- Email: [email protected]
Rapid detection of Enterocytozoon hepatopenaei in shrimp through an isothermal recombinase polymerase amplification assay
Journal Pre-proof Rapid detection of Enterocytozoon hepatopenaei in shrimp through an isothermal recombinase polymerase amplification assay
Shuhong Zhou, Mengqiang Wang, Mei Liu, Keyong Jiang, Baojie Wang, Lei Wang PII:
S0044-8486(19)32760-7
DOI:
https://doi.org/10.1016/j.aquaculture.2020.734987
Reference:
AQUA 734987
To appear in:
aquaculture
Received date:
18 October 2019
Revised date:
27 December 2019
Accepted date:
18 January 2020
Please cite this article as: S. Zhou, M. Wang, M. Liu, et al., Rapid detection of Enterocytozoon hepatopenaei in shrimp through an isothermal recombinase polymerase amplification assay, aquaculture (2019), https://doi.org/10.1016/ j.aquaculture.2020.734987
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier.
Journal Pre-proof
Rapid detection of Enterocytozoon hepatopenaei in shrimp through an isothermal recombinase polymerase amplification assay
Shuhong Zhou a, c, Mengqiang Wang a, Mei Liu a, Keyong Jiang a, Baojie Wang a
a*
, Lei Wang
a, b, d *
CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy
b
oo
f
of Sciences, Qingdao 266071, China Laboratory for Marine Biology and Biotechnology, National Laboratory for Marine Science and
pr
Technology, Qingdao 266237, China
University of Chinese Academy of Sciences, Beijing 100049, China
d
CAS Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao 266400, China
al
Pr
e-
c
rn
*Corresponding author:
Jo u
Lei Wang Email: [email protected]. Baojie Wang
Email: wangbaojie@ qdio.ac.cn.
Journal Pre-proof
Abstract
Enterocytozoon hepatopenaei (EHP) has caused mortality in Pacific white shrimp (Penaeus vannamei) and resulted in large economic losses in shrimp farming. The best way to avoid this parasitic disease is to find out about them early. In this study, we describe a novel, sensitive and specific rapid isothermal recombinase polymerase amplification assay (RPA) for detecting EHP. We
oo
f
evaluated the ability, including the specificity and sensitivity, of the EHP-RPA assay to detect EHP. By optimizing the reaction time and temperature, and screening primers based on the conserved
pr
small subunit ribosomal RNA gene, we determined the optimal reaction conditions. The RPA could
e-
be performed at 30°C for 40 min without cross-reactivity with other pathogens. Sensitivity assay
Pr
indicated that the limit of detection for EHP-RPA, PCR and real- time PCR was 8 × 102 , 8 × 102 and
al
8 × 101 copies/μL, respectively. Using 18 samples collected from shrimp farms, we demonstrated
rn
that RPA enables simple, convenient and rapid EHP detection, especially when laboratory equipment is lacking. This new RPA method is easy to implement and has great potential for use in both
Keywords: amplification
Jo u
laboratory and field testing applications. Penaeus
vannamei;
Enterocytozoon
hepatopenaei;
Recombinase
polymerase
Journal Pre-proof
1. Introduction
Enterocytozoon hepatopenaei (EHP) is a microsporidian discovered and named as a new species in 2009, which recognizes host cells on the basis of spore wall proteins (Jaroenlak et al., 2018; Southern et al., 2007; Tourtip et al., 2009). EHP is a serious problem for shrimp (Penaeus vannamei) aquaculture industry, because of the absence of clearly pathognomonic signs except for
oo
f
slow growth rate and wide size variation upon visual inspection, EHP causes economic losses due to decreases in growth rate and productivity. Several experiments have proved that the microsporidians
pr
can be horizontally transmitted among shrimp through water (Karthikeyan and Sudhakaran, 2019;
e-
Salachan et al., 2017), and thus allowing the pathogen to spread. Recently, EHP has been reported in
Pr
Venezuela as well as Thailand, China, India, Vietnam, Indonesia and Malaysia (Tang et al., 2017). In
al
our lab, we have also found a relatively high prevalence of the three pathogens, including infectious
rn
hypodermal and hematopoietic necrosis virus (IHHNV), white spot syndrome virus (WSSV), and acute hepatopancreatic necrosis disease (AHPND). However, there are no specific drugs for the
Jo u
treatment of EHP currently, and the only way to avoid the damage is to detect them early. Thus, effective preventive measures for early and rapid detection of pathogens are urgently needed. Methods used to detect EHP have been widely reported, such as conventional polymerase chain reaction (PCR), real- time PCR, loop- mediated isothermal amplification (LAMP) and in situ hybridization assay with a digoxigenin- labeled DNA probe. However, these approaches rely on accurate temperature control or a variety of experimental procedures or time-consuming. PCR-based detection is a common method in the field of molecular detection, but it requires expensive thermocyclers for accurate temperature control. If the detection equipment is insufficient, methods are greatly limited (Han et al., 2016; Liu et al., 2018b; Tang et al., 2015). Although LAMP reaction
Journal Pre-proof
time is only 45 min, the reaction temperature is still as high as 65°C (Ma et al., 2019; Suebsing et al., 2013). In addition, although in situ hybridization assay using probes for the detection of EHP enable visual detection of spore infected epithelium of hepatopancreas tubules, overnight hybridization of slides is required, and detection remains difficult during the experiment in a few individuals (Han et al., 2016; Karthikeyan et al., 2017).
f
In this work, we introduced a highly sensitive and specific recombinase polymerase
oo
amplification (RPA) method for EHP detection in shrimp. RPA is an isothermal gene amplification
pr
technique first developed in 2006 (Piepenburg et al., 2006). RPA assays can be performed within 20 -
e-
40 min at 20 - 37°C, the amplification products can simultaneously be tested with1% agarose gel
Pr
electrophoresis, gold- labeled immune response, real- time fluorescence and other methods. Compared with other known detection methods, including PCR, real- time PCR and LAMP, RPA has
al
demonstrated higher accuracy and shorter reaction times. Here, a rapid, specific and sensitive RPA
rn
assay for EHP detection was established, and the practical application of the EHP-RPA method was
Jo u
verified through the detection of clinical samples.
