Detection of human herpesvirus-6 in paraffin-embedded tissue of cervical cancer by polymerase chain reaction

Journal of Virological Methods 47 (1994) 297-305

ELSEVIER

Journal of Virological Methods

Detection of human herpesvirusin paraffin-embedded tissue of cervical cancer by polymerase chain reaction Hong Wang”, Michael Chena, Zwi N. Bernemanb, Gregorio Delgado”, Joseph, A. DiPaoloa2* “Laboratory of Biology, Bldg 3712419, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA, ‘Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, MD 20892, USA, ‘Department of Obstetrics and Gynecology, Stritch School of Medicine, Loyola University, Maywood, IL 60153, USA

(Accepted 4 November 1993)

Abstract The polymerase chain reaction (PCR) was used to detect human herpesvirus(HHV-6) DNA sequences from paraffin-embedded tissue from cervical cancer patients. Two of eight cases were positive for HHV-6 using two sets of HHV-6 primers. Hybridization of PCR products with specific radioisotope-labeled oligonucleotide probes confirmed the results. Furthermore, HHV-6 typing was possible by adapting restriction endonuclease digestion of PCR product. This method is useful for retrospective studies in investigating the etiologic role of HHV-6 in the development of human diseases. Key words: Polymerase

chain reaction;

HHV-6; Paraffin-embedded

tissue; Cervical cancer

1. Introduction Human herpesvirus (HHV-6) was first isolated in 1986 from the peripheral blood lymphocytes of patients with AIDS and lymphoproliferative disorders (Salahuddin et al., 1986). Since then, detection of HHV-6 has been reported from healthy individuals (Gopal et al., 1990) and patients with various diseases such as exanthem subitum (Yamanishi et al., 1988), chronic fatigue syndrome (Ablashi et al., 1988), Hodgkin’s lymphoma (Torelli et al., 1991), and non-Hodgkin’s lymphoma (Jarrett et al., 1988). Southern blot, PCR, and hybridization in situ have been used to detect HHV6 DNA sequences from lymph nodes, peripheral blood lymphocytes, and infected *Corresponding

author.

Fax: + 1 (301) 4963238.

0166-0934/94/$07.00 0 1994 Elsevier Science B.V. All rights reserved SSDI 0166-0934(93)E0152-R

298

H. Wang et al./Jownal of Vidogical

Methods 47 /1994/ 297-3Q5

cell lines (Buchbinder et al., 1988, Ablashi et al., 1991, Collandre et al., 1991). Except for ~~~~~~~~ ~M~~tu~~the relevance of HHV-6 to diseases remains to be established. The need for a simple, fast, and specific method is obviously urgent. PCR can be used to screen samples either from throat swabs (Kido et al., 1990), blood cells, or tissue biopsies. The tropism of HHV-6 is not confined to T cells (Tedder et al., 1987). HHV-6 can replicate in vitro in human epithelial cells, and molecular clones of HHV-6 can transactivate Fa~il~omavirus promoters in vitro (Chen et al., 1994). Thus, HHV-6 is not solely l~photro~ic and may be distributed in a variety of cells. The PCR method to detect HHV-6 in fixed tissue of tumors may contribute to investigation of the possible etiologic role of HHV-6 in tumorigenicity. Furthermore, retrosp~tive studies become possible because archived paraf~n blocks are suitable for PCR detection (Shibata et al., 1988). Reliable results can be obtained by using a set of ‘external’ and ‘internal’ HHV-6 primers with ‘nested’ PCR (Klotman et al., 1992). Furthermore, HHV-6 PCR products can be digested by some enzymes and analysis of the resulting polymorphism used for subtyping HHV-6. Lastly, all PCR products were probed with radioisotope-labeled oligonucleotides to confirm the PCR amplification. In this study two of eight specimens of paraffin-em~dded cervical carcinoma were found to be HHV6 positive by PCR methods.

