Detection of shrimp hemocyte iridescent virus by recombinase polymerase amplification assay

Journal Pre-proof Detection of shrimp hemocyte iridescent virus by recombinase polymerase amplification assay Zhengwei Chen, Jun Huang, Fang Zhang, Yang Zhou, Huijie Huang PII:

S0890-8508(19)30281-6

DOI:

https://doi.org/10.1016/j.mcp.2019.101475

Reference:

YMCPR 101475

To appear in:

Molecular and Cellular Probes

Received Date: 29 July 2019 Revised Date:

27 September 2019

Accepted Date: 22 October 2019

Please cite this article as: Chen Z, Huang J, Zhang F, Zhou Y, Huang H, Detection of shrimp hemocyte iridescent virus by recombinase polymerase amplification assay, Molecular and Cellular Probes (2019), doi: https://doi.org/10.1016/j.mcp.2019.101475. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.

[Title Page] Detection of Shrimp Hemocyte Iridescent Virus by Recombinase Polymerase Amplification Assay Zhengwei Chen1,2,3, *, Jun Huang4, Fang Zhang1, *, Yang Zhou5 and Huijie Huang1,2, * 1

2 3 4

5

*

Laboratory of Information Optics and Optoelectronic Technology, Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai, P. R. China; University of Chinese Academy of Sciences, Beijing, P. R. China; Center of Engineering Training, Zhejiang University of Science and Technology, Hangzhou, P. R. China; College of Biological and Chemical Engineering, Zhejiang University of Science and Technology, Hangzhou, P. R. China; College of Information and Electronic Engineering, Zhejiang University of Science and Technology, Hangzhou, P. R. China; Correspondence: [email protected] (Z.C.); [email protected] (F.Z.);

[email protected] (H.H.); Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, No. 390, Qinghe Road, Jiading District, Shanghai 201800, China

Abstract Shrimp hemocyte iridescent virus (SHIV), which was first identified in white leg shrimp (Litopenaeus vannamei) in China in 2014, can cause extensive shrimp mortality and major economic losses in the shrimp farming industry in China. In this study, a novel real-time isothermal recombinase polymerase amplification (RPA) assay was developed using a TwistAmp exo kit for SHIV detection. First, five primers and a probe were designed for the major capsid protein gene (GenBank: KY681039.1) according to the TwistDx manual; next, the optimal primers were selected by a comparison experiment. The primers and probe were specific for SHIV and did not react with shrimp white spot syndrome virus (WSSV), shrimp infectious hypodermal and hematopoietic necrosis virus (IHHNV), shrimp enterocytozoon hepatopenaei (EHP), and macrobrachium rosenbergii nodavirus (MrNV) samples, as well as pathogens of acute hepatopancreatic necrosis disease (AHPND). The RPA assay reached a detection limit of 11 copies per reaction according to probit regression analysis. In addition, RPA assay detected the positive plasmid samples at concentration of 1000 copies/µL within 16.04±0.72 min at a single low operation temperature (39°C). The results proved that the proposed RPA method was an accurate, sensitive, affordable, and rapid detection tool that can be suitably applied for the diagnosis of SHIV in field conditions and in resource-poor settings. Keywords: pathogen detection; shrimp hemocyte iridescent virus (SHIV); shrimp; recombinase polymerase amplification (RPA); field diagnosis

Acknowledgments： ：We would like to thank Xiaoye Zheng (Zhejiang Fisheries Technical Extension Station, Hangzhou, Zhejiang 310023, China) for providing shrimp samples. Funding: This work was supported by the grants from the Key International Innovative and Collaborative Project in Science & Technology of China (grant number 2016YFE0110600), the International Innovative and Collaborative Project in Science & Technology of Shanghai (grant number 16520710500), the Science and Technology Commission of Shanghai Municipality (grant number 17YF1429500), and the Science Foundation for Young Scholars of Zhejiang University of Science and Technology (grant number 2019QN55).

