Detection of putative pathogenicity and virulence genes of Erysiphe pisi using genome-wide in-silico search and their suppression by er2 mediated resistance in garden pea

Microbial Pathogenesis 136 (2019) 103680

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

Detection of putative pathogenicity and virulence genes of Erysiphe pisi using genome-wide in-silico search and their suppression by er2 mediated resistance in garden pea

T

Sheetal M. Bhosle, Nitinkumar Marathe, Malathi Bheri, Ragiba Makandar∗ Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Prof. C.R. Rao Road, Gachibowli, Hyderabad, 500046, India

A R T I C LE I N FO

A B S T R A C T

Keywords: Garden pea Pathogenicity-factors Powdery mildew infection Transcriptional analysis Virulence In silico-gene search

The biotrophic fungus, Erysiphe pisi is the chief causal agent of powdery mildew disease of garden pea. A genomewide search using in-silico approach was carried to detect putative pathogenicity and virulence genes of E. pisi, since information about these genes and their interaction with pea is limited. Nineteen putative pathogenicity gene sequences were detected through genome-wide pathogenicity gene-search and confirmed them to be conserved in E. pisi through genomic PCRs. Fifteen of these genes expressed through reverse transcriptasepolymerase chain reaction (RT-PCR) amplifying expected band size along with fungal and plant specific internal controls. Gene sequencing and annotation revealed them to be Erysiphe-specific. A time course study was carried to monitor expression of nine of these genes through real-time quantitative (qRT)-PCR in Erysiphe-challenged plants of powdery mildew resistant pea genotype, JI-2480 carrying er2 gene and susceptible pea cultivar, Arkel. Expression of these genes was differentially and temporally regulated. They were found mostly related to signaling; cAMP-PKA (cPKA, CRP and AC) and MAPK (MST7) pathways along with MFP, TRE and PEX which are reported pathogenicity factors in other ascomycete members indicating that similar conserved pathways function in E. pisi also. These genes expressed at higher level at initial hours post inoculation (hpi) as early as 6 hpi in Arkel compared to JI-2480 implying them as pathogenicity factors. The elevated level of expression of MFP, TRE, CRP and cPKA gene sequences in E. pisi-challenged JI-2480 genotype at 12 hpi alone suggests these genes to possess a role in avirulence in JI-2480, conferring er2 mediated resistance.

1. Introduction The powdery mildew disease caused by Erysiphe pisi is a serious concern in garden pea (Pisum sativum L.). Previous studies to identify resistance to powdery mildew disease had revealed presence of two recessive genes er1 and er2 in Pisum sativum and one dominant gene Er3 in P. fulvum and these genes are the reported sources that confer resistance to powdery mildew disease in pea [1–4]. Host resistance mechanism as well as the nature of pathogenicity and virulence of E. pisi necessitates investigation to combat powdery mildew disease [5]. The manipulation of the host machinery by the pathogen is demonstrated to be genetically regulated through previous research studies carried in other biotrophic fungal pathogens [6,7]. Previous studies attempted to make an insight into the mechanisms of pathogenesis of biotrophic fungal pathogens by characterizing powdery mildew pathogens of barley, Blumeria graminis [8] and the model plant Arabidopsis thaliana [9] caused by members of the genus, Golovinomyces sp. Research studies

∗

aiming at unraveling the molecular mechanisms of host-pathogen interaction between E. pisi and garden pea are limiting. Therefore, it necessitates studies to detect pathogenicity and virulence of E. pisi pathogen in garden pea. Erysiphe pisi being an adapted pathogen of pea is recognized by the host through pathogen associated molecular patterns (PAMPs) [10]. Effectors are reported to target host immunity by suppressing defense responses and promoting pathogen growth in host tissues. Delivery of these effector proteins into susceptible host cells would enhance susceptibility mediated through effector triggered-susceptibility (ETS). On the contrary, effectors recognized by specific resistance genes trigger Effector triggered immunity (ETI) which manifests in a resistant genotype to confer resistance against adapted pathogens. Targeting pathogenicity and virulence factors would enable combating powdery mildew infection in garden pea. Therefore, the present study was aimed at identifying putative pathogenicity genes using E. pisi-pea interaction. Erysiphe pisi genome sequence information available in the public

Corresponding author. E-mail address: [email protected] (R. Makandar).

https://doi.org/10.1016/j.micpath.2019.103680 Received 24 December 2018; Received in revised form 19 August 2019; Accepted 20 August 2019 Available online 20 August 2019 0882-4010/ © 2019 Elsevier Ltd. All rights reserved.

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

2.3. Erysiphe pisi pathogen isolation, maintenance and multiplication

domain is a draft sequence. The unavailability of complete genome sequence with annotated genes poses difficulty in isolation of the genes. Therefore, closely related powdery mildew causing fungal organismsB. graminis, E. necator and hemibiotrophic fungus M. oryzae genes were used to identify pathogenicity and virulence genes from E. pisi draft genome. A genome-wide search for pathogenicity genes using highly conserved domain sequences was carried using bioinformatic tools and in-silico based approach. Monitoring their expression in E. pisi-challenged pea plants compared to control would confirm whether they are required for pathogenesis. Previous studies had demonstrated that pea genotype, JI-2480 known to carry the recessive gene, er2 expressed resistance in mature leaves at temperature of 25 °C against powdery mildew disease [4]. Disease phenotyping studies previously carried to screen pea genotypes for powdery mildew resistance revealed the commercial cultivar, Arkel to be susceptible to powdery mildew causing pathogen, E. pisi while the genotype, JI-2480 was found to be resistant. Further, a SCAR marker, ScX17_1400 which is linked to er2 gene [11] was used to screen the JI2480 and Arkel. The expected band size of SCAR marker of 1400 was observed in the pea genotype, JI-2480 while it was absent in Arkel. In addition, the resistant line JI-2480 showed significant levels of resistance to the E. pisi isolate EP01, which recorded consistently lowest PDI score (0.0) compared to other genotypes whereas Arkel recorded a PDI score of 69.1 ± 0.45 [5]. Also, biochemical and histological studies correlated with resistance response in JI-2480 compared to Arkel which was compromised in resistance at different time points of inoculation of 24, 28 and 72 hpi [12]. Therefore, the two genotypes, Arkel and JI-2480 were used to carry further studies to detect pathogenicity factors and to monitor their expression in susceptible and resistant lines through quantitative-PCR approach. The experiments were carried to detect candidate genes in E. pisi with a potential role in pathogenicity and virulence through their differential gene expression in the pathogen-challenged plants of JI-2480 and Arkel and the research findings confirming er2 mediated suppression of these genes are presented.