2. Materials and Methods
2.1. Shrimp specimens
Samples from shrimp in different growing stages were collected from commercial shrimp ponds in Weifang, Weihai, Dongying, and Qingdao of China from August to November 2018. The samples were stored in 95% ethanol before detection of pathogens in our lab.
Journal Pre-proof
2.2. DNA extraction
Hepatopancreas of shrimp was sampled for DNA extraction using the TIANamp Marine animals DNA kit (Tiangen Biotech, Beijing, China). The concentrations of the DNA samples were measured via UV absorption with a NanoDrop Lite spectrophotometer (Thermo Scientific, Madison, WI, USA). All obtained DNA samples were diluted to 100 ng/µL and stored at –20°C until to use.
oo
f
2.3. Primer design
pr
The primers for the RPA assay were designed according to the instruction manual of the
e-
TwistAmp Basic kit (TwistDx, Cambridge, UK), on based of the SSU rRNA gene (GenBank
Pr
accession no. MF977746.1). Two pairs of primers, as shown in table1, were designed using the Primer Premier 5.0 software, as described in Table 1, and then the optimal primers were identified
al
via testing. The primers for PCR and real- time PCR detection were also designed on the basis of the
rn
SSU rRNA gene. All oligonucleotides were purchased from Qingdao TsingKe Biotechnology Co.
Jo u
Ltd. (Qingdao, China) and are listed in Table 1.
2.4. Preparation of plasmid standard
A microsporidian SSU rRNA gene fragment (510 bp) was amplified by PCR and ligated into the pEASY-T1 vector (TransGen Biotech, Beijing, China). The recombinant plasmids were transferred into Escherichiacoli DH5α cells (TransGen Biotech, Beijing, China), and the positive clones were identified by colony PCR, which was followed by sequencing with using M13 primers (TsingKe Biotech, Qingdao, China). Recombinant plasmids were purified with an EasyPure HiPure Plasmid MiniPrep kit (TransGen Biotech, Beijing, China) and measured with a NanoDrop Lite
Journal Pre-proof
spectrophotometer (Thermo Scientific). The copy number of the recombinant plasmid per microliter was calculated on the basis of the following equation: number of copies (copies/μL) = [M (ng/μL) × 6.02 × 1023 (copies/mol)×10-9 ) ] / [ N (bp) × 660 (g/mol/bp) ], where the M is the concentration of the recombinant plasmid, N is the copy number of the prepared plasmid standard in base pairs, and the average weight of one base pair was assumed to be 660 Da. The prepared plasmid standard was determined with a nucleic acid analyzer to be 383.6 ng/µL, which was equal to 8 × 1010 copies/µL.
oo
f
The recombinant plasmid was serially diluted tenfold from 8.8 × 10 10 to 8.8 × 100 , and aliquots were
pr
stored at –80°C until use.
e-
2.5. Establishment and optimization of the RPA assay
Pr
The RPA reaction was performed in a 50 μL volume including 2.4 μL of each primer (10 μM),
al
2.5 μL magnesium acetate (280 mM), 29.5 μL rehydration buffer, 12.2 μL nuclease- free water and 1
rn
μL of template DNA with a TwistAmp Basic kit (TwistDX, Cambridge, UK). In addition to the
Jo u
template and magnesium acetate, the main mixture has been prepared in freeze-dried reaction tubes in the form of a dried enzyme pellet. When template DNA and magnesium acetate were added to the tubes, they immediately started reacting. To optimize the EHP-RPA reaction conditions, we screened four different reaction time (10, 20, 30 and 40 min) and five different temperature gradients (25, 30, 35, 40and 45°C). The obtained amplicons were purified with a Universal DNA Purification kit (TianGen Biotech, Beijing, China) and subjected to by 1% agarose gel electrophoresis.
2.6. Analytic specificity of EHP-RPA
The specificity of the EHP-RPA assay was confirmed by evaluation of cross-reactivity with
Journal Pre-proof
genomic DNA templates isolated from shrimp tissue infected with different pathogens, including IHHNV, WSSV and AHPND, and with DNA of shrimp infected with EHP as a positive control.
2.7. Comparative diagnostic sensitivity of EHP-RPA with PCR and real-time PCR
The PCR reaction was performed in 25 μL reaction mixtures containing, 1μL of extracted DNA,
oo
f
0.1 mM of each primer and 12.5 μL Premix Taq (TaKaRa, Dalian, China). The cycling conditions for
pr
the amplification were 94°C for 4 min, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s,72°C
e-
for 30 s and a final extension step of 72°C for 5 min. The amplicons were electrophoresed on a 1% agarose gel, and visualized and documented under UV light with a Universal Hood II
Pr
Electrophoresis Imaging Cabinet (Bio-Rad, USA). Real- time PCR was performed on an ABI
al
QuantStudio 6FLex instrument. The reaction mixture (20μL) contained 1μL template DNA, 0.1 mM
rn
of primers F3 and R3 (Table 1), 0.4μL Passive Reference Dye II and 10μL 2 × TransStartTop Green
Jo u
qPCR SuperMix (TransGen Biotech, Beijing, China). The thermal cycling program was as follows: 95°C for 5min, followed by 40 cycles of 95°C for 5s and 60°C for 30 s, and a melting curve at 65°C to 95°C with an increase of 0.5°C per cycle.
2.8. Practical application
Eighteen samples of P. vannamei collected from shrimp farms were detected with RPA, real-time PCR and PCR.
Journal Pre-proof
3. Results
3.1. Primers and reaction conditions
According to the instructions of the commercial kit and results from a previous study (Daher et al., 2016), we designed two pairs of primers for the EHP-RPA assay. The F2/R2 primers showed high specificity and sensitivity, and wereused for further detection of EHP infection (Fig. 1).
oo
f
To optimize the EHP-RPA reaction temperature, we incubated the tubes in a heating block at
pr
different temperature (25, 30, 35, 40 and 45°C) for 40 min. The band specificity in the gel under UV
e-
light was highest when the temperature was 25°C or 30°C, and there was no significant difference
Pr
between the products at the two different reaction temperatures. However, nonspecific amplification was observed when the temperature exceeded 30°C (Fig. 2A). To optimize the EHP-RPA reaction
al
time, we allowed the reaction to continue for 10, 20, 30 and 40 min at 30°C. EHP-RPA amplicons
rn
displayed a ladder- like pattern over time. The intensity of the amplicons was highest when the
reaction conditions.
