Detection of hepatitis B virus sequences in serum by using in vitro enzymatic amplification

Journal of Virological Methods, 20 (1988) 227-237 Elsevier

227

JVM 00731

Detection of hepatitis B virus sequences in serum by using in vitro enzymatic amplification D. Larzul’, F. Guiguel, J.J. Sninsky*, D.H. Mack2, C. B&hot3 and J.-L. Guesdonl ‘Laboratoire des Sondes Froides, ‘Unit6 de Recombinaison et d’Expression GtWtique, Insritut Pasteur, Paris, France and 2Department of Diagnostics Research, Cetus Corporation, Emeryville, U.S.A. (Accepted

10 March

1988)

Summary In vitro enzymatic amplification was applied to detect hepatitis B virus (HBV) DNA sequences in serum. This technique, known as the polymerase chain reaction (PCR) was used to amplify a 128 bp DNA fragment including a 112 nucleotide long sequence complementary to a region in the S gene of the HBV genome. Amplified samples were subjected to spot-test hybridization and scintillation counting using a 32P-labeled oligonucleotide probe. A kinetic study, performed for 4 to 32 PCR cycles with a viral particle preparation, showed a time-limited exponential accumulation of the specific amplified DNA fragment. Amplification yield after 32 cycles was at least 4 x lo6 with a detection limit equal to 3 X lo2 viral particles per ml of serum. As the reliability of the PCR technique was greatest for 24 PCR cycles, these conditions were used to develop a quantitative test with a detection limit of 4 x lo4 viral particles per ml of serum. Results of this test were perfectly correlated with those obtained from the classical spot test without amplification. Ethydium bromide stained agarose gel and Southern blot analysis confirmed the specific amplification of the 128 bp HBV DNA fragment. Polymerase fication

Correspondence 15, France.

chain

reaction

to: Dr. D. Larzul,

0166-0934/881$03.X)

(PCR);

Laboratoire

@ 1988 Elsevier

Science

Hepatitis

B virus

des Sondes Froides.

Publishers

(HBV);

Institut

B.V. (Biomedical

Diagnosis;

Pasteur,

Division)

Quanti-

75724 Paris Ckdex

228

Introduction Serological markers are commonly used for the diagnosis of hepatitis B viral infection (Losowsky, 1980; Gust, 1982) and the HBe-Agianti-HBe antibody status is a particularly good marker of viral replication (Scotto, 1982; Lok, 1984). More recently, HBV DNA detection (Scotto, 1982; Weller, 1982) has been shown to be one of the most direct and reliable tests for HBV multiplication (Berninger, 1982; BrCchot, 1982). Experiments in chimpanzees injected with HBV contaminated sera have determined that a concentration of 10’ particles per ml was required to establish infection (Prince, 1983). Unfortunately, all HBV DNA detection tests reported to date have a detection limit ranging from 10” to lo5 particles/ml (B&hot. 1982; Scotto, 1982; Weller, 1982), i.e. 10’ above the infectivity limit concentration. This technological limitation poses serious problems for the diagnosis of infectivity and for the surveillance of HBV carriers. We have adapted a new technique known as the polymerase chain reaction (PCR) (Saiki, 1985) in order to address this problem. This technique is based on a specific amplification of a short DNA fragment framed by two opposite strand complementary synthetic oligonucleotides used as primers by a DNA polymerase. As each newly synthesized DNA strand is itself a template for the PCR primers, a theoretical exponential amplification of the specific DNA fragment is expected after repeated cycles. An amplification yield of 2 x lo5 was observed after 20 cycles of denaturation, annealing and extension (Saiki, 1985). We now report the results of a new HBV DNA detection test using the PCR to specifically amplify a part of the HBV genome in serum.