A monoconidial isolate of E. pisi was cultured on ten-day old pea seedlings of Arkel grown aseptically on Murashige and Skoog medium in isolation in plant growth chamber with temperature controlled at 25 ± 2 °C with a 16 h light and 8 h dark cycle. The fungal isolate was identified through PCR-sequencing for ITS region of ribosomal RNA using Erysiphe specific primers (EryF-5′-TACAGAGTGCGAGGCTCAG TCG-3′) and (EryR-5′-GGTCAACCTGTGATCCATGTGACTGG-3′) [18]. The ITS sequence was submitted in NCBI (Genbank number: KM189823). Further, E. pisi isolate was propagated to increase spore production by inoculating fifteen-day-old Arkel plants grown in greenhouse conditions by applying spore on adaxial surface of leaves using fine camel-haired brush. 2.4. Challenging pea plants with E. pisi pathogen The spores harvested from E. pisi infected Arkel leaves ten days post inoculation was used for RNA extraction for identification of pathogenicity genes. The uninoculated leaves from same-aged Arkel plants served as control. Pea plants of both the genotypes used for challenging were grown in growth chamber conditions. Infected Arkel plants were shaken 24 h before inoculation to allow the formation of fresh conidial spores [20] and spores were collected on autoclaved parafilm paper. For inoculation, spores were dusted from leaves to the leaves of the two cultivars with 10 mg of spores per every three plants and plants were maintained in growth chamber conditions at 25 °C. Leaves from plants at different infection times from 6, 12, 24, 48 and 72 h post-infection (hpi) were collected to analyze gene expression changes in response to powdery mildew infection. Leaf samples were collected from uninoculated plants as controls. All samples were immediately frozen in liquid nitrogen and stored at −80 °C for total RNA extraction. Three biological replicates were used for all treatments. 2.5. DNA extraction DNA was isolated by adopting the methods of Doyle and Doyle, 1991 [21], Devi et al., 2013 [22] and Saghai-Maroof et al., 1984 [23]. The tissue was ground in liquid nitrogen in a mortar. The lysate was emulsified in extraction buffer and incubated at 65 °C for 2 h. The extraction buffer A (100 mM Tris–HCl pH 8.0, 250 mM NaCl, 25 mM EDTA pH 8.0, 1% SDS) was used for Plant DNA isolation while extraction buffer B (100 mM Tris-HCl pH 8.0, 1.4 M NaCl, 20 mM EDTA pH 8.0, 2% CTAB, 2% β Mercaptoethanol) was used for fungal DNA isolation. An equal volume of Phenol: Chloroform: Isoamyl alcohol (25:24:1) was added to the lysate. The emulsion was mixed thoroughly and centrifuged for 5 min at 12,000 g. The supernatant was transferred to a fresh Eppendorf tube and 0.6 volume of Isopropanol was added. The mix was incubated at room temperature for 10–15 min followed by centrifugation for 10 min at 12,000 g for DNA precipitation. The precipitated DNA was washed with 70% ethanol by centrifuging at 12,000 g for 30 s. The DNA pellet was air-dried at room temperature for 15 min and dissolved in 1X TE buffer. The DNA was subjected to RNase A treatment (2 μL of RNase A with a final concentration of 10 μg/mL) at 37 °C for 2 h followed by incubation at 65 °C for 10 min. The DNA was quantified by NanoDrop spectrophotometer at 260 nm and checked on 0.8% agarose gel as well. The DNA samples were diluted to working solutions of 10_25 ng/μl.

2. Material and Methods 2.1. Plant material and plant growth conditions The plant material comprised of two pea genotypes-a resistant genotype known to carry er2 gene (JI-2480) and the susceptible genotype (Arkel). Seeds of pea lines were sterilized with 0.1% Sodium hypochlorite for 5 min followed by washing once with 70% ethanol for 30 s. The seeds were then washed with sterile distilled water 4–5 times. The sterilized seeds were soaked in autoclaved distilled water for 12_24 h prior to sowing to facilitate germination. The seeds were sown in pots filled with potting soil and farmyard manure (FYM) in 3:1 proportion. The plants were grown in greenhouse conditions at a temperature of 25 ± 2 °C with natural photoperiod of a maximum of 14 h and leaf samples collected for DNA isolation.

2.2. Morphological characterization of Erysiphe isolate Erysiphe pisi, isolate, Ep-01 was isolated from Arkel plants grown in green house conditions at University of Hyderabad. The morphological states of Ep01 isolate was characterized for vegetative, mitosporic and meiosporic attributes according to the descriptions previous reports [13–19]. The pathogen isolate was studied using bright field Light Microscopy (LM)–Model-Olympus-IX81, Laser Scanning Confocal Microscopy (LSCM)-Model-Leica-TCSSP2 and Scanning Electron Microscopy (SEM)–Models-Hitachi S–3400 N and Philips XL-30ESEM. The isolate was observed by mounting fungal mycelium on glass slides in 0.1% Lactoglycerol for LSCM and Light Microscopy.

2.6. RNA extraction and cDNA synthesis Total RNA was extracted from conidia of E. pisi isolate as well as pea leaves challenged with the fungal pathogen at different time points using TRI-Reagent (Sigma-Aldrich). The tissue was ground in liquid nitrogen in a mortar using liquid nitrogen and homogenized in 1 ml of TRI-Reagent further incubated for 5 min at room temperature. 0.2 ml of 2

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

2.9.2. Real Time PCR (qRT) conditions The qPCR was performed on 96-well PCR plate (Applied Biosystems) on Eppendorf gradient. The 10 μl reaction mix contained 5.2 μl of 1X SYBR mix, 0.5 μl of 0.25 μM of each primer, 1 μl of 1:5 diluted cDNA and 2.8 μl of water to make up the volume. The cycling conditions used were initial denaturation of 95 °C for 3 min followed by 95 °C for 15 sec, specific annealing temperature for specific gene for 30 sec, 72 °C for 20 sec followed by 40 cycles of 95 °C for 15 sec, 60 °C for 15 sec. The reaction efficiency for each qRT primer set was checked with cDNA dilution at 1:5, 1:10, 1:20, 1:30, 1:40, and primer concentration of 0.25 μM and 0.125 μM by RT- PCR. The amplification efficiency of qRT primers was tested and optimum annealing temperature and cycling conditions were identified. A melting curve was performed at the end of qPCR run, during qRT analysis all the samples were set in triplicates including no-template DNA control (NTC). Threshold cycle value (Ct) for each sample was determined from the realplex software (Eppendorf) for pathogenicity-associated and housekeeping genes.

Chloroform was added per ml of TRI-Reagent and mixed vigorously for 15 sec and kept at room temperature for 15 min. Samples were centrifuged at 12,000 g at 4 °C for 15 min. The aqueous phase was collected carefully in fresh tube and 0.5 ml of isopropanol per ml TRI-Reagent was added. The tubes were incubated for 10 min at room temperature and centrifuged at 12,000 g for 10 min. The pellet was washed with 1 ml of 70% (W/V) ethanol and centrifuged at 12,000 g for 5 min. Pellet was dried and resuspended in nuclease free water. Then RNA integrity was checked by formaldehyde gel electrophoresis. Quantity and purity testing were completed by NanoDrop 2000 spectrophotometer (Thermo Scientific). The RNA samples with A260/A280 ratio of 1.8_2.0 and A260/ A230 ratio of > 2.0 was used for complementary DNA (cDNA) synthesis. First strand cDNA synthesis was performed using 2 μg/μl total RNA per sample using cDNA synthesis kit (Takara) as given in the manual. 2.7. In-silico search for pathogenicity factors Erysiphe pisi draft genome sequence available in NCBI public domain (submitted by Max-Planck-Institute for Plant Breeding Research) was used to identify putative pathogenicity factors. A total of nineteen MCL (Markov Chain-Clustering Loci) for pathogenicity from other ascomycete's fungus were identified and selected for the study [24]. Blastsearch was carried with each pathogenicity gene sequence to identify homologous gene sequences from closely related organisms such as powdery mildew causing fungus- B. graminis, E. necator and hemi-biotrophic fungus M. oryzae. The homologous gene sequences identified from these fungi were aligned with E. pisi draft genome using Clustal Omega bioinformatics tool. The alignment identified conserved domain sequences from E. pisi genome. The conserved domain sequences of each of the genes from E. pisi were compared with pathogenicity factors of closely related organisms using BlastX to identify their domain function and its significant similarity with predicted E. pisi putative pathogenicity factors.

2.9.3. Expression stability analysis and statistics analysis The relative quantification of pathogenicity-associated genes was done by threshold cycle model (Ct value) which describes number of cycles required for the amplification of any genes to reach a threshold level. The level of gene expression was normalized by subtracting the Ct value of internal control genes from Ct value of target gene named as ΔCt, done for each repetition of samples in every run. Furthermore, the expression fold change was calculated by using 2^-ΔCt for all pathogenicity genes for both genotypes [25]. Statistical analysis was carried using SigmaPlot 11.0 and RT-QPCR was plotted to compare gene expression using student-t test at different time points. 2.10. Microscopic study of E. pisi pathogen at early time points of infection To monitor E. pisi pathogen growth at early time points of infection, microscopic study was carried at 0, 6, 12 and 24 hpi in Arkel and JI2480 genotypes. Leaves were collected for all time points post inoculation and incubated in 3:1 ethanol: glacial acetic acid solution for overnight to remove chlorophyll. After bleaching leaf samples are transferred in lacto-glycerol solution (equal volumes of lactic acid, glycerol, and water). The trypan blue stock solution was prepared by adding 0.02 g of trypan blue stain to a solution containing 10 g phenol, 10 ml glycerol, 10 ml lactic acid prepared in 10 ml sterile distilled water. The working solution was prepared by diluting the stock solution with ethanol (96%) in 1:2 (v/v) ratios. Trypan blue stained Erysipheinfected leaf samples of pea genotypes representing different time points were mounted on clean glass slides and were observed under the light microscope (OLYMPUS U-CMAD3).