1. Introduction The shrimp hemocyte iridescent virus (SHIV), a newly identified member of the iridoviridae family, has a diameter between 120 and 300 nm, and single linear double-stranded DNA molecule [1,2]. One typical SHIV infection case that caused massive mortality occurred in December of 2014 in Zhejiang Province, China, was reported by Chen et al. and Qiu et al. [1-4]. The recent study found SHIV in white-leg shrimp, the most important crustacean species in aquaculture worldwide. White-leg shrimp account for a dominant portion of total crustacean production in the global aquaculture market, and high levels of mortality, caused by SHIV, could severely damage shrimp farming operations and lead to major economic losses [2]. Hence, it is critical to develop an effective and rapid SHIV detection method. Metagenomics sequencing and phylogenetic analyses of SHIV have been conducted, and a specific nested-PCR assay was developed for SHIV detection [1,2]. In the nested-PCR assay, external and internal primers are used to amplify targeted DNA fragments in two successive runs. Although two successive amplifications increase the specificity and sensitivity of detection, the processes are time-consuming (usually more than three hours). In addition, the nested-PCR technology requires the user to remove the product from the tube in the electrophoretic device after amplification, which might increase the risk of cross-contamination. Real time polymerase chain reaction (qPCR) assay, an alternative approach for quantitative or qualitative analysis of SHIV in shrimp, was developed by Qiu et al. [4]. The qPCR technique is very sensitive, specific, and accurate [4,5]. Compared with the nested PCR method, the fluorescent signal of the sample is monitored during amplification and the result is directly given by a qPCR machine, thereby eliminating the need of electrophoretic analysis and thus avoids the risk of cross-contamination during product transformation. However, the qPCR method requires expensive and large devices as well as a long amplification time (usually more than one hour). Recombinase polymerase amplification (RPA), which was developed by TwistDx in 2006, provides a promising new method for isothermal amplification of nucleic acids [6-12]. This technology enables PCR-like DNA amplification through the binding of three core proteins, isothermal recombinase, single-strand DNA binding protein, and strand-displacing polymerase. Compared with qPCR, RPA does not require thermal cycling controlled by a large expensive apparatus but has a comparable sensitivity and specificity [7,8]. In addition, RPA has a significantly shorter reaction time. At the optimum reaction temperature, the amplification efficiency reaches to the peak and the target DNA molecules can be rapidly

amplified to detectable levels within 5-30 minutes. This technology has the competitive advantages of a constantly low reaction temperature (37-42°C), rapid detection, and low cost [7,11]. The RPA technique has been successfully applied for the diagnosis of different kinds of pathogens [7-23]; however, to our knowledge, no report exists regarding the use of RPA in SHIV detection. In the present study, an RPA-based method for SHIV detection was developed and validated, which provided a technical reference for rapid diagnosis and prevention of SHIV infection. 2. Materials and methods 2.1. Sample collection and DNA extraction All the Litopenaeus vannamei samples used in the present study were provided by Zhejiang Aquatic Technology Promotion Station and collected from the farms in Zhejiang Province in China. The samples were prepared in accordance with the protocol titled Quarantine Sampling Standard of Aquatic Animals (SC/T 7103-2008). The shrimp samples were stored in 95% alcohol in 50 mL centrifuge tubes, which were held at −80°C. For each test, approximately 30 mg of shrimp tissues were homogenized for 20 min by a Bioprep-24 homogenizer (Hangzhou Allsheng Instrument Co., Ltd., Hangzhou, China) at 6 m/s speed; next, the product of each sample was transferred to a 1.5 mL centrifuge tube for DNA extraction. A DNA Extraction Kit (DP304-3, Tiangen, Beijing, China) was used in the extraction procedure following the protocol provided by the manufacturer. Finally, the concentration and purity of the obtained DNA were measured using a micro spectrophotometer (NanoDropTM One, Thermo Fisher Scientific, Waltham, MA, USA). 2.2. Preparation of positive plasmid The SHIV major capsid protein gene (MCP, GenBank: KY681039.1) was synthesized by Generic Biosystems (Anhui) Co., Ltd., (Chuzhou, Anhui, China). Here, PUC57-MCP was used as the positive plasmid. The concentration of the plasmid sample was determined using a NanoDropTM One micro spectrophotometer [7]. 2.3. RPA primers and probe According to the instructions for the RPA kit (TwistDX, Cambridge, United Kingdom) [24], RPA requires a longer length of the primer (approximately 30-35 nucleotides) than that required for PCR analysis. Therefore, the primer design should take into account multiple factors, including hairpin