Materials

and Methods

Serological studies Hepatitis markers, HBs-Ag, HBe-Ag and anti-HBe, were sought by means of standard radioimmunoassay (Abbot Diagnostics). All sera used in this study were HBs-Ag positive. Sera SO, Sl, S2, S4, SlO, Sll and S13 were HBe-Ag negative and anti-HBe positive. Sera S3, S.5, S6. S12, S14, S15, S16, S17, S18 and S19 were HBe-Ag positive and anti-HBe negative. Oligonucleotide sequence determination Primers and probe sequences were determined from alignment of five human HBV sequences (Fig. 1) of subtypes adw, adr and ayw. MD03 and MD06 primers. and the MD09 probe were selected in conserved regions of the S gene with a very low number of potential mismatches, i.e. two for MD09, one for MD06 and no mismatches for MD03. Each primer carried an additional 5’ restriction site for eventual cloning. Hind111 for MD03 and BamHI for MD06. These primers directed the amplification of a 128 bp DNA fragment containing a sequence of 112 nucleotides specific for the HBV genome.

229 MD03 5’ CTCAAGCTTCATCATCCATATA MD06 5’ CTTGGATCCTATGGGAGTGG MD09 5’ GCCTCAGTCCGTTTCTClTGGCTCAGTlTACTAGTGCCATl-TGllC

Fig. 1, Sequences of oligonucleotide primers and probe and their relation to the target HBV genome. In MD03, the 13 nucleotide long sequence at the 3’ end is partially complementary to the (+) strand and an additional Hind111 site is carried by the 5’ end. In MD06, the 13 nucleotide long sequence at the 3’ end is partially complementary to the (-) strand and an additional BumHI site is carried by the 5’ end. MD09 is complementary to the (-) strand and is positioned immediately after the 3’ end of the MD06 primer.

Sample treatment Sera were treated to extract nucleic acids as described elsewhere (Larzul, 1987). Briefly, sera were incubated for 1 h at 70°C with proteinase K (Boehringer, Mannheim) at 2.5 mg/ml in 25 mM sodium acetate, pH 6.5, containing 2.5 mM EDTA and 0.5% SDS. After one phenol and one diethyl ether extraction, samples were incubated for 30 min at 68°C to eliminate the diethyl ether. Preparation of viral particles Viral particles were purified from the serum of a chronic HBs-Ag carrier by using a discontinuous sucrose gradient (Budkowska, 1986). In a 12 ml polypropylene centrifuge tube, 5 ml of serum were loaded onto a 6 ml discontinuous sucrose gradient containing an equal volume of 10, 20 and 30% sucrose in 10 mM Tris-HCl, pH 7.8, containing 50 mM NaCl. After a 4 h centrifugation at 220000 x g, the pellet was resuspended in 10 mM Tris-HCl, pH 7.8. containing 50 mM NaCl and 1 mM EDTA. The concentration of viral particles in this preparation was determined by dot-blot (Scotto, 1982) using a known preparation of recombinant X HBV bacteriophage particles (Kuhns, 1984). Viral particle preparations to be amplified were treated with proteinase K as described above. Amplification technique Ten microliters of the partially purified DNA to be amplified were added to 90 ~1 of a buffer containing 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 10 mM MgCl,, 10 mM dATP, 10 mM dTTP, 10 mM dCTP, 10 mM dGTP, 10% DMSO, 10 p_M MD03 and 10 ~.LMMD06. One amplification cycle included denaturation for 2 min at 95°C (5 min for the first cycle), primer annealing for 1 min at 20°C polymerase extension for 2 min at 37°C after addition of the Klenow fragment of Escherichia cofi polymerase I (1 unit, Amersham, U.K.). The temperatures indicated for one cycle were those applied to the Eppendorf tube and not to the sample. After 4, 8, 12, 16, 20, 24, 28 or 32 cycles, an additional denaturation was performed to inactivate DNA polymerase.