2. Materials and methods

Para~n-embedded tissue blocks of cervical squamous carcinomas were obtained from Foster G. McGaw Hospital, Loyola University of Chicago. Tissue sections were cut by American HistoLab, Inc. (Gaithersburg, MD) using a new disposable razor blade for each specimen. The preparation of DNA from tissue sections for PCR amplification followed Ting and Manos’ method (Ting and Manos, 1990). 2.2. PCR assay DNA extracted from 20, 5 pm sections was dissolved in 20 ,ul 1 x TE (pH 8.0) and stored at 4°C. One ,pl was used in each 100 ~1 PCR reaction. The reaction buffer consisted of 50 mM KCl, 10 mM Tris-HCl (pH 8.3) and 0.001% (w/v) gelatin, IS mM MgC12, 100 ,uM of each dNTP, Taq polymerase 2.5 U (Perkin Elmer Corp, Norwalk, CT), 0.2 L(.Mof each primer, and 1 ~1 of DNA template. Genomic DNA (1 ng/$) extracted from a lymphocyte cell line infected with GS strain of HHV-6 was used as a positive control (Ablashi et al., 1988). The primers and oligonucleotide probes used are given in Table 1, and an HHV-6-negative T-cell line HUT 78 (1 pg/ ~1) was used as a negative control (Berneman et al., 1992). Before adding the polymerase, 100 of mineral oil was layered over the reaction buffer, heated at 95°C for 5 min (hot start), and chilled in an ice water bath. Forty cycles of PCR am~li~cation were performed in a DNA Thermal Cycler 480 (Perkin Elmer Carp, Norwalk, CT).

H. Wang et al.lJ~M~al

of Virologicd Methods 47 (19943 297-305

299

Table 1 Primers, probes, and references Sequence

PCR product

Reference

I. External primer pair H6-8

T-CAGTGTGTAGTTCGGCAGCCCCGAG-3

a 549 bp

H6-6

T-AAGCTTGCACAATGCCAAAAAACAG-3

b

2. Internal primer pair H6-7 SXTCGAGTATGCCGAGACCCCTAATC3:ep

b 112 bp

H&6/7

5’-AACTGTCTGACTGGCAAAAACTTT-3

b

Probe H6-9

S-GTGCGTGATC~GAATG~AC~-3

c

3. A, C primers S-GATCCGACGCCTACAAACAC-3 A

d 830 bp

C

S-CGGTGTCACACAGCATGAACTCTC-3

d

S-probe

f-GGCTGATTAGGAT-I’AATAGGAGA-3’

d

‘Klotman et al. 1993. bGopal et al. 1990. H6-6/7 has one T less at the 3’ end. ‘Corbellino and Lusso, unpublished data. dAubin et al. 1991.

Each cycle consisted of denaturing at 94°C for 1 min, annealing at 55°C for 1 min, extending at 72°C for 1.5 min with increasing 2 s per cycle, and finally extending at 72°C for 7 min before storingat 4°C. 2.3. Nested PCR Thirty amplification cycles were run with the two external primers. One ,ul of the amplified products was carefully removed from the tube and added to the PCR reaction solution, which was prepared with the two internal primers (nested primers) and PCR carried out using the same conditions as above. The PCR products were analyzed by electrophoresis on 2.5% agarose gels (0.5 x TBB, 4 mm thick) and visualized on a UV transilluminator. 2.4. Hybridization of PCR products The amplified DNA products were blotted onto GeneScreen Plus (DuPont NEN Research Products, Boston MA). The membranes were prehyb~dized for 20 min at 52.5”C in hybri~zation buffer (QuikHyb, Stratagene, La Jolla CA)’ and hyb~dized in the same buffer with the addition of 10 pg of sheared DNA (Research Genetics, Huntsville, AL) per ml and 2 x IO6 dpm/ml of T4-polynucleotide kinase-labeled

H. Wang et ai./.Iournal of Yirological Methods 47 (1994) 297-305

300

oligo probe (Lofstrand Labs Limited, Gaithersburg MD) at 52.5”C for 2 h, washed with 2 x SSC, 0.5% SDS 20 min at room temperature; twice at 42°C and once stringently (0.1 x SSC, 0.1% SDS) at 55°C for 20 min. Exposure time for autoradiography ranged from I h to overnight at -70°C.