structure, mismatch, primer dimer, and amplification efficiency [24]. In the present study, five primer pairs and a probe were designed for MCP gene according to the manual of TwistDx and the optimal primer pair was determined by a comparison experiment. Subsequently, the sequences of the probe and primer pairs were compared with the sequences of other pathogens, such as shrimp white spot syndrome virus (WSSV), shrimp infectious hypodermal and hematopoietic necrosis virus (IHHNV), shrimp Enterocytozoon hepatopenaei (EHP), Macrobrachium rosenbergii nodavirus (MrNV), and Acute hepatopancreatic necrosis disease (AHPND). This was done to determine the specificity of the primers and probe by using the Basic Local Alignment Search Tool at online system from the US National Center for Biotechnology Information. The designed primers and probe, shown in Table 1, were synthesized by Generic Biosystems (Anhui) Co., Ltd. Table 1. Primers and probes designed for shrimp hemocyte iridescent virus

Primer RPA-F 1

RPA-R 1

RPA-F 2

RPA-R 2

RPA-F 3

RPA-R 3

RPA-F 4

RPA-R 4

RPA-F 5

RPA-R 5

RPA-P robe qPCRFa qPCRRa

Number of Sequence (5’-3’) nucleoti des 2 CAGAGCGCATTCGATCCCATAGGCACCGC 9 3 CCCAGAAGGATCAACATTGTTCATCTTGAG 0 3 CACCCGTACCCGACGCCGACAAGATTGATT 0 3 CTTGGCTTCACCTTCACCCTTTGCCGCTTTA 1 3 ATCACCCGTACCCGACGCCGACAAGATTGATTT 3 3 CAGTCTTGGCTTCACCTTCACCCTTTGCCGCTTT 4 3 CCCAGATCAGAGCGCATTCGATCCCATAGGCACC 4 3 CATTGTTCATCTTGAGAGCGTAAGAGAACATGTGG 5 3 CAGATCAGAGCGCATTCGATCCCATAGGCACCGC 4 3 CGTAAGAGAACATGTGGTATCCGGTGAGTTCGGG 4 4 ATACGAATCTTCAGATCGTATTCCCGTGA(FAM-dT)G(THF)C(BHQ1-d 8 T)GCCGATTACTTCTC(Phosphorylation) 2 AGGAGAGGGAAATAACGGGAAAAC 4 2 CGTCAGCATTTGGTTCATCCATG 3

qPCR-Pro bea 7 a

2

CTGCCCATCTAACACCATCTCCCGCCC

from Liang Qiu et al.[4].

Purp ose RPA RPA RPA RPA RPA RPA RPA RPA RPA RPA RPA qPC R qPC R qPC R

2.4. RPA system and procedure Following the instructions for the TwistAmp exo kit (TwistDX, Cambridge, United Kingdom), RPA reactions were performed at 39℃ in 50 µL volumes consisting of 25 µL of 2 × reaction buffer, 2.1 µL of primer-F (10 µM), 2.1 µL of primer-R (10 µM), 0.6 µL of RPA probe, 5 µL of 10 × Probe E-mix, 8.2 µL of d NTPs (10 µM), 2.5 µL 20 × Core Reaction Mix, 1 µL of 50 × Exo, and 1 µL of DNA template [7,8,24]. After thoroughly mixing, 2.5 µL of 280 mM MgAc was added into the reaction system. The solution was then centrifuged and placed in an ABI Step One instrument (Applied Biosystems, Foster City, CA, USA) for RPA reaction. The reaction protocol included 40 cycles; each cycle consisted of two steps, 39°C for 45 s and 15 s in the first and second step, respectively. The fluorescent signals were measured in the last 6 s of the second step of each cycle. 2.5. Determination of specificity and sensitivity The positive plasmid samples at a concentration of 106 copies/µL were used as the positive control group, and the equivalent volume of deionized water samples were used as the negative control (NC) group. The genomic DNA samples extracted from the pathogens (WSSV, IHHNV, EHP, MrNV, and AHPND) were used for comparison to determine the specificity of the designed SHIV primer set. The positive plasmid samples were diluted to obtain samples at concentrations of 1, 10, 102, 103, 104, and 105 copies/µL, each of which was tested by RPA method. Finally, probit regression analysis was done and the limit of detection at 95 % probability was calculated. 2.6. qPCR system and procedure Following the procedure described previously by Qiu et al. [4], primers and a probe (shown in the Table 1) synthesized by Generic Biosystems (Anhui) Co., Ltd., were used for qPCR. The reaction system had a volume of 20 µL consisting of 10 µL of 2 × Probe Master Mix (AceQ U+, Vazyme Biotech Co.,Ltd, Nanjing, China), 0.4 µL of primer F, 0.4 µL of primer R, 0.2 µL of probe, 1 µL of template, and 8 µL of ddH2O. The qPCR protocol was as follows: 37℃ for 2 minutes, 95℃ for 5 minutes, 60 cycles at 95℃ for 10 seconds, and 60℃ for 30 seconds. 3. Results 3.1. Primer screening The positive plasmid samples at concentration of 105 copies/µL were subjected to an RPA reaction using different sets of primers. The amplification efficiency and threshold time varies among different