230

Dot blot Twenty-five percent of the total amplification products were denatured for 6 min at 95°C and cooled immediately in ethanol/dry-ice. Denatured samples were spotted on nylon membranes (HybondTM, Amersham, U.K.) using a vacuum filtration apparatus (SRC096 Minifold I, Schleicher and Schuell, Keene, U.S.A.). The filter was treated for 1 min in a mixture of 0.5 M NaOH and 1.5 M NaCl, neutralized for 1 min in 0.5 M Tris containing 3 M NaCl and finally irradiated at 302 nm for 2 min per side on a transilluminator table. Five picomoles of the MD09 oligonucleotide were “2P-labeled with T4 polynucleotide kinase (Amersham. U.K.) for 30 min at 37°C in 100 mM Tris-HCl, pH 7.6, 20 mM MgCl,, 10 mM dithiothreitol, 0.2 mM spermidine, and 0.2 mM EDTA in a final volume of 30 ~1. The enzymatic reaction was stopped by 2 ~1 of 250 mM EDTA and the “‘P-labeled MD09 probe purified on a G50 column (Pharmacia. Sweden) equilibrated in 10 mM Tris-HCl, pH 7.8, 1 mM EDTA and 0.1% SDS. Prehybridization of the filter was performed for 1 h at 42°C in 30% formamide, 5 x SSC, 2 x Denhardt. 10% dextran sulfate, 150 kg/ml denatured salmon sperm DNA (1 X SSC= 0.15 M NaCl; 0.015 M sodium citrate), and hybridization for 14 h at 42°C in the same buffer with the “Plabeled MD09 probe at 0.15 pmoliml (specific activity: 2.2-2.9 &i/pmol). The filter was washed three times in 2 x SSC, 0.1% SDS for 10 min at room temperature, and twice for 30 min at 58°C in 0.2 X SSC. 0.1% SDS. Then, each spot was cut and counted separately in an automatic liquid scintillation system (MR300. Kontron). A standardization of these results (in countsimin) was necessary to compare values obtained from different experiments. Then a reference HBV DNA positive serum was used in each experiment allowing standardization of the cpm values. Southern blot For the Southern blot. 25% of the PCR product was electrophoresed on agarose gel composed of 4% Nusieve (FMC Corporation) and 0.5% agarose (Sigma. U.S.A.) and stained with ethydium bromide to visualize DNA. Then the gel was incubated twice for 12 min in 0.5 M NaOH, 1.5 M NaCl and twice for 20 min in 0.5 M Tris-HCI, pH 7.8, 3 M NaCl. Nucleic acids were passively transferred for 10 h to a nylon membrane (Hybond) and the filter was treated for UV irradiation. hybridization and washing as described in the dot-blot experiment. Autoradiography was performed at -80°C with Kodak XAR-S film and an intensifying screen.

Results PCR was used to amplify a 112 nucleotide sequence in the S gene of the HBV genome. The two opposite strand complementary oligonucleotides. MD03 and MD06, were used as primers by the DNA polymerase (Klenow fragment) to control the PCR amplification of a 128 bp DNA fragment including the 112 nucleotides HBV sequence. Primer and probe sequences (Fig. 1) were included in a conserved region of the HBV genome as determined by comparative study of sequences

231 CPM

a

lo6 105

104 6

lo3

10*

I&

*

I

I

12

16

24

20

28

32

CYCLES

EPR lo6 32C 28C 24C

105

2oc

104

16 C

lo3

102

I,

lo2 Fig.

,

lo3

I

lo4

I

lo5

,

io6

2.

10'

lo8

lo9

PIRTICLES tEl Mt.