2.8. Primer designing Primers were designed from conserved domain sequences of putative pathogenicity loci by using E. pisi draft genome by OligoAnalyzer 3.1 bioinformatics tool. Primers free from self-annealing sites, hairpin loop formation and hetero-dimer were designed with 45–60% GC content and melting temperature ranging in between 48 and 58 °C. The list of primers used for genomic, reverse transcriptase (RT) along with their expected amplicon size (Table 1) and quantitative-reverse transcriptase (qRT) along with annealing temperatures (Table 2) are provided. PCR amplification efficiency and optimization conditions were standardized for all the loci using both genomic and cDNA as template. Yeast-Actin gene was used as internal control for qPCR normalization of fungal gene expression.

3. Results 2.9. PCR amplification, gel elution and sequencing 3.1. Morphological characterization of Erysiphe 2.9.1. Genomic and RT- PCR conditions For confirmation of er2 gene, both JI-2480 and Arkel accessions were screened by PCR using SCAR markers reported for resistance gene er2 i.e. ScX17_1400 [5]. The PCR reaction mix consisted of 1X master mix (Clontech), 1.25 μM of each primer, 1:10 diluted cDNA and nuclease free water to make up final volume and cycling condition was standardized as initial denaturation at 94 °C for 5 min followed by 35 cycles of 94 °C for 30 sec, annealing temperature between 50 and 60 °C for 30 sec and extension at 72 °C for 30 sec and final extension at 72 °C for 5 min. PCR amplification conditions were similar for genomic and cDNA (second strand synthesis) amplification of pathogenicity genes as well as ITS sequence of E. pisi isolate. The amplicons were eluted from agarose gel using NucleoSpin Gel and PCR clean-up kit (MachereyNagel) and DNA fragments were cloned in pTZ57 R/T vector. Transformed colonies were confirmed by PCR and sequencing.

The anamorph and teleomorph stages of Erysiphe isolate, Ep01 was confirmed through LSCM, SEM and light microscopy techniques. The ectophytic mycelium was white in appearance, covering the adaxial surface of garden pea leaves, stems and the pods. Characters which include mycelial growth, appressorium type, foot cell type, conidiophore type, presence of fibrosin bodies, conidial edge type, SEM based patterns on conidial outer walls, ascoma shape, dorsiventral symmetry, ascoma-peridial layers, appendage type, number of septa in appendages, appendage placement on chasmothecia and branching of appendages was examined to be E. pisi pathogen specific as shown in Fig. 1. The Ep01 isolate was characterized as members of E. pisi pathogen by morphological characterization. The mitosporic characters of the isolate correlated with features of E. pisi with cylindrical type of foot 3

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

Table 1 The list of fifteen of the putative pathogenicity loci predicted in filamentous ascomycetes members and identified through gene expression through Reverse Transcriptase (RT) PCR using domain-specific primers in Erysiphe pisi-infected pea samples. The primer sequences along with their expected amplicon size and putative biological role are presented. S. No.

Name

Function

Pathway

Primer Sequence

Band size (bp)

1

cPKA

cAMP-dependent protein kinase catalytic subunit

CRP

cAMP-dependent protein kinase regulatory subunit

3

AC

Adenylate cyclase

4

PMK1

MAP kinase

5

MST11

MAP kinase kinase kinase

MAPK pathway

6

MST7

MAP kinase kinase

MAPK Pathway

7

PEX

Peroxisome biogenesis

Cellular function

8

ICL

Isocitrate lyase

Metabolic pathway

9

KIN

Kinesin motor protein

Cellular function

10

MFP

Multifunctional beta-oxidation enzyme

Metabolic pathway

11

ODC

Ornithine decarboxylase

12

GAS

Alpha-glucosidase

Cellular function

13

TRE

Trehalose-6-phosphate synthase subunit 1

Metabolic pathway

14

MET

Methionine synthase

Metabolic pathway

15

CRU

Cell cycle regulatory protein

F: ATGCTTTGTGGCTATACACCGTTCTG R: ATCTGGGCCAGTCTGGCCGTAACGTT F: ATGTACAATGCACCAAGAGCA R: AGTCTTTGGAACCCATCTTTT F: TACTTGACCACCGTCAGCAA R: CTTAGTATTGTATTTACAGACATC F: ATGGAAACGGATATGCATAGAGTCATT R: ACAATCCTTTCCAGGAAATAAAGGC F: ATGGGACAGGTTCTTCTTGGACTTCAA R: TTTAGCTTACAGGGGATACTCCTTCA F: ATGGTTGATTTCTGGTCATTAGGCGTA R: CTTCAACTCTTCAGCATCATCATTGG F: ATGAAGAGACTTGAAAAACTA R: TTACTTCCTAGTCAATGCTT F: ATGCTCGCTGCTGAGCG R: AAAGTGCATGCACACCATTC F: ATGAATTCACGGCAGAAAGATGT R: TACTAGGAGAACAGTTGATTATC F: GATTACTGGAGGAACATCTGG R: GTATTAGTCCATAGAGTTTTGGC F: TATGCGGTCAAGTGTAACCCCGAC R: GTTGGTCCCCAGATGGAGTATTC F: GACGAAAGTACATGGTGGGA R: GGCCAGCACCAACCTTCATA F: ATGACTGATGGAAAAACAGAGC R: AAGACTAGTTGTATTCATGCC F: GGATGATCTCCTTGCAGAAG R: GAAGTCGCAACGATCACACG F: TAACCATGTGTACTAACAATTTC R: TACATGTCACCTCGTCATCATA

321

2

cAMP-PKA pathway cAMP-PKA pathway cAMP-PKA pathway MAPK pathway

437 441 372 341 228 728 386 737 861 851 819 816 774 884

(24_55 μm) and width (13.5_22 μm) in E. pisi [13,26]. The diameter of the chasmothecia was observed to be in the range of (70_)80_150(_160) μm as reported for the (80_)85_150 μm in E. pisi [14,27]. In addition to typical powdery mildew symptoms, as compared to the long flexous and dichotomously branched chasmothecial appendages, characteristic of E. trifolii, myceloid, short and unbranched chasmothecial appendages were observed in Ep01 isolate, similar to E. pisi [28].

cell and pseudoidium type conidiophore bearing a single or solitary conidium on the top. The conidia were hyaline and ellipsoidal lacking fibrosin bodies. The rugose pattern of the outer walls of mature conidia was observed with no distinct conidial edges. The meiosporic characters comprising shape of chasmothecia, presence or absence of dorsiventral symmetry, chasmothecial-peridial layers, appendage type and their placement on chasmothecia were observed. The chasmothecia was observed to be globose or spherical in shape, lacking dorsiventral symmetry with tightly packed peridial cells. The chasmothecial appendage of the isolate was myceloid and unbranched, characteristic to E. pisi. The length of the Ep01 conidia ranged from 23_51 μm while the width of the conidia ranged from 11_22 μm as reported for length

3.2. Screening of powdery mildew resistant gene er2 Genotype PCR based screening revealed, marker ScX17_1400 which is in cis-phase with er2 gene amplified expected band of 1400 bp in JI-

Table 2 The list of nine putative pathogenicity genes detected in Erysiphe pisi-infected pea samples using domain-specific primers for gene expression through Real-Time Quantitative-Reverse Transcriptase (q-RT) PCR. The primer sequences along with their annealing temperatures and biological function are presented. S. No.