prime sets, of which the fifth prime set (RPA-F5 and RPA-R5) shows the highest amplification efficiency (Fig. 1). Hence, the fifth set of primers was used in the subsequent experiments. 3.2. RPA specificity The results of the primer specificity test (Fig. 2) show that a significant increase of characteristic fluorescence signals (curves) was detected from the positive plasmid samples (SHIV) but not from the samples infected with the pathogens (WSSV, IHHNV, EHP, MrNV, and AHPND), as well as SHIV-free and NC samples. This indicates that the primers designed in this study distinguished SHIV from other pathogens and did not generate false positive results, suggesting the proposed RPA method has a high specificity.

Fig. 1. Primer screening. (a) Amplification curves of the positive plasmid samples using different primer sets. (b) Threshold times of the amplifications using different primer sets. SD: standard deviation.

Fig. 2. Amplification curves of the WSSV, IHHNV, AHPND, MrNV, EHP, SHIV-free shrimp, as well as the positive (SHIV) and negative (NC) control samples. 3.3. RPA sensitivity The results of the sensitivity experiment show that the ∆Rns at the endpoints of the RPA reactions gradually decreased while the initial template concentrations decreased, which is consistent with the findings previously reported [15,22]. So, it is difficult to determine whether the result is positive or negative for low-concentration samples due to ambiguousness at lower concentrations. Therefore, it is necessary to set an appropriate threshold and optimize the probe concentration in the reaction system. According to the method that calculates the threshold value based on the standard deviation of negative controls [25,26], the threshold was set as the maximum ∆Rn among all negative control samples plus three times the mean standard deviations of all negative control samples during a defined time range (i.e. from the 5th to 35th cycle of amplification). A sample was considered positive if its maximum ∆Rn was greater than the threshold value, and otherwise negative. Further, we optimized the probe concentration by manipulating the probe volume (0.6 µL, 0.9 µL,1.2 µL, or 1.8 µL) in the reaction systems of the negative control sample (1 µL of deionized water) and SHIV plasmid sample (1 µL of SHIV plasmid sample at the concentration of 100 copies/µL ). The RPA

amplification curves of the negative control and SHIV plasmid samples were compared to determine the optimal volume of the probe. The experiment for each of negative control and SHIV plasmid samples was repeated three times. As shown in Fig. 3, the ∆Rn at the endpoint significantly increases with the increase of the probe volume when the probe volume is less than or equal to 1.2 µL, and it stops increasing when more than 1.2 µL of the probe is in the reaction system. The increased ∆Rns at the endpoint clearly distinguish low-concentration samples from the negative samples. Therefore, we chose to use 1.2 µL of the probe in the sensitivity experiment.

Fig. 3. Optimization of probe concentration in the reaction system. (a) 0.6 µL of probe. (b) 0.9 µL of probe. (c) 1.2 µL of probe. (d) 1.8 µL of probe. NC represents negative control samples. SHIV represents SHIV plasmid sample at the concentration of 100 copies/ µL.