Kinetic study of the polymerase chain reaction from 4 to 32 cycles. Seven dilutions, ranging were obtained from a viral particle preparation after proteinase K treatment. [I]: 3 X lo’, [2]: 3 X lo’, 131: 3 x 10h, 141: 3 x 105, [5]: 3 x 104, [6]: 3 x I@, 171: 3 x 10’ particles/ml. (a) In a first experiment, eight samples of each dilution were PCR amplified for 4, 8, 12, 16, 20, 24, 28 or 32 cycles. The amplification step was followed by dot-blot hybridization analysis. The bound radioactivity is plotted against the number of cycles. The broken line represents results obtained with an HBV DNA negative serum. (b) In a second experiment, one sample per dilution was PCR amplified for a given number of cycles 14, 8, 12, 16, 20, 28 and 32 cycles). The amplified material was analyzed by dot-blot hybridization. Specifically bound radioactivity was plotted against the viral particle concentration when the cpm value reached at least three times the background value. For 4, 8 and 12 cycles, the hybridization signal was not significantly different from the negative control. Arrows show the cpm value for each curve obtained with an HBV DNA negative control serum, from 3 x IOx to 3 x 10’ viral particles/ml.

232

from subtype adw, adr and ayw. In a kinetic study. variations of the amplified DNA fragment quantities were estimated during PCR using dilutions from a standard viral particle preparation. Subsequently, sera were used directly to develop a quantitative test for evaluation of viral particle concentration. Kinetic study A viral particle preparation from the serum of a HBs-Ag chronic carrier containing lox particles per ml was used to determine the amplification kinetics for 4 to 32 cycles and for evaluation of test sensitivity. Nucleic acids were extracted from the concentrated viral particles preparation (at 3 x 10’ particles/ml) and then serially diluted to equivalent particles per ml concentrations ranging from 3 x 108 to 3 x 10’. For each of the 10-fold dilutions, eight samples were amplified simultaneously and stopped after 4. 8, 12. 16, 20, 24. 28 or 32 cycles (Fig. 2a). In addition, seven samples, one of each dilution, were amplified with the same number of cycles, namely 4, 8, 12, 16, 20. 24, 28 or 32 cycles (Fig. 2b). The amplification yield (Y) is related to the efficiency per cycle (x) by the following expression: Y= (l+ x)‘, where n is the number of cycles. Curves in Fig. 2a show an exponential increase of specific amplified DNA during a first period (with an efficiency per cycle of up to 70%) and. in a second period, inflexion of the curves indicating a decrease of the efficiency per cycle. The duration of the exponential increase is inversely related to the initial viral particle concentration of the sample. For example, in curve 1. this period ran from 3 to 20 cycles and the efficiency per cycle decreased progressively from 72 to 70%. Thereafter. the efficiency dropped from 70 to 6%. For curves 1 to 6. the efficiency of the 28th cycle was 13, 22, 54, 68. X2 and 82%). respectively. Similarly, when the radioactive signal reached 10” cpm. the efficiency of the preceding cycle ranged from 80 to 90% for curves 2 to 7. respectively. After TABLE Reliability Parameter

1 of the amplification

test

Serum Sl

S?

s3

S1

s5

1.o 10” I IO”

1.1 lo*

1.6 IO”

0.2 IO”

0.2 10h

Sh

24 c\c/r.s M SD Cv

nd nd nd

nd nd nd

3.0. 10” 0.5 10” 16

0.

9

I?

I7

32 cukr M SD Cv

1.0 107 0.6 lo1 63

3.1 lo7 0.8 10’ 2.5

2.1 lOi ?.‘I IO 113

1.5 10; I .2 lo81

nd nd nd

nd nd nd

DNA was extracted from six HBs-Ag positive sera (Sl to Sh) and treated in quadruplicate for 2J cycles amplification (S3 to S6) and for 32 cycles (St to S4). After dot-blot hybridization. viral particle concentrations were deduced from curves 24~ and 32c in Fig. 2h. From the four values obtained for each serum, the following parameters were calculated: the arithmetic mean (M). the standard deviation (SD), and the coefficient of variation in ri (CV). nd = not determined.