Name

Function

Primer Sequence

Annealing temperature

1

cPKA

cAMP-dependent protein kinase catalytic subunit

56 °C

2

MST7

MAP kinase kinase

3

MST11

MAP kinase kinasekinase

4

MET

Methionine synthase

5

MFP

Multifunctional beta-oxidation enzyme

6

TRE

Trehalose-6-phosphate synthase subunit 1

7

PEX

Peroxisome biogenesis

8

CRP

cAMP-dependent protein kinase regulatory subunit

9

AC

Adenylate cyclase

F: ATGCTTTGTGGCTATACACCGTTCTG R: ATACAGTCAGCTCCTCCGTGT F: ATGGTTGATTTCTGGTCATTAGGCGTA R: CGTGGAAAGCGAACCTTGCCAA F: ATGGGACAGGTTCTTCTTGGACTTCAA R: CAGCACTCTTGCCGGGGCAG F: GGATGATCTCCTTGCAGAAG R: CAGCCTGCTTCATGTTAGCT F: GATTACTGGAGGAACATCTGG R: GTGACGATAGGTCGATTTGC F: ATGACTGATGGAAAAACAGAGC R: TGTACATTTGCGGGACTAGC F: ATGAAGAGACTTGAAAAACTA R: ACGTCACTCCAACTTACAT F: ATGTACAATGCACCAAGAGCA R: CATCTGCAATCTTCGAGCG F: TACTTGACCACCGTCAGCAA R: TTCTAGTGTTCTTGGCCAGG

4

56 °C 56 °C 50 °C 50 °C 50 °C 50 °C 50 °C 56 °C

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

Fig. 1. Morphological characterization of Ep01 isolate: (a) lobed conidial appressorium, (b) hyphal appressoria, (c) conidiophores with foot cells, (d) rugose conidial surface, (e) conidia, (f and g) globose chasmothecia with myceloid appendages, (h) firmly connected chasmothecia-peridial layers, (i) myceloid appendages on epiphytic mycelium. The Figs. a, b, d, f, h, i are SEM images, c is Light microscopy image and e, g are confocal images.

ectophytic conidia and mycelia collected using a camel-haired paintbrush, it is possible that the plant tissue in the sample mixture is in negligible amounts thereby resulting in lack of plant-related gene expression in control samples. PCR amplified gene sequences were cloned in pTZ57R\T vector and sequenced. The pathogenicity domains were confirmed through BLASTx search from NCBI public domain. The findings revealed pathogen domain-specific sequences for fifteen genes which showed significant similarity with closely related organisms from ascomycetes (Table 1), while the remaining four genes; Cystathionine beta lyase (CLB1), Cyclin (CLB2), Imidazoglycerol-phospahte dehydratase (PTH2), Carnitine acetyl transferase (PTH3) either could not amplify or if amplified could not be confirmed for domain and significant similarity with other closely related organism. In the former situation, it is possible that lack of amplification of these sequences might be resulting from poor sequence consensus in the primer-binding region. While in the later, though gene product amplified but the domain is not confirmed, it could have been either a false positive or resulting from a partially redundant gene sequence and necessitates further testing. The genomic DNA and cDNA PCR products were sequenced and the sequences submitted to NCBI public domain. The Gene bank accession numbers are provided in Supplementary Table 2. The genomic DNA and cDNA sequences for most of the components were identical suggesting conserved of the genes.

2480 and absent in susceptible genotype Arkel, shown in Supplementary Fig. 1. Amplification of 1400 bp in JI-2480 indicated that this line is carrying er2 gene.

3.3. Identification of putative pathogenicity factors from Erysiphe pisi A total of nineteen genes predicted for pathogenicity as listed in Supplementary Table 2 were tested to identify homologous gene sequences by BLAST-search tool. The homologous gene sequences identified from other powdery mildew causing fungal organisms-Blumeria graminis, Erysiphe necator and hemibiotrophic fungus Magnaporthe oryzae were compared with E. pisi genome sequence using Clustal Omega tool to identify highly conserved domain sequences for each of the genes from E. pisi. The pathogenicity domains detected in E. pisi genome sequence were comparable with experimentally tested pathogenicity factors from closely related organisms. The primer sets designed from conserved domain regions were tested using E. pisi fungal genomic DNA as well as cDNA obtained from ectophytic conidia and mycelia collected from the surface of pathogen-inoculated leaves of Arkel genotype. The genomic DNA PCRs carried to test the presence of nineteen putative pathogenicity-associated gene sequences; amplified expected size of amplicons for all the loci. Further, sequencing of genomic DNA PCR products of putative pathogenicity gene sequences revealed that these gene sequences were conserved in E. pisi genome also. The gene expression of putative pathogenicity loci was monitored through mRNA transcript accumulation in ectophytic conidia and mycelia harvested using a fine-hair brush from E. pisi-infected pea leaves ten days post-inoculation. To confirm whether these gene sequences were fungal specific, RNA from leaves of uninoculated Arkel plants of the same age as those challenged with E. pisi pathogen was included as control. RT-PCR products with expected amplicon size were amplified for fifteen gene loci in E. pisi-infected samples but not from control leaf samples as shown in Fig. 2, suggesting them to be E. pisi specific gene sequences. The expression of fungal-specific, Actin gene tested as an internal control, was observed in E. pisi-infected samples alone while plant-specific, Actin and Tubulin gene expression was observed in control plant samples alone. Since cDNA template used in RT-PCR from E. pisi-infected samples was prepared from the RNA extracted from

3.4. Transcriptional analysis of identified pathogenicity factors To test the role of putative E. pisi pathogenicity factors, a timecourse study to analyze gene expression in E. pisi-challenged plants of two pea genotypes, a powdery mildew resistant genotype JI-2480 carrying er2 resistant gene and a susceptible genotype, Arkel was carried. The gene expression was compared between E. pisi-challenged plants of JI-2480 and Arkel at 6, 12, 24, 48 and 72 hpi. The leaf tissues were monitored for gene expression using nine sets of primers designed from the domain sequences with a role in pathogenicity (Table 2). The optimal PCR conditions for primer concentration, dilution of cDNA template and annealing temperatures were set through standardizing for all genes at different time point of infection. A 0.25 μM primer 5

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

Fig. 2. Expression of E. pisi-specific putative pathogenicity factors through Reverse Transcriptase (RT)-PCR. The cDNA amplification of putative pathogenicity-associated factors using RNA extracted from the conidia and mycelia collected from Erysiphe pisi-infected leaf samples of Arkel plants (I) were compared with amplification profile obtained using RNA extracted from leaves of uninoculated Arkel plants of the same age which served as control (C). All the fungal genes tested amplified expected band size along with the internal controls, fungalspecific Actin [Actin (F)] expressed in infected samples alone while plant-specific Actin [Actin (P)] and Tubulin [Tubulin (P)] expressed in control leaf samples.