Jo u
reaction time was 40 min (Fig. 2B). Thus, 40min and 30°C were chosen as the subsequent testing
3.2. Analytic specificity of EHP-RPA
The specificity of EHP-RPA assay was identified by evaluation of cross-reactivity with other pathogens. The genomic DNAs isolated from shrimp infected with other pathogens, including IHHNV, WSSV and AHPND as the template in RPA assay. No amplification was discovered in other pathogens, which suggested that the RPA assay had good specificity (Fig. 3).
Journal Pre-proof
3.3. Comparative diagnostic sensitivity of PCR, real-time PCR and RPA
To confirm the sensitivity of the EHP-RPA assay, we used a 10-fold serial dilution of standard plasmid as templates. The serially 10-fold diluted samples of EHP ranging from 109 to 100 copies/μL were tested with PCR, real- time PCR and EHP-RPA. The PCR products were visualized by electrophoresis on a 1% agarose gel. As shown in Fig. 4A, the PCR detection limit was 8 × 102 .
oo
f
However, after agarose gel electrophoresis, the EHP-RPA detection limit was also 8 × 102 (Fig. 4B). The amplification curve for real-time PCR showed better repeatability and accuracy (Fig. 5A). The
pr
standard curve showed that the real-time PCR had a high correlation coefficient (R2 = 0.9907) within
e-
the range of 8 × 109 – 8 × 100 DNA copies/μL (Fig. 5B). The regression equation was Ct =
Pr
−3.0741·log (EHP DNA copies) + 31.071. The limit of detection of the real-time PCR was 80
Jo u
3.4. Practical application
rn
al
molecules.
Eighteen individuals of P. vannamei were collected in shrimp farms and subjected to detectionwith EHP-RPA, PCR and real- time PCR. Compared with those of PCR (8/18) and real-time PCR (9/18), the diagnostic sensitivity of EHP-RPA was 9/18.
4. Disscusion
Early pathogen detection is an effective measure to control EHP infection in the shrimp aquaculture industry. To rapidly detect EHP, many methods have been developed, such as PCR,
Journal Pre-proof
real-time PCR and LAMP. However, few RPA protocols have been described for the detection of EHP in Pacific white shrimp (P. vannamei). In the present study, we developed a simple, rapid, sensitive and specific diagnostic RPA assay for EHP detection. Over time, the product concentration increased in agradient. The product concentration was highest when the reaction time was 40 min. In previous studies, the reaction condition of time was
f
explored only within the recommended time range of the kit, and temperature has rarely been
oo
explored. Here, we examined the reaction temperature and found that 30°C was the optimal reaction
pr
temperature for EHP-RPA. If the reaction temperature exceeded 30°C, nonspecific amplification
e-
occurred. Therefore, in addition to time, temperature must be validated when using RPA for testing.
Pr
Various methods for detecting EHP have been developed.The highly sensitive methods are primarily PCR-based, including nested PCR and real-time PCR. K. Karthikeyan et al. have compared
al
the detection limit of real-time LAMP with those of other thermal cycling methods including single
rn
step PCR, nested PCR and real-time PCR. Real-time LAMP was found more sensitive than other
Jo u
assays of PCR-based (Karthikeyan et al., 2017). However, Sathish Kumar T et al. haved reported that the detection limit of EHP with LAMP assay is equal to the nested PCR and PCR. LAMP assay results are basically consistent with PCR results (Kumar et al., 2018). YaMei Liu et al. have reported that compared with nested PCR and SYBR Green I qPCR, TaqMan qPCR has a higher sensitivity (Liu et al., 2018b). From previous studies, the sensitivity of different detection methods is various. However, RPA assay can greatly shorten the detection time and decrease the reaction temperature while maintaining a higher detection sensitivity. The sensitivity of EHP-RPA was evaluated in comparison with that of PCR and real-time PCR. The reaction limits of EHP-RPA and PCR were 8 × 102 , whereas the reaction limit of real- time PCR was 8 × 101 , thus indicating that the sensitivity of
Journal Pre-proof
the real-time PCR assay was higher than that of EHP-RPA and PCR. However, the EHP-RPA assay achieved a sensitivity of 8 × 102 copies per reaction under 40 min at 30°C without sophisticated equipment. Hence, in these detection method with the same sensitivity, the simplicity and rapidity of RPA are more prominent. Moreover, in detecting farm samples, the RPA-EHP have the same positive detection rate as real-time PCR, but higher than PCR. In short, compared with other methods of
f
PCR-based, RPA-EHP has particular advantages, such as field adaptability, low operation
oo
temperature, and no requirement for sophisticated equipments. Notably, RPA is being increasingly
pr
used in scientific research and has been applied in samples from many organisms, such as shrimp
e-
(Liu et al., 2017; Xia et al., 2015), dog (Geng et al., 2017), goslings (Liu et al., 2019), human (Daher
Pr
et al., 2014; Frimpong et al., 2019; Koo et al., 2016), ginkgo (Liu et al., 2018a), tomato (Strayer-Scherer et al., 2019) and rose (Babu et al., 2017). Moreover, the EHP-RPA specificity was
al
high, and no cross-reactivity was observed with other pathogens (WSSV, IHHNV and AHPND), as
rn
has been found in other studies using RPA.
Jo u
In addition, we noticed that PCR sensitivity was reduced when the template density was less than 8 × 102 copies, which may be correlated with enzymes and primers. Sathish Kumar et al. have found discordant results between different assays (LAMP and PCR assay) when diagnosis of EHP infection in shrimp (Kumar et al., 2018). Nasarudin et al. have also obtained several false-positive and false-negative results in LAMP assay detection of Enterocytozoon bieneusi in fecal specimens (Nasarudin et al., 2015). Up to now, there have been two primary viewpoints for this phenomenon. One is that some inhibitors of PCR amplification may be present in the sample. (Enosawa et al., 2003), and the other is that some samples with very low bacterial may lead to inconsistent results with different detection methods (Nagdev et al., 2011). In addition to the above factors, we believe
Journal Pre-proof
that the results may be affected by the sensitivity of enzymes and primers. Therefore, when the detection is unstable, we also recommend replacing enzymes and primers and performing repeated verification to ensure the accuracy of the results. In conclusion, we developed a rapid RPA assay for detection of EHP with high sensitivity and specificity. The assay could be completed in 40 min at 30°C. More importantly, the RPA assay , minimal
f
compared with other methods, provides the advantages of field adaptability,
oo
sample-preparation requirements, low operation temperature and no requirement for sophisticated
pr
equipment. Therefore, the effective RPA assay developed in this study should be highly useful in the
e-
control of EHP, especially in resource-limited settings.