233

32 cycles and with the lower dilution (at 3 x lo* particles per ml), a positive/negative ratio equal to 3 was obtained. Amplification yield cannot be calculated from these experiments, but we can estimate a minimal value. After 32 cycles, the amplification yield of dilution 1 (3 X lo8 particles per ml) was at least 10” with a cpm value of 280000. The radioactive signal was 1000 cpm for dilution seven (3 x lo2 particles/ml) after the same number of cycles, namely a radioactive signal ratio of 280 between dilution one and seven. As the amount of HBV DNA before PCR was 10” times greater in dilution one than in dilution seven, we were able to deduce a minimum amplification yield for dilution seven after 32 cycles, namely 3.6 x 10” (10’ x lO”1280). Curves from Fig. 2b confirm these estimates as evidenced by the relative positions of curves 1 to 7 and by the detection limit of 3 x lo* particles per ml obtained after 32 cycles.

Detection of HBV sequences in serum The results shown in Fig. 2b were exploited to develop a quantitative assay for the evaluation of viral particle concentration in serum. To determine the number of cycles to be used in a quantitative assay, the reliability of the method was evaluated for 24 and 32 cycles by testing six sera (Sl to S6) in quadruplicate. Sera Sl to S6 were treated for DNA extraction and each of them was PCR amplified in quadruplicate for 24 cycles (S3 to S6) or 32 cycles (Sl to S4). After dot-blot hybridization and scintillation counting, the viral particle concentrations were deduced from curves 24c and 32c of Fig. 2b. After 24 cycles, the four estimated concentrations were obtained with a coefficient of variation (CV) of 16, 9, 12 and 12% for sera S3 to S6, respectively. After 32 cycles, a CV of 63, 25, 113 and 81% was obtained for sera Sl, S2, S3 and S4, respectively (Table 1). As the best results were obtained with 24 amplification cycles in the quantitative assay, these conditions were used to diagnose HBV infection in sera (SlO to S19) from 10 HBs-Ag carriers. Results were compared to the spot test performed without amplification (Fig. 3). Nine sera were HBV DNA positive with both tech-

, ,I4

I

0’

Fig. 3. Determination of viral particle concentration in sera (SIO to S19) from ten HBs-Ag carriers. DNA was extracted and PCR amplified for 24 cycles. After dot-blot hybridization, viral particle concentrations were deduced from curve 23~ (Fig. 2b) and compared with results obtained with the usual spot test (ST) (without PCR).

234

niques and the relative classification of the sera was similar. It is noteworthy, however, that serum S12 was considered HBV DNA negative without amplification. whereas it was found to be positive after 24 PCR cycles at a concentration of 4 x lo4 particles/ml. This value was 2.5-fold lower than the detection limit of the classical spot test (10’ particles/ml). Serum SO, at 10’ particles per ml, was treated with proteinase K and PCR amplified for 24 cycles. The 128 bp amplified DNA fragment from this serum was clearly visualized on an agarose gel (Fig. 4 I, Lane b). The estimated amount of DNA contained in this band was 100 ng. As approximately 0.13 pg of the 128 bp DNA fragment was contained in the volume (10 ~1) used for PCR amplification. the amplification yield was 3 x 10”. A strong hybridization signal was obtained from DNA amplified from the HBV-recombinant plasmid pCPl0 (Dubois. 1980) (Lane a) and from serum SO (Lane b). No detectable signal was obtained with the HBV DNA negative serum (Lane c) or with samples without amplification (not shown) even after three days’ exposure.

a

b

c

t30bp

Fig. 4. Ethydium bromide stained agarose gel and Southern analysis of PCR amplified DNA from serum. (Lane a): 100 ng of amplified HBV DNA fragment from an HBV recombinant plasmid pCPI(I (Dubois. 1980). (Lanes b and c): 25% of the 24 cycle amplified product from SO (at 10’ particles/ml) and an HBV DNA negative serum respectively. (I): Ethydium bromide stained agarose gel. (II): Southern analysis of the same gel. Hybridization was performed with the “P MD09 probe labeled at 2.7 ~Ciipmol and the autoradiographic time ww I h.