Fig. 4. Performance of RPA using serial dilutions of SHIV-positive plasmid samples. The representative amplification curves from three runs of RPA show that the amplifications were successful in the RPA reactions using SHIV-positive plasmid samples in a concentration range of 105 to 101 copies/µL. NC, 1E1, 1E2, 1E3, 1E4, and 1E5 denote the samples at the concentrations of 0, 1 × 101, 1 × 102, 1 × 103, 1 × 104, and 1 × 105 copies/µL, respectively. The results of the sensitivity experiment are shown in Fig. 4. The amplifications were successful in all five concentrations (1 ×101, 1 ×102, 1 ×103, 1 ×104, and 1 ×105 copies/µL) of the positive plasmid samples when using the RPA method. Next, probit regression analysis was conducted to further determine the sensitivity of the RPA method [7,8,17] using the SHIV-positive plasmid samples at concentrations of 1 ×1, 1 ×10, 1 ×102, 1 ×103, and 1 ×104 copies/µL. Each concentration was tested eight times. The final sensitivity, 11 copies per reaction, was determined at the 95% level of sample positivity from the probit regression profile (Fig. 5).

Fig. 5. Sensitivity of the recombinase polymerase amplification (RPA) assay determined by using probit regression analyses. Serial dilutions (1, 10, 1 × 102, 1 × 103, and 1 × 104 copies/µL) of the positive plasmid samples were used as templates in the RPA reactions; each concentration was tested for eight times for probit regressions. The prisms mark the proportion of the samples positive at each log10 genomic quantity level; the solid line marks the predicted frequency of the samples positive as a function of log10 genomic quantity input, and the dotted line is a visual marker indicating the 95% level of sample positivity. 3.4. Reaction time The SHIV-RPA method developed in the present study detected the positive plasmid samples at concentration of 1000 copies/µL within 16.04±0.72 min, while qPCR method established by Qiu et al. [4] required 55.7 ± 0.9 min. In other words, the RPA-based detection saved almost 40 min in comparison with the qPCR assay. 3.5. Detection performance on shrimp samples Twenty shrimp samples, which were collected in seedling farms and other farms in Zhejiang Province in China, were used to validate the proposed RPA-based detection method for SHIV infection. As shown in Fig. 6 and Table 2, the RPA-based method showed fifteen positive cases and five negative cases, which was consistent with the result of the qPCR method. Table 2. RPA and qPCR results of 20 shrimp samples Sample ID RPA qPCR Sample ID

1 Positive Positive 6

2 Positive Positive 7

3 Positive Positive 8

4 Positive Positive 9

5 Positive Positive 10

RPA qPCR Sample ID RPA qPCR Sample ID RPA qPCR

Positive Positive 11 Positive Positive 16 Negative Negative

Positive Positive 12 Positive Positive 17 Negative Negative

Positive Positive 13 Positive Positive 18 Negative Negative

Positive Positive 14 Positive Positive 19 Negative Negative

Positive Positive 15 Positive Positive 20 Negative Negative

Fig. 6. Amplification curves of 20 shrimp samples. Blue: positive samples; black: negative samples; NC: negative control. (a) shows the data of recombinase polymerase amplification (RPA), and (b) shows the data of real time polymerase chain reaction (qPCR). 4. Discussion SHIV, a new pathogen detected in Litopenaeus vannamei in Zhejiang Province, China, in 2014, can cause various clinical symptoms, including empty stomach and soft shell, and guts, pale hepatopancreas [1-4]. This pathogen is a new threat to the shrimp farming industry. Currently, diagnostic methods for SHIV infection include electron microscopy, nested PCR, and qPCR methods [1-4]. However, these three methods require expensive equipment, complicated procedures, and highly trained personnel; as a result, they can only be carried out in professional laboratories and cannot meet the needs of on-site rapid detection in aquaculture units. As a new type of nucleic acid amplification detection technology, RPA can overcome the shortcomings of the methods above and allow realization of field diagnosis or point-of-care testing because it provides the following advantages. First, other than primers, probes, and test samples, the components needed for RPA, including the enzymes, nucleotides, and buffer, are readily available in a