3. Results 3.1. Amplification of HHV-6 sequence 3.1.1. External and internal primers The expected ampli~~ation products were seen in 2 of 8 specimens at the 549 and 112 bp positions, respectively (Fig. 1A). Sample 2 was positive for PCR amplifica-

(2% 1234567891011

03 1234

5

67891011

&OO600-

loo-

Fig. I. Ampli~cation of HHV-6 DNA from paraffin embedded tissue of cervical cancer by external, internal primers and nested PCR. (A) Agarose gel electrophoresis of amplified products visualized by ethidium bromide staining. (B) Hybridization of amplified PCR products corresponding to (A) with H69 probe. Lane 1 is 100 bp molecular weight marker; lanes 2 and 4 are positive controls of external and internal PCR products 549 and Il.2 bp, respectively, while lanes 3 and 5 are negative controls. Lanes 6 to 8 are sample 2 amplified by external, internal primers and nested PCR, respectively, while lanes 9 to 11are sample 1 with the same order as sample 2. Lane 6 was shown up after longer exposure (data not shown).

H. Wang et al./Journal of Virological Methods 47 (1994) 297-305

301

tion by both external and internal primers, while sample 1 was negative by external primers. Nested PCR was performed using external primer amplified PCR products as template for internal primer amplification; both samples were positive (Fig. 1A). 3.2.2. A, C primers By adapting A, C primers to amplify HHV-6 was observed. Both samples had strong bands staining.

sequences, an 830 bp PCR product as visualized by ethidium bromide

3.2. Specificity of PCR amplification The PCR products of external and internal primers were hybridized with H69 oligo probe which is located in a sequence between the two internal primers. The expected 549 and 112 bp bands were observed (Fig. 1B). The band at the 500 bp position (Fig. lB, lane 2) is lower than that of 549 bp, and its intensity is much less than that of the 112 bp band (lane 4). It represents a nonspecific artifact due to the extreme sensitivity of PCR, especially true for PCR hybridization of nested PCR products. The 830 bp band was also hybridized with the S-probe (Fig. 2B). No primer used amplified HHV-7, a new herpesvirus strain found in T lymphocytes from healthy adults (Frenkel et al., 1990) and in peripheral blood mononuclear cells from patients with chronic fatigue syndrome (Berneman et al., 1992) (data not shown.)

1 2 3 4 5 6 7 8 9 10 11 1213141516

Fig. 2. Enzymatic digestion pattern of A, C primer amplified PCR products. (A) Agarose gel electrophoresis of amplified products, lanes 2, 7, and 12, digested with enzyme Hind111 (lanes 3, 8, and 13) Hinfl (4, 9, and 14), TaqI (5, 10, 15) and BgnI (6, 1I, and 16) respectively. Lane 1 shows base pairs of 100 bp molecular weight marker; lanes 2 to 6 are positive controls of HHV-6 (group A), whereas lanes 7 to 11 and 12 to 16 are samples 1 and 2, respectively. (B) Southern blot of 830 bp amplified products corresponding to panel (A) with S-probe. The remaining bands at 830 bp position in Lane 11 (A and B) indicate a partial digestion of PCR product with Bg/II.

H. Wang et aLlJournal of Virological Methods 47 (1994) 297-305

302

12

3

4

5

6

7

8

910111213

141516

Fig. 2. Continued

3.3. HHV-6

typing

The restriction enzyme digestion pattern of A, C primer amplified PCR product (830 bp), visualized by ethidium bromide in gels and as well as by hybridization with 32P-labeled S-probe was determined (Fig. 2A and B). Sample 1 pattern is similar to the positive control, GS strain group A, while sample 2 belongs to group B (Abiashi et al., 1991; Aubin et al., 1991). Although sufficient amplified DNA was loaded as

Table 2 Restriction

enzyme patterns

Restriction

enzyme

of the 830-bp fragment Fragment Sample

obtained

by PCR

Size (bp)”

1 (group A)

Sample 2 (group

Hind111

830

610 220

Hi&I

530 110 100 90

220 300 200 150 100 90

TaqI

630 200

630 200

BglII

530 300

530 300

“The fragment

size was estimated

by its running

position

in agarose

gel.

B)

H. Wang et al./Journal

of Virological Methods 47 (1994) 297-305

303

visualized by ethidium bromide staining, the hybridization signals were weaker for group B than for group A (sample 2 compared to either positive control or sample 1, Fig. 2B), indicating lower affinity for group B than group A to S-probe. The polymorphism of two samples is shown in Table 2.