Pr
Acknowledgments
This research was supported by the National Key R&D Program of China (2019YFD0900401),
al
and the National Natural Science Foundation of China-Joint Fund of Shandong People's Government
Jo u
suggestions.
rn
(2017T3011). We are grateful to all the laboratory members for their technical advice and helpful
The authors declared no conflict of interest for this study.
References
Babu, B., Washburn, B.K., Ertek, T.S., Miller, S.H., Riddle, C.B., Knox, G.W., Ochoa-Corona, F.M., Olson, J., Katırcıoğlu, Y.Z., Paret, M.L., 2017. A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay. Journal of virological methods.247, 81–90. Daher, R.K., Stewart, G., Boissinot, M., Bergeron, M.G., 2014. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples.
Journal Pre-proof Clinical chemistry.60, 660–666. Daher, R.K., Stewart, G., Boissinot, M., Bergeron, M.G., 2016. Recombinase Polymerase Amplification for Diagnostic Applications. Clinical chemistry.62, 947–958. Enosawa, M., Kageyama, S., Sawai, K., Watanabe, K., Notomi, T., Onoe, S., Mori, Y., Yokomizo, Y., 2003. Use of loop- mediated isothermal amplification of the IS900 sequence for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. Journal of clinical microbiology.41, 4359–4365. Frimpong, M., Ahor, H.S., Wahed, A.A.E., Agbavor, B., Sarpong, F.N., Laing, K., Wansbrough-Jones,
oo
f
M., Phillips, R.O., 2019. Rapid detection of Mycobacterium ulcerans with isothermal recombinase polymerase amplification assay. PLoS neglected tropical diseases.13, e0007155.
pr
Geng, Y., Wang, J., Liu, L., Lu, Y., Tan, K., Chang, Y.-Z., 2017. Development of real-time
e-
recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2. BMC veterinary research.13, 311.
Pr
Han, J.E., Tang, K.F.J., Pantoja, C.R., Lightner, D.V., Redman, R.M., Le Groumellec, M., 2016. Detection of a new microsporidium Perezia sp. in shrimps Penaeus monodon and P. indicus by
al
histopathology, in situ hybridization and PCR. Diseases of aquatic organisms.120, 165–171.
rn
Jaroenlak, P., Boakye, D.W., Vanichviriyakit, R., Williams, B.A.P., Sritunyalucksana, K., Itsathitphaisarn, O., 2018. Identification, characterization and heparin binding capacity of a
Jo u
spore-wall, virulence protein from the shrimp microsporidian, Enterocytozoon hepatopenaei (EHP). Parasites & vectors.11, 177. Karthikeyan, K., Sharma, A., Mekata, T., Itami, T., Sudhakaran, R., 2017. Rapid and sens itive real-time loop meditated isothermal amplification for the detection of Enterocytozoon hepatopenaei of shrimp. Aquaculture.481, 119–123. Karthikeyan, K., Sudhakaran, R., 2019. Experimental horizontal transmission of Enterocytozoon hepatopenaei in post- larvae of whiteleg shrimp, Litopenaeus vannamei. Journal of fish diseases.42, 397–404. Koo, K.M., Wee, E.J.H., Trau, M., 2016. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification. Theranostics.6, 1415–1424. Kumar, T.S., A, Krishnan, A.N., Rajan, J.J.S., Makesh, M., Jithendran, K.P., Alavandi, S.V., Vijayan,
Journal Pre-proof K.K., 2018. Visual loop-mediated isothermal amplification (LAMP) for the rapid diagnosis of Enterocytozoon hepatopenaei (EHP) infection. Parasitology research.117, 1485–1493. Liu, L., Jiang, L., Yu, Y., Xia, X., Pan, Y., Yan, S., Wang, Y., 2017. Rapid diagnosis of Vibrio owensii responsible for shrimp acute hepatopancreatic necrosis disease with isothermal recombinase polymerase amplification assay. Molecular and cellular probes.33, 4–7. Liu, W.J., Yang, Y.T., Du, S.M., Yi, H.D., Xu, D.N., Cao, N., Jiang, D.L., Huang, Y.M., Tian, Y.B., 2019. Rapid and sensitive detection of goose parvovirus and duck-origin novel goose parvovirus by recombinase polymerase amplification combined with a vertical flow visualization strip.
oo
f
Journal of virological methods.266, 34–40.
Liu, Y., Wang, X.y., Wei, X.m., Gao, Z.t., Han, J.-p., 2018a. Rapid Authentication of Ginkgo biloba
pr
Herbal Products Using the Recombinase Polymerase Amplification Assay. Scientific Reports.8,
e-
1–8.
Liu, Y.M., Qiu, L., Sheng, A.Z., Wan, X.Y., Cheng, D.Y., Huang, J., 2018b. Quantitative detection
invertebrate pathology.151, 191–196.