convenient and stable form of lyophilized powder (dry-formulated RPA reagents) and can be easily stored and transported at a room temperature [24]. Second, the RPA reaction requires only an easily acquired fixed low temperature in the range of 37-42℃. Compared with PCR methods and other isothermal amplification methods, including loop-mediated isothermal amplification and cross-priming amplification that require a higher reaction temperature of approximately 63℃, the RPA method consumes less energy and can be performed with battery-operated portable instruments [6,13,24]. Third, RPA has a remarkably shorter reaction time. The SHIV-RPA method developed in this study only took 16.04±0.72 min to detect the positive plasmid samples at concentration of 1000 copies/µL, which is much faster than the qPCR method (55.7 ± 0.9 min). Moreover, the cost of RPA detection can be further decreased by using inexpensive portable instruments such as ESE-Quant Tube scanner (Qiagen Lake Constance GmbH, Stockach, Germany), Genie III instrument (OptiGene, Horsham, UK), or Gene-8C/Gene-8C2 instrument (Hangzhou Allsheng Instrument Co., Ltd, Hangzhou, China), in combination with simple and low-cost commercial DNA extraction methods, such as the magnetic bead-based technology and heated NaOH method. Hence, RPA is a promising detection tool suitable for the field conditions and resource-poor diagnostic settings [22-24]. The RPA technique has been successfully used to detect various bacteria, viruses, and parasites [7-23]. A number of studies concerning the application of RPA in detecting pathogens from aquatic organisms have been reported [7,8,18]. The real-time fluorescence RPA method reached a detection limit of 10 copies of RNA molecules for WSSV [7] and 4 copies of RNA molecules within 7 min for IHHNV [8]. Prescott et al. [18] used the lateral-flow technology to detect cyprinid herpesvirus 3 and reached a sensitivity of at least 10 copies of RNA molecules. Some previous studies have argued that the longer primers (30-35 nucleotides) used in the RPA assays are prone to cause non-specific amplification and generate higher background noise for negative control samples, which would lower the detection sensitivity of the method [27]. However, this drawback can be overcome by carefully designing and screening the probes and primers according to the TwistDx user manual. In addition, other tools that have been developed in recent years, including lateral flow dipsticks, enzyme-linked immunosorbent assays, aptamer-based bio-barcodes, and hybridization in the microarray format, can be jointly used with an RPA assay to improve its performance [21-23,28-32]. RPA can serve as a highly sensitive tool for pathogen detection. Xia et al., James et al., and Teoh et al. used RPA for early detection of IHHNV, Ebolavirus, and dengue virus, respectively [8,15,33]. In addition

to high sensitivity, the success of RPA-based early detection of SHIV relies on appropriate target sequences. Using a target gene sequence that is massively amplified at the early stage of infection significantly improves the performance of RPA-based early detection. As of this date, the sequences used for SHIV detection include MCP sequence, ATPase sequence, ribonucleotide reductase (RNR) sequence, and DNA methyltransferase gene [4]. In the future research, the expression pattern of these genes in the SHIV-infected shrimp should be further clarified to identify the optimal target sequence for RPA detection. Due to its high specificity, high sensitivity and easy field use, the RPA method using a highly effective target sequence can be used to screen the asymptomatic shrimp at early stage of infection in a timely manner; as a result, the necessary measures, including quarantining the infected shrimp to stop the spread of viruses and enhancing the immunity of shrimp, can be taken as early as possible to reduce the economic loss. In the present study, the sensitivity of the RPA-based method was 11 copies (0.05 fg) per reaction, which was much better than 36 fg of the nested-PCR method proposed by Qiu et al. and slightly worse than 4 copies per reaction of the qPCR method proposed by Qiu et al., met the general standard of microbial detection [2,4,11,19,22]. 5. Conclusions A real-time fluorescent RPA method was developed for the detection of SHIV, which showed a sensitivity of 11 copies per reaction. The proposed method was rapid, specific, sensitive, reproducible, convenient, and did not have any cross-reaction with DNA samples extracted from the pathogens (WSSV, IHHNV, EHP, MrNV, and AHPND). Because it uses a fixed low reaction temperature, simple operating procedures, and rapid amplification speed, RPA can serve as a useful diagnostic tool for the rapid detection of SHIV. The application of this user-friendly method can help control the propagation of SHIV disease to avoid large-scale SHIV outbreaks, thereby playing an important role in the healthy development of the shrimp industry. Disclosure of conflict-of-interest The authors declare no conflict of interest. References [1]

L. Qiu, M.M. Chen, R.Y. Wang, X.Y. Wan, C. Li, Q.L. Zhang, et al. Complete genome sequence of shrimp hemocyte iridescent virus (SHIV) isolated from white leg shrimp, Litopenaeus vannamei. Arch. Virol., 163(3) (2018) 781-785. http://doi.org/10.1007/s00705-017-3642-4.