4. Discussion Two of eight paraffin-embedded cervical carcinoma specimens were found to be HHV-6 positive by multiple sets of PCR primers. Because only two of the tested samples were positive, it is highly unlikely that cross-contamination was responsible. Moreover, one sample was subtyped into variant B which differs from the positive control, variant A. Thus, the possibility of contamination by HHV-6 positives is excluded. Because HHV-6 has not been causally linked (except for exanthem subitum) to specific diseases, its presence is being investigated in a variety of diseases. Interestingly, when a molecular probe of HHV-6, pZVH-14 was used to investigate DNA from lymphoma tissue in conjunction with Southern analysis or PCR using a set of primers, a low frequency of positive cases was observed (3/25 Hodgkin’s lymphoma, Torelli et al., 1991; and 2/53 cases of non-Hodgkin’s lymphoma, Jarrett et al., 1988). The significance of positive cases of cervical carcinomas with HHV-6 will have to await analysis of additional cervical carcinomas. However, it should be pointed out that HHV-6 can infect genital cells immortalized by recombinant human papillomavirus-16 and preliminary in situ data suggest that two viruses in rare cases can coexist in the same cell (Chen et al., 1994). Due to the extreme sensitivity of PCR plus PCR hybridization, interpretation of results should be interpreted cautiously. As shown in sample 2, the external primers could amplify a 549 bp fragment detected only by nested PCR or hybridization but not by PCR. A strong 830 bp band was visualized by ethidium bromide staining in gels as well as in hybridization with another set of primers (Fig. 2). Thus, more than one pair of primers should be used for routine screening or for clinical diagnosis. For example, the use of external and internal primers for PCR amplification and the combination of PCR hybridization with radioisotopic detection will produce reliable results. Furthermore, an additional pair of primers (A and C) can be utilized to detect subtypes because the classification of HHV-6 subtypes is based in part on polymorphism of the viral genome. However, at this time it is not possible to distinguish the two variants on the basis of clinical observations. It is possible that PCR analyses of additional cervical samples will contribute to distinguishing pathologic changes that may be attributable to molecular properties of either variant A or B. The current results, utilizing cervical cancers as well as adherent embryonic, lung, and glia cells (Tedder et al., 1987), indicate that HHV-6 is not restricted solely to lymphocytes; a wider spectrum of cancers or diseases should be examined to study the distribution of HHV-6 and its possible etiologic role. This method of amplification of HHV-6 DNA sequences and typing by PCR from paraffin-embedded tissue from pathologic sections of lymph nodes or solid tumors, such as cervical, esophageal, and hepatocellular carcinoma enable epidemio-

304

H. Wang et al./Journal of Virological Methods 47 (1994) 297-305

logic retrospective studies regarding a possible etiologic role for HHV-6. PCR products from three pairs of primers did not hybridize with other herpesviruses such as herpes simplex virus-l and -2, Epstein-Barr virus, human cytomegalovirus, varicellazoster virus (Buchbinder et al., 1988, Collandre et al., 1991), or HHV-7 in this study. Thus, the PCR method is specific. When hybridization with labeled oligonucleotides is combined with PCR detection, the sensitivity is increased dramatically. The procedure is fast, simple, and useful for routine screening for clinic diagnosis as well as in basic research.