for the Trehalose-6-phosphate synthase subunit 1 (TRE) gene which showed ~13-fold change expression at 6 hpi, followed by a ~3-fold change expression at 12 hpi and 9-fold change at 24 hpi in Arkel. Whereas TRE transcript expression in JI-2480 was at basal level except at 24 hpi with a 2-fold change suggesting its role as a pathogenicity and virulence factor similar to MFP gene. Likewise, a significant increase in the mRNA gene expression of cAMP dependent protein kinase catalytic subunit gene (cPKA) was observed till 24 hpi in Arkel with a 6-fold change followed by a gradual decline at later time points. While in JI-2480 a significant increase in gene expression was observed at 12 hpi with a 2.5–3.0-fold change which subsequently decreased at later time points suggesting its putative involvement in early stages of pathogenicity as well as virulence. Activation of host defense in response to E. pisi in fungal-challenged resistant pea plants might be the reason for decrease of cPKA gene transcripts at later time points. The cAMP regulatory protein (CRP) transcript accumulation showed a 4-fold change at 6 hpi which escalated to ~20-fold change at 24 hpi followed by a sharp decline with 3fold change at 48 hpi which further reduced at 72 hpi indicating a significant modulation of its expression during pathogenesis. Though CRP gene expression was lower in JI-2480 compared to Arkel, however, a maximum level of expression with ~3-fold change at 72 hpi was observed suggesting it may act as an effector in modulating defense

concentration and 1:5 cDNA dilution was found suitable for qRT-PCR reaction. Annealing temperatures of the primers for the gene sequences tested were standardized which ranged between 45 and 60 °C. Differential expression of putative pathogenicity factors was observed at all time points tested; indicating that expression of these genes is temporally regulated. Further, significant level of variation in expression of these genes between E. pisi-challenged plants from resistant and susceptible pea genotypes revealing that host-pathogen interaction was involved in determining the level of expression of these genes. The graphs representing varied level of gene expression monitored through relative mRNA transcript accumulation of nine putative pathogenicity factors are presented as Fig. 3. The mRNA transcripts of the gene encoding, Multifunction protein (MFP) showed significantly higher level of expression at early time points between 6 hpi to 24 hpi with an escalated expression level of ~14-fold change at the earliest time point of 6 hpi in response to infection in susceptible genotype, Arkel suggesting that MFP plays a crucial role in early stages of pathogenesis. On the contrary, the level of MFP transcripts accumulated was meager at all time points in the resistant genotype, JI-2480 except at 24 hpi where a 4-fold change was observed and reduced at later time point. The temporal expression of MFP at 24 hpi alone suggested that its expression was required at the specific stage of infection. A similar pattern of expression was observed 6

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

(caption on next page)

7

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

Fig. 3. Real Time-quantitative Reverse Transcriptase (q-RT) PCR for gene expression of putative pathogenicity factors. The relative level of mRNA transcript accumulation of nine putative pathogenicity and virulence factors (MFP, TRE, CRP, cPKA, PEX, AC, MST7, MST11 and MET) at different time-points from 6, 12, 24, 48 and 72 h post infection (hpi) in two pea genotypes, a susceptible (Arkel) and resistant (JI-2480 carrying er2 gene).Yeast-Actin gene was used as internal control for qPCR normalization of fungal gene expression and samples were tested in triplicates including no-template DNA control (NTC). Threshold cycle value (Ct) for each sample was determined from the realplex software (Eppendorf) for pathogenicity-associated and housekeeping genes. Statistical analysis was carried using SigmaPlot 11.0 and RT-QPCR was plotted to compare gene expression using student-t test at different time points. The symbol (*) shows significant differences between time points (* - P < 0.05; **- P < 0.01).

It necessitates identifying putative pathogenicity factors which might be determining the ability of the pathogen to incite and cause infection on the host using E. pisi-pea interaction. Pathogenicity factors have been implicated in several pathogenesis related processes like signal transduction, metabolic pathways, amino acid biosynthesis, cell cycle regulation, cellular interactions, toxins biosynthesis, their secretion against host defense and detoxification of plant antimicrobial compounds [29–31]. Some of these pathways were identified through studies in hemibiotrophic fungus, Magnaporthe grisea [32–34] biotrophic fungus, Blumeria graminis [5], budding yeast, Saccharomyces cerevisiae [35] and other filamentous fungi suggesting conserved nature of genetic components among various members of the fungi for different functions [24]. The MAP kinase pathways have been studied extensively in yeast, Saccharomyces cerevisiae and reported to induce morphological and biochemical changes in response to external stimuli such as starvation stress or hyperosmotic conditions [35]. The present study was attempted to find whether similar mechanism for pathogenicity and virulence does exist in Erysiphe pisi. In this study, fifteen putative pathogenicity genes were identified by PCR based approach. Based on significant similarity with identified database and low E value, identified sequences were confirmed by genomic and RT PCRs. These putative pathogenicity genes were also reported to act as vital components of signal transduction and metabolic pathways, cell-to-cell interactions and toxin biosynthesis in other pathogens [24,29]. In this study, homologues of putative pathogenicity domains were identified in E. pisi suggesting a similar biological role for these genes. The cyclic AMP (cAMP) signaling and mitogen-activated protein (MAP) kinase pathways are best studied among the signal transduction pathways in eukaryotes [36], and the genetic components detected revealed their major role in surface recognition and imitation, appressorium formation and penetration, germ tube formation and growth, cell-wall integrity and osmoregulation in all filamentous fungi [32,36,37]. Likewise, few other pathogenicity genes were reported to carry biological role in metabolic pathways such as Isocitrate lyase (ICL) in glyoxylate cycle, induce peroxisome proliferation involved in host invasion; amino acid synthesis like Multifunctional beta-oxidation enzyme (MFP) in fatty acid metabolism and Methionine synthase (MET), an essential element for survival in host during infection; Trehalose-6-phosphate synthase subunit 1 (TRE) in Trehalose metabolism which is required for efficient development of plant fungus interaction [38–41]. Other identified pathogenicity factors such as PEX, KIN and GAS were found to be involved in different cellular functions. A member of ATPase family, Peroxisome biogenesis (PEX) gene, reported with a role in cellular functions in biogenesis and proliferation of microbodies [42] was detected. Likewise, Kinesin Motor Protein (KIN) gene being a microtubule associated protein found to be essential for filamentous growth and organelle transport during hyphal growth [43,44] was also noted. The Alpha-glucosidase (GAS) gene, a α-subunit of endoplasmic reticulum (ER) glucosidase which localizes to ER aiding in early biotrophic development was found as key factor for pathogenic development [45]. The pathogenicity genes tested in the study were found to be associated with host infection, hyphal growth, plant cell wall degradation, defense against plant responses and toxin biosynthesis [29]. Expressions of these putative pathogenicity genes were also observed in response to E. pisi suggesting them to be candidate genes in pathogenicity of E. pisi pathogen in garden pea. A time course study for real-time expression of nine of the putative

response of the host. A 2-fold change in mRNA transcript accumulation of Peroxisome biogenesis (PEX) gene was observed 24 hpi in Arkel while the level of expression was at basal levels in JI-2480 suggesting that it might be candidate gene for pathogenicity. A four-fold increase in the expression of Adenylate cyclase (AC), a key gene in cAMP-PKA pathway with higher amount of transcript expression was observed at 24 hpi in Arkel. Similarly, the level of expression of MAP kinase kinase (MST7) gene, one of the genes of MAPK pathway showed 3-fold increase in expression level at 24 hpi in Arkel while negligible expression was observed in E. pisi-challenged JI-2480 genotype. Conversely, the level of expression of MAP kinase kinase kinase (MST11) gene was lower showing a 0.5-fold expression change at 24 hpi. The genes, MST7 and MST11 constitute the MAPK pathway of which MST7 seem to highly up-regulated in pathogenicity as shown by higher transcript expression at 24 hpi in Arkel compared to JI-2480. A 4.5-fold change increase in MST7 gene expression in Arkel at 24 hpi was observed, contrary to the low level of MST11 gene transcript accumulated at 24 hpi. Further, the expression of MST11 gene was also lower in the resistant genotype, JI-2480 challenged with E. pisi. Varying level of mRNA transcript accumulation was observed for the genes, MST11 and MET in both E. pisi-challenged susceptible and resistant genotypes. Meager change of 0.6-fold at 6 hpi for Methionine synthase (MET) genes in the susceptible Arkel plants suggested that these genes may not be contributing to the pathogenicity. The MET transcript accumulation was at basal level at all time-points in both the genotypes, Arkel and JI2480 in response to E. pisi infection. 3.5. Microscopic analysis of E. pisi pathogen at early time points of infection The powdery mildew infection was compared between the genotypes, Arkel and JI-2480, by microscopically examining Erysiphe-infected leaf samples at 0, 6, 12, 24 hpi by trypan blue staining. Erysiphe pisi spores germinated after contact with epidermal cells in both genotypes (Fig. 4). At 6 hpi, spore germination and primary germ tube formation progressed at uniform level in both pea genotypes. At 12 hpi, successful penetration of germinated spore in epidermal cells of the host was observed. However, at subsequent time points starting from 12 hpi, a slow progression in fungal growth was noticed in JI-2480 which showed reduced hyphal length compared to those in Arkel. At 24 hpi, quantitative level of variation in secondary fungal hyphal growth was observed between resistant, JI-2480 and susceptible, Arkel genotypes. The relatively more and faster growth of fungal mycelium in Arkel compared to JI-2480 correlates with elevated levels of transcript accumulation of most of the pathogenicity genes at early time point of infection suggesting their involvement in pathogenesis and virulence. Furthermore, slow progression of Erysiphe pathogen in JI-2480 compared to Arkel correlates with reduced transcript levels of key pathogenicity genes supporting their role in pathogenicity. 4. Discussion The pathogenicity genes are essential for successful completion of the pathogen lifecycle but are dispensable for saprophytic growth [26]. Erysiphe pisi being an adapted pathogen with a biotrophic mode of living would have evolved a more complex mechanism of pathogenesis and virulence to promote its growth in its host. 8