[2]

[3] [4]

[5]

[6] [7]

[8]

[9]

[10]

[11] [12] [13]

[14] [15]

[16]

[17] [18]

[19]

[20]

[21]

L. Qiu, M.M. Chen, X.Y. Wan, C. Li, Q.L. Zhang, R.Y. Wang, et al. Characterization of a new member of Iridoviridae, Shrimp hemocyte iridescent virus (SHIV), found in white leg shrimp (Litopenaeus vannamei). Sci. Rep., 7(1) (2017) 11834. http://doi.org/10.1038/s41598-017-10738-8. M.M. Chen. Application of Real-time PCR in detection of pathogens VPAHPND and SHIV of Litopenaeus vannamei [dissertation]. ShangHai, ShangHai Ocean University, (2017), Chinese. L. Qiu, M.M. Chen, X.Y. Wan, Q.L. Zhang, C. Li, X. Dong, et al. Detection and quantification of shrimp hemocyte iridescent virus by TaqMan probe based real-time PCR. J. Invertebr. Pathol., 154 (2018) 95-101. http://doi.org/10.1016/j.jip.2018.04.005. F. Mendoza-Cano, A. Sánchez-Paz. Development and validation of a quantitative real-time polymerase chain assay for universal detection of the White Spot Syndrome Virus in marine crustaceans. Virol. J., 10 (2013) 186. http://doi.org/10.1186/1743-422X-10-186. O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes. DNA detection using recombination proteins. PLoS Biol., 4(7) (2006) e204. http://doi.org/10.1371/journal.pbio.0040204. X. Xia, Y. Yu, M. Weidmann, Y. Pan, S. Yan, Y. Wang. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay. PLoS One, 9(8) (2014) e104667. http://doi.org/10.1371/journal.pone.0104667. X. Xia, Y. Yu , L. Hu, M. Weidmann, Y. Pan, S. Yan, et al. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay. Arch. Virol., 160(4) (2015) 987-994. http://doi.org/10.1007/s00705-015-2357-7. E. Tian, Q. Liu, H. Ye, F. Li, Z. Chao. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao). Molecules, 22(12) (2017) 2261. http://doi.org/10.3390/molecules22122261. Y. Qi, Q. Yin, Y. Shao, S. Li, H. Chen, W. Shen, et al. Rapid and Visual Detection of Coxiella burnetii Using Recombinase Polymerase Amplification Combined with Lateral Flow Strips. Biomed Res. Int., 2018 (2018)6417354. http://doi.org/10.1155/2018/6417354. R.K. Daher, G. Stewart, M. Boissinot, M.G. Bergeron. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem., 62(7) (2016) 947-958. http://doi.org/10.1373/clinchem.2015.245829. G. Silva, J. Oyekanmi, C.K. Nkere, M. Bömer, P.L. Kumar, S.E. Seal. Rapid detection of potyviruses from crude plant extracts. Anal. Biochem., 546 (2018) 17-22. http://doi.org/10.1016/j.ab.2018.01.019. B. Babu, F.M. Ochoa-Corona, M.L. Paret. Recombinase polymerase amplification applied to plant virus detection and potential implications. Anal. Biochem., 546 (2018) 72-77. http://doi.org/10.1016/j.ab.2018.01.021. S. Kumar, A. Kumar, G. Venkatesan. Isothermal Nucleic Acid Amplification System: An Update on Methods and Applications. J. Genet. Genom., 2 (2018) 112. Y. Yang, X. Qin, G. Wang, Y. Zhang, Y. Shang, Z. Zhang. Development of a fluorescent probe-based recombinase polymerase amplification assay for rapid detection of Orf virus. Virol. J., 12 (2015) 206. http://doi.org/10.1186/s12985-015-0440-z. H. Soliman, G. Kumar, M. El-Matbouli. Recombinase polymerase amplification assay combined with a lateral flow dipstick for rapid detection of Tetracapsuloides bryosalmonae, the causative agent of proliferative kidney disease in salmonids. Parasit. Vectors, 11(1) (2018) 234. http://doi.org/10.1186/s13071-018-2825-5. M.D. Moore, L.A. Jaykus. Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses. Sci. Rep., 7 (2017) 40244. http://doi.org/10.1038/srep40244. M.A. Prescott, A.N. Reed, L. Jin, M.K. Pastey. Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification. J. Aquat. Anim. Health, 28(3) (2016) 173-180. http://doi.org/10.1080/08997659.2016.1185048. A.S. James, S. Todd, N.M. Pollak, G.A. Marsh, J. Macdonald. Ebolavirus diagnosis made simple, comparable and faster than molecular detection methods: preparing for the future. Virol. J., 15(1) (2018) 75. http://doi.org/10.1186/s12985-018-0985-8. M. Euler, Y. Wang, P. Otto, H. Tomaso, R. Escudero, P. Anda, et al. Recombinase polymerase amplification assay for rapid detection of Francisella tularensis. J. Clin. Microbiol., 50(7) (2012) 2234-2238. http://doi.org/10.1128/JCM.06504-11. M. Euler, Y. Wang, D. Heidenreich, P. Patel, O. Strohmeier, S. Hakenberg, et al. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents. J. Clin. Microbiol., 51(4) (2013) 1110-1117. http://doi.org/10.1128/JCM.02704-12.