235

Discussion The present study describes a new system for HBV sequence detection in human sera with a detection limit of 3 x 10’ particles per ml. This value approaches the extreme figure of 10’ particles per ml which was estimated to be the lowest infectious serum concentration in the chimpanzee. Exponential amplification shown in Fig. 2 confirms the observations of Saiki et al. (1985) with 20 cycles. Nevertheless, the efficiency for each subsequent cycle decreased dramatically to 6% for the 32nd cycle in curve 1 for example. This effect was more pronounced for high viral particle concentrations after a certain number of cycles (20 cycles for instance). On the other hand, for a given radioactive signal (lo3 cpm for instance), the efficiency was practically identical in all dilutions independent of the number of cycles. All these observations show that the amount of amplified DNA fragment in given sample had a prevailing influence on amplification efficiency. In this way, two major factors directly influenced amplification. Firstly, with a primer concentration of 1 FM in an initial sample volume of 100 ~1, all primers were hybridized when the quantity of amplified fragment (128 bp) was 7 kg. In our conditions, at least 100 ng of amplified fragment were visualized with ethydium bromide on an agarose gel (Fig. 4) after 24 cycles for serum SO (10s particles/ml) and between 1 and 10 ug of amplified fragment were obtained after 32 PCR cycles from a sample at 3 x lo8 particles/ml (dilution 1). Secondly, the Klenow fragment could be a limiting factor when a high matrix concentration is used. This hypothesis was consistent with the observation of Erlich et al. (1988) when a thermostable DNA polymerase was used (Ou et al., 1988). The minimum amplification yield of 3.6 x lo6 obtained with a suspension of 3 x 10’ particles per ml after 32 cycles (Fig. 2a) was consistent with the amplification yield of 3 x lo6 after 24 cycles, deduced from an estimation of the DNA amount on agarose gel (Fig. 4 I) using a serum at 10s particles/ml (SO). All these observations were in agreement with the results of Wong et al. (1987) who found an amplification yield of lo6 to 10’ after 30 PCR cycles. Reliability of the quantitative evaluation was estimated after 24 or 32 cycles by treating some sera in quadruplicate (Table 1). After 24 cycles, an acceptable variation in the four estimations was obtained with a coefficient of variation ranging from 9 to 12%. On the other hand, a great variation appeared when 32 cycles were performed; indeed, under these conditions, a coefficient of variation ranging from 25 to 113% was observed. Viral particle concentrations of sera S3 and S4 were evaluated either after 24 cycles (3.0 x lo6 and 1.0 x lo8 particles/ml, respectively) or 32 cycles (1.0 x lo5 and 3.2 x 10’ particles/ml, respectively). The great difference between these two evaluations probably came from the low efficiency of some cycles compared with the optimal PCR curves (Fig. 2) obtained from a great number of experiments. This hypothesis is in agreement with the underestimation of virus concentration after 32 cycles as compared to 24 cycles. There was a perfect correlation between the results obtained after 24 PCR cycles applied to 9 HBs-Ag carrier sera and the classical spot test. One serum had a low viral particle concentration (4 X lo4 particles/ml) indicating a viral replication which was not detected

236

in the spot test without amplification. These results on HBs-Ag carriers confirm the exceptional sensitivity of the amplification technique and this will modify the approach to HBV DNA diagnosis in serum. All sera with a low viral concentration (about lo” particles/ml) which give ambiguous results without amplification and which require a long autoradiographic time (3 days), can give clearly positive results after only 24 PCR cycles. Nevertheless, this technique has to be used under very strict conditions, especially when a quantitative evaluation is required. Small variations in the efficiency per cycle or even viral contamination can have dramatic effects on the final amplification result. For example, if the efficiency per cycle is 60% instead of 70% the amplification yield after 32 PCR cycles will be 7-fold lower than predicted by our results. The extreme sensitivity of the PCR technique after 32 cycles was actually limited by this low reliability. An attenuation of this problem will probably occur when an automatization of the PCR technique coupled with the use of the recently commercialized thermoresistant DNA polymerase will be available.