Pr
method of Enterocytozoon hepatopenaei using TaqMan probe real- time PCR. Journal of
al
Ma, B., Yu, H., Fang, J., Sun, C., Zhang, M., 2019. Employing DNA binding dye to improve
rn
detection of Enterocytozoon hepatopenaei in real-time LAMP. Scientific Reports.9, 15860. Nagdev, K.J., Kashyap, R.S., Parida, M.M., Kapgate, R.C., Purohit, H.J., Taori, G.M., Daginawala,
Jo u
H.F., 2011. Loop- mediated isothermal amplification for rapid and reliable diagnosis of tuberculous meningitis. Journal of clinical microbiology.49, 1861–1865. Nasarudin, S.N.S.'a., Zainudin, N.S., Bernadus, M., Nawi, A.M., Hanafiah, A., Osman, E., 2015. Loop- mediated isothermal amplification for rapid molecular detection of Enterocytozoon bieneusi in faecal specimens. Journal of medical microbiology.64, 1329–1334. Piepenburg, O., Williams, C.H., Stemple, D.L., Armes, N.A., 2006. DNA detection using recombination proteins. PLoS biology.4, e204. Salachan, P.V., Jaroenlak, P., Thitamadee, S., Itsathitphaisarn, O., Sritunyalucksana, K., 2017. Laboratory cohabitation challenge model for shrimp hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP). BMC veterinary research.13, 9. Southern, T.R., Jolly, C.E., Lester, M.E., Hayman, J.R., 2007. EnP1, a microsporidian spore wall protein that enables spores to adhere to and infect host cells in vitro. Eukaryotic cell.6,
Journal Pre-proof 1354–1362. Strayer-Scherer, A., Jones, J.B., Paret, M.L., 2019. Recombinase Polymerase Amplification Assay for Field Detection of Tomato Bacterial Spot Pathogens. Phytopathology.109, 690–700. Suebsing, R., Prombun, P., Srisala, J., Kiatpathomchai, W., 2013. Loop-mediated isothermal amplification combined with colorimetric nanogold for detection of the microsporidian Enterocytozoon hepatopenaei in penaeid shrimp. Journal of applied microbiology.114, 1254–1263. Tang, K.F.J., Aranguren, L.F., Piamsomboon, P., Han, J.E., Maskaykina, I.Y., Schmidt, M.M., 2017.
oo
f
Detection of the microsporidian Enterocytozoon hepatopenaei (EHP) and Taura syndrome virus in Penaeus vannamei cultured in Venezuela. Aquaculture.480, 17–21.
pr
Tang, K.F.J., Pantoja, C.R., Redman, R.M., Han, J.E., Tran, L.H., Lightner, D.V., 2015. Development
e-
of in situ hybridization and PCR assays for the detection of Enterocytozoon hepatopenaei (EHP), a microsporidian parasite infecting penaeid shrimp. Journal of invertebrate pathology.130, 37–41.
Pr
Tourtip, S., Wongtripop, S., Stentiford, G.D., Bateman, K.S., Sriurairatana, S., Chavadej, J., Sritunyalucksana, K., Withyachumnarnkul, B., 2009. Enterocytozoon hepatopenaei sp. nov.
al
(Microsporida: Enterocytozoonidae), a parasite of the black tiger shrimp Penaeus monodon
pathology.102, 21–29.
rn
(Decapoda: Penaeidae): Fine structure and phylogenetic relationships. Journal of invertebrate
Jo u
Xia, X., Yu, Y., Hu, L., Weidmann, M., Pan, Y., Yan, S., Wang, Y., 2015. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real- time, isothermal recombinase polymerase amplification assay. Archives of virology.160, 987–994. Table 1 Primers for RPA, PCR and real-time PCR assays. Product size Assay
Primers
Sequence (5'-3')
References (bp)
F1
TTAAAAGCCATTGAGTTTGTTGAGAGTAGCG
R1
GTAAGAGCATCGCTTTCGCCTCCGTTGGTCC
F2
CATTGAGTTTGTTGAGAGTAGCGGAACGGAT
R2
CTAAGAGCATCGCTTTCGCCTCCGTTGGTC
F3
GCGGAACGGATAGGG
RPA
Real-time
118
This study
111
This study
185
This study
Journal Pre-proof PCR
R3
GCATTGTCGGCATAG
F4
TGAGAGATGGCTCCCACGT
R4
TACTATCCCCAGAGCCCGA
510
Tang et al.
pr
oo
f
PCR
Fig. 1 Two primers (F1/R1 and F2/R2) for the detection of EHP. Lane 1, Trans2K DNA marker;
Jo u
rn
al
Pr
e-
lanes 2 and 3, DNA products amplified with primers F1/R1 and F2/R2.
Fig. 2 (A) Optimization of EHP-RPA reaction temperature. Lane 1, Trans2K DNA marker; lanes 2–5, DNA products amplified through 25, 30, 35, 40 or 45°C RPA reaction. (B) Optimization of EHP-RPA reaction time. Lane 1, Trans2K DNA marker; lanes 2–5, DNA products amplified through 10, 20, 30 or 40 min RPA reactions.
Journal Pre-proof
Fig. 3 Specificity of the RPA assay in EHP detection. Three different pathogen templates were
f
used along with EHP. Lane 1, Trans2K DNA Marker; lane 2, Enterocytozoon hepatopenaei (EHP);
oo
lane 3, infectious hypodermal and hematopoietic necrosis virus (IHHNV); lane 4, white spot
Jo u
rn
al
Pr
e-
pr
syndrome virus (WSSV); lane 5, acute hepatopancreatic necrosis disease (AHPND).
Fig. 4 (A) Sensitivity of PCR in EHP detection. Lane1, Trans2K DNA marker; lanes 2 – 11, PCR using 10- fold diluted standard plasmid (8 × 109 – 8 × 100 ). (B) Sensitivity of EHP-RPA in EHP detection. Lane1, Trans2K DNA marker; lanes 2 – 11, PCR products using 10- fold diluted standard plasmid (8 × 109 – 8 × 100 ) as template.
Pr
e-
pr
oo
f
Journal Pre-proof
al
Fig. 5 (A) Amplification curve of real-time PCR for EHP with plasmid standard templates. (B)
Jo u
rn
Standard curve of real-time PCR for EHP.
Journal Pre-proof Highlights RPA has the lowest reaction temperature among all the PCR-based methods for the detection of EHP. EHP-RPA detection method have no cross-reactivity with other pathogens.
The sensitivity of EHP-RPA was higher than PCR but lower than real-time PCR.