[22] K. Shahin, J. Gustavo Ramirez-Paredes, G. Harold, B. Lopez-Jimena, A. Adams, M. Weidmann. Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis. PLoS One, 13(2) (2018) e0192979. http://doi.org/10.1371/journal.pone.0192979. [23] P. Craw, W. Balachandran. Isothermal nucleic acid amplification technologies for point-of-care diagnostics: a critical review. Lab Chip, 12(14) (2012) 2469-2486. http://doi.org/10.1039/c2lc40100b. [24] TwistAmp DNA Amplifcation Kits Assay Design Manual. Available online: https://www.twistdx.co.uk/docs/default-source/twistamp-manuals/twistamp-assay-design-manual-v2-5. pdf?sfvrsn=14. [25] C. Hu, S. Kalsi, I. Zeimpekis, K. Sun, P. Ashburn, et al. Ultra-fast electronic detection of antimicrobial resistance genes using isothermal amplification and Thin Film Transistor sensors. Biosens Bioelectron, 96 (2017) 281-287. http://doi.org/10.1016/j.bios.2017.05.016. [26] F.B. Myers, R.H. Henrikson, J.M. Bone, L.P. Lee. A handheld point-of-care genomic diagnostic system. PLoS One, 8(8) (2013) e70266. http://doi.org/10.1371/journal.pone.0070266. [27] H.Y. Lau, J.R. Botella. Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection. Front. Plant Sci., 8 (2017) 2016. http://doi.org/10.3389/fpls.2017.02016. [28] J.F. Loo, P.M. Lau, H.P. Ho, S.K. Kong. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening. Talanta, 115 (2013) 159-165. http://doi.org/10.1016/j.talanta.2013.04.051. [29] S. Kersting, V. Rausch, F.F. Bier, M. von Nickisch-Rosenegk. Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens. Mikrochim. Acta, 181(13-14) (2014) 1715-1723. http://doi.org/10.1007/s00604-014-1198-5. [30] W. Gao, H. Huang, P. Zhu, X. Yan, J. Fan, J. Jiang, et al. Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of Salmonella in shellfish. Bioprocess Biosyst. Eng., 41(5) (2018) 603-611. http://doi.org/10.1007/s00449-018-1895-2. [31] Y. Yang, X. Qin, W. Zhang, Y. Li, Z. Zhang. Rapid and specific detection of porcine parvovirus by isothermal recombinase polymerase amplification assays. Mol. Cell. Probes, 30(5) (2016) 300-305. http://doi.org/10.1016/j.mcp.2016.08.011. [32] Y. Yang , X. Qin , W. Zhang, Z.Y. Li, S.J. Zhang, Y.M. Li, et al. Development of an isothermal recombinase polymerase amplification assay for rapid detection of pseudorabies virus. Mol. Cell. Probes, 33 (2017) 32-35. http://doi.org/10.1016/j.mcp.2017.03.005. [33] B.T. Teoh, S.S. Sam, K.K. Tan, M.B. Danlami, M.H. Shu, J. Johari, et al. Early detection of dengue virus by use of reverse transcription-recombinase polymerase amplification. J. Clin. Microbiol., 53(3) (2015) 830-837. http://doi.org/10.1128/JCM.02648-14.

Real-time RPA assay was developed first time to detect SHIV. The specificity, repeatability, and sensitivity of RPA assay were measured. The RPA assay provides a rapid, accurate, sensitive, affordable, and specific alternative for detection of SHIV.