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

Fig. 4. Light microscopic studies to monitor spore germination and fungal growth during early stages of E. pisi infection. Trypan blue stained leaves of Erysiphechallenged leaves of Arkel (left panel) and JI-2480 (right panel) at 0, 6, 12, 24 h post inoculation; scale bar 10 mm.

early stages clearly suggests the importance of cAMP pathway in conidial development of E. pisi. Further, accumulation of cAMP gene was reported in germinating spores of E. graminis f. sp. hordei in barley [47]. The study also highlighted that application of exogenous cAMP or cAMP analogues at different concentrations and on different surfaces, either promoted or inhibited conidial differentiation suggesting a role for cAMP in conidial differentiation. Likewise, the role of cAMP in pathogenesis and conidial differentiation was demonstrated in the fungus, M. grisea [48]. The genes, MST7 and MST11 are vital genes of MAPK pathway seem to regulate molecular processes post conidial germination and appressorium development during fungal pathogenesis in M. oryzae [36]. In Blumeria graminis, powdery mildew causing fungal pathogen of barley, the transcript profile of MAPK kinase genes as mpk1 and mpk2 were elevated during mature primary and appressoria germ tube stages demonstrating their role in pathogenesis [7]. However, in our study MST7 gene expression was found to be upregulated at 24 hpi in E. pisi-challenged Arkel compared to other time points of infection while, MST11 transcript accumulation though observed at later stages but were nonsignificant suggesting more involvement of MST7 gene in pathogenesis.

pathogenicity associated genes selected on the basis of highly conserved domain sequences conducted to check if they are required during early pathogenesis, like conidia germination, appressorium formation and disease signaling and to uncover the er2 mediated resistance activity post inoculation. This study showed differential gene expression between E. pisi-resistant and susceptible genotype suggesting a temporal regulation of these genes. In cAMP-PKA pathway, cPKA, CRP and AC genes showed gradual elevation at early time points till 24 hpi in Arkel genotype with highest peak at 24 hpi suggesting their requirement at initial stages of infection for surface recognition, conidial germination and differentiation. The expression of cPKA and CRP genes was also observed in the resistant genotype, JI-2480 at 12 hpi and 72 hpi respectively suggesting their role in virulence as well. It has been reported that avirulence factors upon recognition by the host cells carrying the corresponding resistance gene would confer resistance via an incompatible host-pathogen interaction [46] and the expression of these genes in JI-2480 genotype would be conferring resistance through the effector-triggered immunity (ETI) and triggering er2 driven resistance against powdery mildew infection. Higher transcript expression of cAMP pathway gene sequences at 9

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

The observation is supported from the previous findings wherein transgenic expression of a functional allele of MST7 when expressed in a double mutant strain of Magnaporthe oryzae carrying null mutations at both the loci, mst7 or mst11, resulted in restoration of appressorium formation thereby manifesting a major role of MST7 in MAPK pathway as well as appressorium formation, required for virulence of the pathogen [27,49,50]. Multifunction protein (MFP) has been shown to be involved in fatty acid β-oxidation in mitochondria and peroxisome in Aspergillus nidulans [51]. In M. oryzae, MFP plays a major role in conidia germination and its protein activity was found to be very necessary for fungus to enter the host plant. Further, expression of MFP gene in fungal transformants carrying MFP1: GFP transgenic was detected in conidia germination and germ tube elongation and also found to be vital for appressorium growth in M. grisea [39]. In E. pisi-challenged Arkel leaves, the MFP transcript accumulation was highest at 6 h post inoculation which declined at later time-points in Arkel genotype indicating it might be involved at early stages of infection of conidial germination and host penetration. Likewise, TRE gene expression peaked at 6 hpi suggesting its involvement in trehalose metabolism, glycolysis and gluconeogenesis which aid appressoria to develop on the leaf surface without intaking of nutrients from host. In hemibiotrophic fungus, M. grisea, TRE1 accumulation was localized in germinating conidia and developing appressoria which support its highest transcript accumulation at 6 hpi in E. pisi. TRE gene expression is necessitated for development of appressoria and cell wall biosynthesis at infection [41]. It was also intriguing to observe not only significant level of expression of MFP (~14fold) and TRE (~13-fold) genes at 6 hpi in response to E. pisi infection in Arkel plants but also considerable level of expression in E. pisi-challenged leaves of resistant genotype, JI-2480 at 12 hpi suggesting the possibility of these genes to act as effector molecules to suppress PAMP triggered host defense responses. But at the later time points the gene expression declined rapidly in JI-2480 compared to Arkel suggesting the possibility of generation of defense response by suppressing ETS against powdery mildew infection. Bocscanzy et al. (2012) stated that two most important types of pathogenicity factors are the T3SS and its associated secreted protein called as Type III effectors in Erwinia amylovora [52]. Similarly, in Xanthomonas, both factors are found to be essential and termed as important virulence factors [53]. Our findings were observed in accordance to these reports indicating that pathogenicity factors might be acting as effectors in some cases. However, MET gene expression was found to be non-significant in both the genotypes at all time-points suggesting that it might not be involved actively in pathogenesis of E. pisi fungus. Transcript levels of PEX increased till 24 hpi in susceptible Arkel plants while at basal level in plants of resistant genotype, JI-2480. The PEX gene is involved in peroxisome biogenesis which assists fungus during appressorium development. In M. grisea, the functioning of PEX as an essential component for appressorium mediated plant infection was identified. High level of expression of PEX at 12 hpi suggested that it may play major role in penetration for plant infection, appressoria initiation, development and maturation [39]. In JI-2480 resistant genotype, the expression of most of the predicted pathogenicity loci was at basal level in response to E. pisi infection. However, significant level of expression of few of the genes in JI-2480 at early time point; cPKA, CRP, MFP and TRE suggests their role in virulence. Major decline in the expression of these genes at later time point suggests their involvement in generation of host defense responses. Effector molecules are the virulence genes which suppress or modify host immune response to promote susceptibility via effector triggered susceptibility mechanism. On the other hand, Effector triggered immunity (ETI) activated in the resistant host would confer resistance through incompatible interaction upon recognition of the effector molecules. Immune responses activated by ETI against fungus are more prolonged and robust and effectively confers resistance against fungus [54,55]. Though initially at 6 hpi, uniform spore germination and fungal growth was observed between the two