Jo u
rn
al
Pr
e-
pr
oo
f
Shuhong Zhou, Mengqiang Wang, Mei Liu, Keyong Jiang, Baojie Wang, Lei Wang PII:
S0044-8486(19)32760-7
DOI:
https://doi.org/10.1016/j.aquaculture.2020.734987
Reference:
AQUA 734987
To appear in:
aquaculture
Received date:
18 October 2019
Revised date:
27 December 2019
Accepted date:
18 January 2020
Please cite this article as: S. Zhou, M. Wang, M. Liu, et al., Rapid detection of Enterocytozoon hepatopenaei in shrimp through an isothermal recombinase polymerase amplification assay, aquaculture (2019), https://doi.org/10.1016/ j.aquaculture.2020.734987
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier.
Journal Pre-proof
Rapid detection of Enterocytozoon hepatopenaei in shrimp through an isothermal recombinase polymerase amplification assay
Shuhong Zhou a, c, Mengqiang Wang a, Mei Liu a, Keyong Jiang a, Baojie Wang a
a*
, Lei Wang
a, b, d *
CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy
b
oo
f
of Sciences, Qingdao 266071, China Laboratory for Marine Biology and Biotechnology, National Laboratory for Marine Science and
pr
Technology, Qingdao 266237, China
University of Chinese Academy of Sciences, Beijing 100049, China
d
CAS Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao 266400, China
al
Pr
e-
c
rn
*Corresponding author:
Jo u
Lei Wang Email: [email protected]. Baojie Wang
Email: wangbaojie@ qdio.ac.cn.
Journal Pre-proof
Abstract
Enterocytozoon hepatopenaei (EHP) has caused mortality in Pacific white shrimp (Penaeus vannamei) and resulted in large economic losses in shrimp farming. The best way to avoid this parasitic disease is to find out about them early. In this study, we describe a novel, sensitive and specific rapid isothermal recombinase polymerase amplification assay (RPA) for detecting EHP. We
oo
f
evaluated the ability, including the specificity and sensitivity, of the EHP-RPA assay to detect EHP. By optimizing the reaction time and temperature, and screening primers based on the conserved
pr
small subunit ribosomal RNA gene, we determined the optimal reaction conditions. The RPA could
e-
be performed at 30°C for 40 min without cross-reactivity with other pathogens. Sensitivity assay
Pr
indicated that the limit of detection for EHP-RPA, PCR and real- time PCR was 8 × 102 , 8 × 102 and
al
8 × 101 copies/μL, respectively. Using 18 samples collected from shrimp farms, we demonstrated
rn
that RPA enables simple, convenient and rapid EHP detection, especially when laboratory equipment is lacking. This new RPA method is easy to implement and has great potential for use in both
Keywords: amplification
Jo u
laboratory and field testing applications. Penaeus
vannamei;
Enterocytozoon
hepatopenaei;
Recombinase
polymerase
Journal Pre-proof
1. Introduction
Enterocytozoon hepatopenaei (EHP) is a microsporidian discovered and named as a new species in 2009, which recognizes host cells on the basis of spore wall proteins (Jaroenlak et al., 2018; Southern et al., 2007; Tourtip et al., 2009). EHP is a serious problem for shrimp (Penaeus vannamei) aquaculture industry, because of the absence of clearly pathognomonic signs except for
oo
f
slow growth rate and wide size variation upon visual inspection, EHP causes economic losses due to decreases in growth rate and productivity. Several experiments have proved that the microsporidians
pr
can be horizontally transmitted among shrimp through water (Karthikeyan and Sudhakaran, 2019;
e-
Salachan et al., 2017), and thus allowing the pathogen to spread. Recently, EHP has been reported in
Pr
Venezuela as well as Thailand, China, India, Vietnam, Indonesia and Malaysia (Tang et al., 2017). In
al
our lab, we have also found a relatively high prevalence of the three pathogens, including infectious
rn
hypodermal and hematopoietic necrosis virus (IHHNV), white spot syndrome virus (WSSV), and acute hepatopancreatic necrosis disease (AHPND). However, there are no specific drugs for the
Jo u
treatment of EHP currently, and the only way to avoid the damage is to detect them early. Thus, effective preventive measures for early and rapid detection of pathogens are urgently needed. Methods used to detect EHP have been widely reported, such as conventional polymerase chain reaction (PCR), real- time PCR, loop- mediated isothermal amplification (LAMP) and in situ hybridization assay with a digoxigenin- labeled DNA probe. However, these approaches rely on accurate temperature control or a variety of experimental procedures or time-consuming. PCR-based detection is a common method in the field of molecular detection, but it requires expensive thermocyclers for accurate temperature control. If the detection equipment is insufficient, methods are greatly limited (Han et al., 2016; Liu et al., 2018b; Tang et al., 2015). Although LAMP reaction
Journal Pre-proof
time is only 45 min, the reaction temperature is still as high as 65°C (Ma et al., 2019; Suebsing et al., 2013). In addition, although in situ hybridization assay using probes for the detection of EHP enable visual detection of spore infected epithelium of hepatopancreas tubules, overnight hybridization of slides is required, and detection remains difficult during the experiment in a few individuals (Han et al., 2016; Karthikeyan et al., 2017).
f
In this work, we introduced a highly sensitive and specific recombinase polymerase
oo
amplification (RPA) method for EHP detection in shrimp. RPA is an isothermal gene amplification
pr
technique first developed in 2006 (Piepenburg et al., 2006). RPA assays can be performed within 20 -
e-
40 min at 20 - 37°C, the amplification products can simultaneously be tested with1% agarose gel
Pr
electrophoresis, gold- labeled immune response, real- time fluorescence and other methods. Compared with other known detection methods, including PCR, real- time PCR and LAMP, RPA has
al
demonstrated higher accuracy and shorter reaction times. Here, a rapid, specific and sensitive RPA
rn
assay for EHP detection was established, and the practical application of the EHP-RPA method was
Jo u
verified through the detection of clinical samples.
2. Materials and Methods
2.1. Shrimp specimens
Samples from shrimp in different growing stages were collected from commercial shrimp ponds in Weifang, Weihai, Dongying, and Qingdao of China from August to November 2018. The samples were stored in 95% ethanol before detection of pathogens in our lab.