5. References Ablashi, D.V., Josephs, S.F., Buchbinder, A., Hellman, K., Nakamura, S., Llana, T., Lusso, P., Kaplan, M., Dahlberg, J., Memon, S., Iman, F., Ablashi, K.L., Markham, P.D., Kramarsky, B., Krueger, G.R.F., Biberfeld, P., Wong-Staal, F., Salahuddin, S.Z. and Gallo, R.C. (1988) Human Blymphotropic virus (human herpesvirus-6). J. Virol. Methods 21, 2948. Ablashi, D.V., Balachandran, N., Josephs, S.F., Hung, C.L., Krueger G.R.F., Kramarsky, B., Salahuddin, S.Z. and Gallo, R.C. (1991) Genomic polymorphism, growth properties, and immunologic variations in human herpesvirusisolates. Virology 184, 545-552. Aubin, J.T., Collandre, H., Candotti, D., Ingrand, D., Rouzioux, C., Burgard, M., Richard, S., Huraux, J.M. and Agut, H. (1991) Several groups among human herpesvirus 6 stains can be distinguished by Southern blotting and polymerase chain reaction. J. Clin. Microbial. 29, 367-372. Berneman, Z.N., Ablashi, D.V., Li, G., Eger-Fletcher, M., Reitz, MS., Hung C.L., Brus, I., Komaroff, A.L. and Gallo, R.C. (1992) Human herpesvirus 7 is a T-lymphotropic virus and is related to, but significantly different from, human herpesvirus 6 and human cytomegalovirus. Proc. Nat]. Acad. Sci. USA 89, 10552-10556. Buchbinder, A., Josephs, S.F., Ablashi, D.V., Salahuddin S.Z., Klotman, M.E., Manak, M., Krueger, G.R.F., Wong-Staal, F. and Gallo, R.C. (1988) Polymerase chain reaction amplification and in situ hybridization for the detection of human B-lymphotropic virus. J. Virol. Methods 21, 133-140. Chen, M., Popescu, N., Woodworth, C., Berneman, Z., Corbellino, M., Lusso, P., Ablashi, D.V. and DiPaolo, J.A. (1994) Interaction of human papillomavirus and human herpesviruswithin cervical cells. J. Viral. 68, 1173-l 178. Collandre, H., Aubin, J.T., Agut, H., Bechet, J.M. and Montagnier, L. (1991) Detection of HHV-6 by the polymerase chain reaction. J. Viral. Methods 31, 171-189. Frenkel, N., Schirmer, E.C., Wyatt. L.S., Katsafanas, G., Roffman, E., Danovich, R.M. and June, C.H. (1990) Isolation of a new herpesvirus from human CD4+ T cells. Proc. Natl. Acad. Sci. USA 87, 7488 752. Gopal, M.R., Thomson, B.J., Fox, J., Tedder, R.S. and Honess, R.W. (1990) Detection by PCR of HHV-6 and EBV DNA in blood and oropharynx of healthy adults and HIV-seropositives. Lancet 335, 15988 1599. Jarrett, R.F., Gledhill, S., Qureshi, F., Crae, S.H., Madhok, R., Brown, I., Evans, I., Krajewski, A., O’Brein, C.J., Cartwright, R.A., Venables, P. and Onions, D.E. (1988) Identification of human herpesvirus 6-specific DNA sequences in two patients with non-Hodgkin’s lymphoma. Leukemia 2, 496502. Kido, S., Kondo, K., Kondo, T., Morishima. T., Takahashi, M. and Yamanishi, K. (1990) Detection of human herpesvirus 6 DNA in throat swabs by polymerase chain reaction. J. Med. Virol. 32, 1399142. Klotman, M.E., Lusso, P., Bacchus, D., Corbellino, M., Jarrett, R.F. and Berneman Z.N. (1993) Detection of human herpesvirus 6 and human herpesvirus 7 by PCR amplification. In: Persing, D.H. (Ed.), Diagnostic Molecular Microbiology, Mayo Foundation, Rochester, pp. 501-509. Salahuddin, S.Z., Ablashi, D.V., Markham, P.D., Josephs, S.F., Sturzennegger, S., Kaplan, M., Halligan, G.. Biberfeld, P., Wong-Staal, F., Kramarsky, B. and Gallo, R.C. (1986) Isolation of a new virus,

El. Wang et aLlJournal of Virological Methods 47 (1994) 297-305

30s

HBLV, in patients with iymphoproliferative disorders. Science 234, 596-601. Shibata, D.K., Amheim, N. and Martin, W.J. (1988) Detection of human papilloma virus in paraffinembedded tissue using the polymerase chain reaction. J. Exp. Med. 167, 225-230. Tedder, R.S., Briggs, M., Cameron, C.H., Honess, R., Robertson, D. and Whittle, J-i. (1987) A novel lymphotropic herpesvirus. Lancet ii, 39&391. Ting, Y. and Manos, M.M. (1990) Detection and typing of genital human papi~iomaviruses. In: M. Innis, D. Gelfand, J. Sninsky and T. White (Eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, pp. 356367. Tore% G., Marasca, R., Luppi, M., Selleri, L., Ferrari, S., Narni, F., Mariano, M.T., Frederico, M., Ceccherini-Nelli, L., Bendinelli, M., Montagnani, G., Montorsi, M. and Art&, T. (1991) Human herpesvirus- in human lymphomas: identification of specific sequences in Hodgkin’s lymphomas by polymerase chain reaction. Blood 77, 2251-2258. Yamanishi, K., Okuno, T., Shiraki, K., Takahashi, M., Kondo, T., Asano, Y. and Kurata, T. (1988) Identification of human herpesvirus- as a causal agent for exanthem s&turn.. Lancet i, 1065-1067.