genotypes, Arkel and JI-2480, prominent differences in length of mycelia and secondary hyphae were noticed between the genotypes subsequent to 12 hpi. Previous studies also reported similar differences in spore germination and appressorium formation between resistant and susceptible genotypes during initial stages of infection [56]. The low pathogenicity gene expression pattern in JI-2480 also revealed the major action of er2 mediated resistance against powdery mildew fungus. Suppression of these genes might be conferred by er2 mediated resistance in the pea genotype, JI-2480. Gene expression studies revealed up-regulation of basal resistance genes associated with hypersensitive response in resistant genotype compared to susceptible genotype [57]. Foster et al., 2007 revealed a new pathosystem in Medicago truncatula accessions and the powdery mildew fungus E. pisi with similar expression pattern. On the other hand, up-regulation of these putative pathogenicity genes in Arkel appears to promote susceptibility to Erysiphe pathogen. Collectively, our findings besides identifying putative pathogenicity genes of E. pisi also provide firsthand information about their role in virulence by promoting susceptibility to E. pisi in Arkel. 5. Conclusion In this study, putative pathogenicity and virulence genes were identified from E. pisi fungus. Fifteen putative pathogenicity domains were identified through homologous gene searching using bioinformatic tools and expressed in E. pisi pathogen-challenged pea confirming them to be E. pisi specific genes. Transcriptional gene expression of nine of the putative pathogenicity loci were monitored at different time points; 6, 12, 24, 48 and 72 hpi in powdery mildew resistant and susceptible genotypes, JI-2480 and Arkel respectively. Significantly low level of gene expression was observed for putative pathogenicity genes in JI-2480 genotype compared to Arkel suggesting er2 mediated suppression of these genes. This expression pattern also revealed the defense responses which might be triggered by er2 resistance gene source in JI-2480. Significant level of transcript accumulation was observed for most of the genes suggesting their role in pathogenicity. Among these genes, MFP, TRE and CRP showed highest transcript accumulation in Arkel at early time points of infection indicating their role in early stages of pathogenesis. Likewise, elevated level of accumulation of CRP, cPKA, PEX, MST7 and AC transcripts at 24 hpi depicts their role in post appressorium initiation process of pathogenesis. The genes MFP, TRE and cPKA appear to act as effector since transcripts of these genes were up-regulated in resistant genotype at early stages alone. Furthermore, the expression level in JI-2480 was lower compared to Arkel as expected for a R-Avr mediated interaction enhancing immune responses against E. pisi infection in pea. Conflicts of interest There is no conflict of interest. Acknowledgements The work was supported by Department of Science and Technology (DST; SR/SO/BB02/2010); Department of Biotechnology (DBT; BT/ PR1264/PBD/16/848/2009s), Universities with Potential for Excellence (UPE Phase II; UH/UGC/UPE Phase-2/Interface Studies/research projects/R-29). We acknowledge NBPGR, New Delhi for pea germplasm lines. The authors acknowledge the seed material received from Dr. Rajeev Rathour (HPAU, Palampur, HP, India). Authors acknowledge NCBI public domain (E. pisi data submitted by Max-PlanckInstitute for Plant Breeding Research). Facilities at UoH which include DBT-CREBB, DST-FIST, UGC-SAP, CIL and Plant Culture Facility, Plant Sciences Facility at School of Life sciences are also acknowledged. Also, the authors acknowledge the financial support in the form of fellowships to SMB (DST-INSPIRE) and MB (UGC-RFSMS). 10

Microbial Pathogenesis 136 (2019) 103680

S.M. Bhosle, et al.

Appendix A. Supplementary data

[29] A. Idnurm, B.J. Howlett, Pathogenicity genes of phytopathogenic fungi, Mol. Plant Pathol. 2 (2001) 241–255. [30] N.J. Talbot, On the trail of a cereal killer: exploring the biology of Magnaporthe grisea, Annu. Rev. Microbiol. 57 (2003) 177–202. [31] T.A. Randall, R.A. Dwyer, E. Huitema, K. Beyer, C. Cvitanich, H. Kelkar, A.M.V.A. Fong, K. Gates, S. Roberts, E. Yatzkan, T. Gaffney, M. Law, A. Testa, T. Torto-Alalibo, M. Zhang, L. Zheng, E. Mueller, J. Windass, A. Binder, P.R.J. Birch, U. Gisi, F. Govers, N.A. Gow, F. Mauch, P. Van West, M.E. Waugh, J. Yu, T. Boller, S. Kamoun, S.T. Lam, H.S. Judelson, Large–scale gene discovery in the oomycete Phytophthora infestans reveals likely components of phyto–pathogenicity shared with true fungi, Mol. Plant Microbe Interact. 18 (2005) 229–243. [32] J.R. Xu, J.E. Hamer, MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea, Genes Dev. 10 (1996) 2696–2706. [33] R.D. Kulkarni, M.R. Thon, H. Pan, R.A. Dean, Novel G–protein–coupled receptor–like proteins in the plant pathogenic fungus Magnaporthe grisea, Genome Biol. 6 (2005) R24. [34] Z.Y. Wang, C.R. Thornton, M.J. Kershaw, L. Debao, N.J. Talbot, The glyoxylate cycle is required for temporal regulation of virulence by the plant pathogenic fungus Magnaporthe grisea, Mol. Microbiol. 47 (2003) 1601–1612. [35] M.C. Gustin, J. Albertyn, M. Alexander, K. Davenport, MAP kinase pathways in the yeast Saccharomyces cerevisiae, Microbiol. Mol. Biol. Rev. 62 (1998) 1264–1300. [36] R. Mehrabi, X. Zhao, Y. Kim, J.R. Xu, The cAMP signaling and MAP kinase pathways in plant pathogenic fungi, in: H.B. Deising (Ed.), The Mycota, Plant Relationships, vol. 5, Berlin Springer-Heidelberg, 2009, pp. 157–172. [37] X. Zhao, Y. Kim, G. Park, J.R. Xu, A mitogen–activated protein kinase cascade regulating infection–related morphogenesis in Magnaporthe grisea, The Plant Cell 17 (2005) 1317–1329. [38] M. Asakura, T. Okuno, Y. Takano, Multiple contributions of peroxisomal metabolic function to fungal pathogenicity in Colletotrichum lagenarium, Appl. Environ. Microbiol. 72 (2006) 6345–6354. [39] Z.Y. Wang, D.M. Soanes, M.J. Kershaw, N.J. Talbot, Functional analysis of lipid metabolism in Magnaporthe grisea reveals a requirement for peroxisomal fatty acid β–oxidation during appressorium–mediated plant infection, Molecular plant-microbe interactions 20 (2007) 475–491. [40] R.C. Pascon, T.M. Ganous, J.M. Kingsbury, G.M. Cox, J.H. McCusker, Cryptococcus neoformans methionine synthase: expression analysis and requirement for virulence, Microbiology 150 (2004) 3013–3023. [41] A.J. Foster, J.M. Jenkinson, N.J. Talbot, Trehalose synthesis and metabolism are required at different stages of plant infection by Magnaporthe grisea, EMBO J. 22 (2003) 225–235. [42] A.K.W.K. Jan, D.M. Veenhuis, I.J. van der klei, PEX genes in fungal genomes: common, rare or redundant, Traffic 7 (2006) 1291–1303. [43] G. Steinberg, Hyphal growth: a tale of motors, lipids, The Spitzenkörper. Eukaryotic cell 6 (2007) 351–360. [44] I. Schuchardt, D. Aßmann, E. Thines, C. Schuberth, G. Steinberg, Myosin–V, Kinesin–1, and Kinesin–3 cooperate in hyphal growth of the fungus Ustilago maydis, Mol. Biol. Cell 16 (2005) 5191–5201. [45] J. Schirawski, H.U. Böhnert, G. Steinberg, K. Snetselaar, L. Adamikowa, R. Kahmann, Endoplasmic reticulum glucosidase II is required for pathogenicity of Ustilago maydis, Plant Cell 17 (2005) 3532–3543. [46] J. Glazebrook, Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens, Annu. Rev. Phytopathol. 43 (2005) 205–227. [47] A.A. Hall, L. Bindslev, J. Rouster, S.W. Rasmussen, R.P. Oliver, S.J. Gurr, Involvement of cAMP and protein kinase A in conidial differentiation by Erysiphe graminis f. sp. hordei, Molecular plant–microbe interactions 12 (1999) 960–968. [48] K. Adachi, J.E. Hamer, Divergent cAMP signaling pathways regulate growth and pathogenesis in the rice blast fungus Magnaporthe grisea, The Plant Cell 10 (1998) 1361–1373. [49] X. Zhao, R. Mehrabi, J.R. Xu, Mitogen–activated protein kinase pathways and fungal pathogenesis, Eukaryot. Cell 6 (2007) 1701–1714. [50] X. Zhao, J.R. Xu, A highly conserved MAPK‐docking site in Mst7 is essential for Pmk1 activation in Magnaporthe grisea, Mol. Microbiol. 63 (2007) 881–894. [51] L.A. Maggio–Hall, N.P. Keller, Mitochondrial β-oxidation in Aspergillus nidulans, Mol. Microbiol. 54 (2004) 1173–1185. [52] A.M. Bocsanczy, D.J. Schneider, G.A. DeClerck, S. Cartinhour, S.V. Beer, HopX1 in Erwinia amylovora functions as an avirulence protein in apple and is regulated by HrpL, J. Bacteriol. (2012) 553–560. [53] D. Büttner, S.Y. He, Type III protein secretion in plant pathogenic bacteria, Plant Physiol. 150 (2009) 1656–1664. [54] K. Tsuda, F. Katagiri, Comparing signaling mechanisms engaged in pattern–triggered and effector–triggered immunity, Curr. Opin. Plant Biol. 13 (2010) 459–465. [55] J.D. Jones, J.L. Dangl, The plant immune system, Nature 444 (2006) 323–329. [56] U.P. Singh, B. Prithiviraj, B.K. Sarma, Development of Erysiphe pisi on some pea (Pisum sativum) cultivare and on non-hosts, J. Plant Dis. Prot. 107 (2000) 53–58. [57] D.A.W.N. Foster Hartnett, D. Dariush, P. Silvia, N. Sharopova, E. Gabriella, A.V. Kathryn, D.Y. Nevin, A.S. Deborah, Molecular and cytological responses of Medicago truncatula to Erysiphe pisi, Mol. Plant Pathol. 8 (2007) 307–319.

Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2019.103680. References [1] S.C. Harlands, Inheritance of immunity to powdery mildew in Peruvian forms of Pisum sativum, Heredity 2 (1948) 263–269. [2] W.H. Pierce, Resistance to powdery mildew in peas, Phytopathology 38 (1948) 21. [3] R.J. Heringa, A.V. Norei, M.F. Tazelaar, Resistance to powdery mildew (Erysiphe polygoni D.C.) in peas (Pisum sativum L.), Euphytica 18 (1969) 163–169. [4] S. Fondevilla, T.L.W. Carver, M.T. Moreno, D. Rubiales, Macroscopic and histological characterization of genes er- 1 and er-2 for powdery mildew resistance in pea, Eur. J. Plant Pathol. (2006) 115. [5] M. Bheri, G. Fareeda, R. Makandar, Assessing host specialization of Erysiphe pisi on garden pea germplasm through genotypic and phenotypic characterization, Euphytica 212 (2016) 1–14. [6] J. Kinane, R.P. Oliver, Evidence that the appressorial development in barley powdery mildew is controlled by MAP kinase activity in conjunction with the cAMP pathway, Fungal Genet. Biol. 39 (2003) 94–102. [7] R. Huckelhoven, Powdery mildew susceptibility and biotrophic infection strategies. A mini review, FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 245 (2005) 9–17. [8] Z. Zhang, S.J. Gurr, Expression and sequence analysis of the Blumeria graminis mitogen–activated protein kinase genes, mpk1 and mpk2, Gene 266 (2001) 57–65. [9] C. Micali, K. Göllner, M. Humphry, C. Consonni, R. Panstruga, The powdery mildew disease of Arabidopsis: a paradigm for the interaction between plants and biotrophic fungi, Arabidopsis Book 6 (2008) –0115. [10] S.T. Chisholm, G. Coaker, B. Day, B.J. Staskawicz, Host-microbe interactions: shaping the evolution of the plant immune response, Cell 124 (2006) 803–814. [11] V. Katoch, S. Sharma, S. Pathania, D.K. Banayal, S.K. Sharma, R. Rathour, Molecular mapping of pea powdery mildew resistance gene er2 to pea linkage group III, Mol. Breed. 25 (2010) 229–237. [12] S.M. Bhosle, N. Marathe, R. Makandar, The er2 gene resistance against powdery mildew infection is associated with enhanced antioxidative protection and defense gene expression, Physiol. Mol. Plant Pathol. 106 (2019) 253–262. [13] K.R.W. Hammett, Taxonomy of erysiphaceae in New Zealand, N. Z. J. Bot. 15 (1977) 687–711. [14] U. Braun, A Monograph of the Erysiphales (Powdery Mildews), Schweizerbart’sche Verlagsbuchhandlung, Stuttgart, Germany, 1987. [15] H.D. Shin, Y.J. La, Morphology of edge lines of chained immature conidia on conidiophores in powdery mildew fungi and their taxonomic significance, Mycotaxon 46 (1993) 445–451. [16] K.A. Zeller, M. Levy, Intraspecies differentiation in the powdery mildew Erysiphe cichoraceaum determined with rDNA RFLP's, Mol. Ecol. 4 (1995) 277–283. [17] R.T.A. Cook, A.J.J. Inman, C. Billings, Identification and classification of powdery mildew anamorphs using light and scanning electron microscopy and host range data, Mycol. Res. 101 (1997) 975–1002. [18] G.S. Saenz, J.W. Taylor, Phylogeny of the Erysiphales (powdery mildews) inferred from internal transcribed spacer ribosomal DNA sequences, Can. J. Bot. 77 (1999) 150–168. [19] R.N. Attanayake, D.A. Glawe, F.M. Dugan, W.D. Chen, Erysiphe trifolii causing powdery mildew of lentil (Lens culinaris), Plant Dis. 93 (2009) 797–803. [20] X. Li, Z. Bi, R. Di, P. Liang, Q. He, W. Liu, W. Miao, F. Zheng, Identification of powdery mildew responsive genes in Hevea brasiliensis through mRNA differential display, Int. J. Mol. Sci. 17 (2016) 1–17. [21] J.J. Doyle, J.L. Doyle, A rapid DNA isolation procedure from small quantities of fresh leaf tissue, Phytochem Bull 19 (1987) 11–15. [22] K.D. Devi, K. Punyarani, N.S. Singh, H.S. Devi, An Efficient Protocol for Total DNA Extraction from the Members of Order Zingiberales- Suitable for Diverse PCR Based Downstream Applications, Springer plus, 2013 2-669. [23] M. Saghai–Maroof, K. Soliman, R. Jorgensen, R. Allard, Ribosomal DNA spacer–length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics, Proc. Natl. Acad. Sci. U.S.A. 81 (1984) 8014–8018. [24] D.M. Soanes, I. Alam, M. Cornell, H.M. Wong, C. Hedeler, N.W. Paton, M. Rattray, S.J. Hubbard, S.G. Oliver, N.J. Talbot, Comparative genome analysis of filamentous fungi reveals gene family expansions associated with fungal pathogenesis, PLoS One 3 (2008) e2300. [25] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real–time quantitative PCR and the 2ΔΔC(T) Method, Methods 25 (2001) 402–408. [26] R. Oliver, A. Osbourn, Molecular dissection of fungal phyto–pathogenicity, Microbiology 141 (1995) 1–9. [27] U. Braun, The Powdery Mildews (Erysiphales) of Europe, Gustav Fischer Verlag, New York, USA, 1995. [28] R.N. Attanayake, D.A. Glawe, K.E. McPhee, F.M. Dugan, W. Chen, Erysiphe trifolii - a newly recognized powdery mildew pathogen of pea, Plant Pathol. 59 (2010) 712–720.

11