Journal Pre-proof
2.2. DNA extraction
Hepatopancreas of shrimp was sampled for DNA extraction using the TIANamp Marine animals DNA kit (Tiangen Biotech, Beijing, China). The concentrations of the DNA samples were measured via UV absorption with a NanoDrop Lite spectrophotometer (Thermo Scientific, Madison, WI, USA). All obtained DNA samples were diluted to 100 ng/µL and stored at –20°C until to use.
oo
f
2.3. Primer design
pr
The primers for the RPA assay were designed according to the instruction manual of the
e-
TwistAmp Basic kit (TwistDx, Cambridge, UK), on based of the SSU rRNA gene (GenBank
Pr
accession no. MF977746.1). Two pairs of primers, as shown in table1, were designed using the Primer Premier 5.0 software, as described in Table 1, and then the optimal primers were identified
al
via testing. The primers for PCR and real- time PCR detection were also designed on the basis of the
rn
SSU rRNA gene. All oligonucleotides were purchased from Qingdao TsingKe Biotechnology Co.
Jo u
Ltd. (Qingdao, China) and are listed in Table 1.
2.4. Preparation of plasmid standard
A microsporidian SSU rRNA gene fragment (510 bp) was amplified by PCR and ligated into the pEASY-T1 vector (TransGen Biotech, Beijing, China). The recombinant plasmids were transferred into Escherichiacoli DH5α cells (TransGen Biotech, Beijing, China), and the positive clones were identified by colony PCR, which was followed by sequencing with using M13 primers (TsingKe Biotech, Qingdao, China). Recombinant plasmids were purified with an EasyPure HiPure Plasmid MiniPrep kit (TransGen Biotech, Beijing, China) and measured with a NanoDrop Lite
Journal Pre-proof
spectrophotometer (Thermo Scientific). The copy number of the recombinant plasmid per microliter was calculated on the basis of the following equation: number of copies (copies/μL) = [M (ng/μL) × 6.02 × 1023 (copies/mol)×10-9 ) ] / [ N (bp) × 660 (g/mol/bp) ], where the M is the concentration of the recombinant plasmid, N is the copy number of the prepared plasmid standard in base pairs, and the average weight of one base pair was assumed to be 660 Da. The prepared plasmid standard was determined with a nucleic acid analyzer to be 383.6 ng/µL, which was equal to 8 × 1010 copies/µL.
oo
f
The recombinant plasmid was serially diluted tenfold from 8.8 × 10 10 to 8.8 × 100 , and aliquots were
pr
stored at –80°C until use.
e-
2.5. Establishment and optimization of the RPA assay
Pr
The RPA reaction was performed in a 50 μL volume including 2.4 μL of each primer (10 μM),
al
2.5 μL magnesium acetate (280 mM), 29.5 μL rehydration buffer, 12.2 μL nuclease- free water and 1
rn
μL of template DNA with a TwistAmp Basic kit (TwistDX, Cambridge, UK). In addition to the
Jo u
template and magnesium acetate, the main mixture has been prepared in freeze-dried reaction tubes in the form of a dried enzyme pellet. When template DNA and magnesium acetate were added to the tubes, they immediately started reacting. To optimize the EHP-RPA reaction conditions, we screened four different reaction time (10, 20, 30 and 40 min) and five different temperature gradients (25, 30, 35, 40and 45°C). The obtained amplicons were purified with a Universal DNA Purification kit (TianGen Biotech, Beijing, China) and subjected to by 1% agarose gel electrophoresis.
2.6. Analytic specificity of EHP-RPA
The specificity of the EHP-RPA assay was confirmed by evaluation of cross-reactivity with
Journal Pre-proof
genomic DNA templates isolated from shrimp tissue infected with different pathogens, including IHHNV, WSSV and AHPND, and with DNA of shrimp infected with EHP as a positive control.
2.7. Comparative diagnostic sensitivity of EHP-RPA with PCR and real-time PCR
The PCR reaction was performed in 25 μL reaction mixtures containing, 1μL of extracted DNA,
oo
f
0.1 mM of each primer and 12.5 μL Premix Taq (TaKaRa, Dalian, China). The cycling conditions for
pr
the amplification were 94°C for 4 min, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s,72°C
e-
for 30 s and a final extension step of 72°C for 5 min. The amplicons were electrophoresed on a 1% agarose gel, and visualized and documented under UV light with a Universal Hood II
Pr
Electrophoresis Imaging Cabinet (Bio-Rad, USA). Real- time PCR was performed on an ABI
al
QuantStudio 6FLex instrument. The reaction mixture (20μL) contained 1μL template DNA, 0.1 mM
rn
of primers F3 and R3 (Table 1), 0.4μL Passive Reference Dye II and 10μL 2 × TransStartTop Green
Jo u
qPCR SuperMix (TransGen Biotech, Beijing, China). The thermal cycling program was as follows: 95°C for 5min, followed by 40 cycles of 95°C for 5s and 60°C for 30 s, and a melting curve at 65°C to 95°C with an increase of 0.5°C per cycle.
2.8. Practical application
Eighteen samples of P. vannamei collected from shrimp farms were detected with RPA, real-time PCR and PCR.
Journal Pre-proof
3. Results
3.1. Primers and reaction conditions
According to the instructions of the commercial kit and results from a previous study (Daher et al., 2016), we designed two pairs of primers for the EHP-RPA assay. The F2/R2 primers showed high specificity and sensitivity, and wereused for further detection of EHP infection (Fig. 1).
oo
f
To optimize the EHP-RPA reaction temperature, we incubated the tubes in a heating block at
pr
different temperature (25, 30, 35, 40 and 45°C) for 40 min. The band specificity in the gel under UV
e-
light was highest when the temperature was 25°C or 30°C, and there was no significant difference
Pr
between the products at the two different reaction temperatures. However, nonspecific amplification was observed when the temperature exceeded 30°C (Fig. 2A). To optimize the EHP-RPA reaction
al
time, we allowed the reaction to continue for 10, 20, 30 and 40 min at 30°C. EHP-RPA amplicons
rn
displayed a ladder- like pattern over time. The intensity of the amplicons was highest when the
reaction conditions.
Jo u
reaction time was 40 min (Fig. 2B). Thus, 40min and 30°C were chosen as the subsequent testing
3.2. Analytic specificity of EHP-RPA
The specificity of EHP-RPA assay was identified by evaluation of cross-reactivity with other pathogens. The genomic DNAs isolated from shrimp infected with other pathogens, including IHHNV, WSSV and AHPND as the template in RPA assay. No amplification was discovered in other pathogens, which suggested that the RPA assay had good specificity (Fig. 3).