References Berninger. M.. Hammer. M.. Hoyer, B. and Gerin, J.L. (1982) An assay for the detection of the DNA genome of hepatitis B virus in serum. J. Med. Viral. 9, 57-68. Brechot, C.. Pourcel. C., Hadchouel, M.. Dejean, A., Louise. A., Scotto. J. and Tiollaia. P. (lYX2) State of hepatitis B virus DNA in liver diseases. Hepatology 2, 26-34s. Budkowska. A.. Dubreil. P.. Capel. F. and Pillot, J. (19%) Hepatitis B virus pre-S gene encoded an tigenic specificity and anti pre-S antibody: relationship between anti-pre-S response and recovery. Hepatology 6, 36&36X. Dubois. M.-F., Pourcel. C., Rousset, S.. Chany, C. and Tiollais. P. (1980) Excretion of hepatitis B surface antigen particles from mouse cells transformed with cloned viral DNA. Proc. Natl. Acad. Sci. USA 77. 4549-4553. Erlich, H.A., Gelfand. D.H. and Saiki. R.K. (1988) Specific DNA amplification. Nature (London) 331. 461-462. Gust. I.D. (1082) In: W. Szuness. H.J. Alter and J.E. Maynard (Eds.). Viral Hepatitis. (Franklin Institute, Philadelphia), 129-143. Kuhns, M., Thiers, V.. Courouce. A., Scotto. J.. Tiollais, P. and Brechot. C. (1984) Quantitative dctection of HBV DNA in human serum. In: G.N. Vyas. J.L. Dienstag and J.K. Hoofnagle (Eds.), Viral Hepatitis and Liver Disease. SB17.665 Grune and Stratton, New York-London. Larzul, D., Thiers, V., Courouce. A.M.. Brechot, C. and Guesdon, J.-L. (1987) Non-radioactive hepatitis B virus DNA probe for detection of HBV DNA in serum. J. Hepatol. 5, 199-204. Lok, A.S.F., Hadziyannis, S.J., Weller. I.V.D.. Karvountzis, M.G.. Montjardino. J.. Karayianms. P., Montana, L. and Thomas, H.C. (1984) Contribution of low level HBV replication to continuing inflammatory activity in patients with anti-HBe positive chronic hepatitis B virus infection. Gut 25. 1283-1287. Losowsky. M.S. (1980) The clinical course of viral hepatitis. Clin. Gastroenterol. Y, 3-21. Ou, C.-Y., Kwok. S., Mitchell. S. W.. Mack. D.H., Sninsky, J.J., Krebs, J.W., Feorino, P., Warfeld. D. and Schochctman. G. (1988) DNA amplification for direct detection of HIV-l in DNA of peripheral blood mononuclear cells. Science 239, 29%2Y7. Prince, A.M., Stephan, W. and Brotman, B. (1983) B-propiolactoneiultraviolet irradiation: a review of its effectiveness for inactivation of viruses in blood derivatives. Rev. Infect. Dis. 5. 92-107. Saiki, R.K., Scharf, S., Faloona, F.. Mullis, K.B.. Horn, G.T., Erlich, H.A. and Arnheim. N. (lY85) Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 135c13.54.

237 Scotto. J., Hadchouel, M., Hery, C.. Yvart, J., Tiollais, P. and B&hot, C. (1982) Detection of hepatitis B virus DNA in serum by a simple spot hybridization technique: comparison with results for other viral markers. Hepatology 3. 279-284. Weller, I., Fowler, M., Monjardino, J. and Thomas. H. (1982) The detection of HBV-DNA in serum by molecular hybridization: a more sensitive method for the detection of complete HBV particles. J. Med. Virol. 9, 273-280. Wong, C., Dowling, C.E., Saiki. R.K., Higuchi, R.G., Erlich, H.A. and Kazazian, H.H. (1987) Characterization of B-thalassaemia mutations using direct genomic sequencing of amplified single copy DNA. Nature (London) 330, 384-388.