Journal Pre-proof
3.3. Comparative diagnostic sensitivity of PCR, real-time PCR and RPA
To confirm the sensitivity of the EHP-RPA assay, we used a 10-fold serial dilution of standard plasmid as templates. The serially 10-fold diluted samples of EHP ranging from 109 to 100 copies/μL were tested with PCR, real- time PCR and EHP-RPA. The PCR products were visualized by electrophoresis on a 1% agarose gel. As shown in Fig. 4A, the PCR detection limit was 8 × 102 .
oo
f
However, after agarose gel electrophoresis, the EHP-RPA detection limit was also 8 × 102 (Fig. 4B). The amplification curve for real-time PCR showed better repeatability and accuracy (Fig. 5A). The
pr
standard curve showed that the real-time PCR had a high correlation coefficient (R2 = 0.9907) within
e-
the range of 8 × 109 – 8 × 100 DNA copies/μL (Fig. 5B). The regression equation was Ct =
Pr
−3.0741·log (EHP DNA copies) + 31.071. The limit of detection of the real-time PCR was 80
Jo u
3.4. Practical application
rn
al
molecules.
Eighteen individuals of P. vannamei were collected in shrimp farms and subjected to detectionwith EHP-RPA, PCR and real- time PCR. Compared with those of PCR (8/18) and real-time PCR (9/18), the diagnostic sensitivity of EHP-RPA was 9/18.
4. Disscusion
Early pathogen detection is an effective measure to control EHP infection in the shrimp aquaculture industry. To rapidly detect EHP, many methods have been developed, such as PCR,
Journal Pre-proof
real-time PCR and LAMP. However, few RPA protocols have been described for the detection of EHP in Pacific white shrimp (P. vannamei). In the present study, we developed a simple, rapid, sensitive and specific diagnostic RPA assay for EHP detection. Over time, the product concentration increased in agradient. The product concentration was highest when the reaction time was 40 min. In previous studies, the reaction condition of time was
f
explored only within the recommended time range of the kit, and temperature has rarely been
oo
explored. Here, we examined the reaction temperature and found that 30°C was the optimal reaction
pr
temperature for EHP-RPA. If the reaction temperature exceeded 30°C, nonspecific amplification
e-
occurred. Therefore, in addition to time, temperature must be validated when using RPA for testing.
Pr
Various methods for detecting EHP have been developed.The highly sensitive methods are primarily PCR-based, including nested PCR and real-time PCR. K. Karthikeyan et al. have compared
al
the detection limit of real-time LAMP with those of other thermal cycling methods including single
rn
step PCR, nested PCR and real-time PCR. Real-time LAMP was found more sensitive than other
Jo u
assays of PCR-based (Karthikeyan et al., 2017). However, Sathish Kumar T et al. haved reported that the detection limit of EHP with LAMP assay is equal to the nested PCR and PCR. LAMP assay results are basically consistent with PCR results (Kumar et al., 2018). YaMei Liu et al. have reported that compared with nested PCR and SYBR Green I qPCR, TaqMan qPCR has a higher sensitivity (Liu et al., 2018b). From previous studies, the sensitivity of different detection methods is various. However, RPA assay can greatly shorten the detection time and decrease the reaction temperature while maintaining a higher detection sensitivity. The sensitivity of EHP-RPA was evaluated in comparison with that of PCR and real-time PCR. The reaction limits of EHP-RPA and PCR were 8 × 102 , whereas the reaction limit of real- time PCR was 8 × 101 , thus indicating that the sensitivity of
Journal Pre-proof
the real-time PCR assay was higher than that of EHP-RPA and PCR. However, the EHP-RPA assay achieved a sensitivity of 8 × 102 copies per reaction under 40 min at 30°C without sophisticated equipment. Hence, in these detection method with the same sensitivity, the simplicity and rapidity of RPA are more prominent. Moreover, in detecting farm samples, the RPA-EHP have the same positive detection rate as real-time PCR, but higher than PCR. In short, compared with other methods of
f
PCR-based, RPA-EHP has particular advantages, such as field adaptability, low operation
oo
temperature, and no requirement for sophisticated equipments. Notably, RPA is being increasingly
pr
used in scientific research and has been applied in samples from many organisms, such as shrimp
e-
(Liu et al., 2017; Xia et al., 2015), dog (Geng et al., 2017), goslings (Liu et al., 2019), human (Daher
Pr
et al., 2014; Frimpong et al., 2019; Koo et al., 2016), ginkgo (Liu et al., 2018a), tomato (Strayer-Scherer et al., 2019) and rose (Babu et al., 2017). Moreover, the EHP-RPA specificity was
al
high, and no cross-reactivity was observed with other pathogens (WSSV, IHHNV and AHPND), as
rn
has been found in other studies using RPA.
Jo u
In addition, we noticed that PCR sensitivity was reduced when the template density was less than 8 × 102 copies, which may be correlated with enzymes and primers. Sathish Kumar et al. have found discordant results between different assays (LAMP and PCR assay) when diagnosis of EHP infection in shrimp (Kumar et al., 2018). Nasarudin et al. have also obtained several false-positive and false-negative results in LAMP assay detection of Enterocytozoon bieneusi in fecal specimens (Nasarudin et al., 2015). Up to now, there have been two primary viewpoints for this phenomenon. One is that some inhibitors of PCR amplification may be present in the sample. (Enosawa et al., 2003), and the other is that some samples with very low bacterial may lead to inconsistent results with different detection methods (Nagdev et al., 2011). In addition to the above factors, we believe
Journal Pre-proof
that the results may be affected by the sensitivity of enzymes and primers. Therefore, when the detection is unstable, we also recommend replacing enzymes and primers and performing repeated verification to ensure the accuracy of the results. In conclusion, we developed a rapid RPA assay for detection of EHP with high sensitivity and specificity. The assay could be completed in 40 min at 30°C. More importantly, the RPA assay , minimal
f
compared with other methods, provides the advantages of field adaptability,
oo
sample-preparation requirements, low operation temperature and no requirement for sophisticated
pr
equipment. Therefore, the effective RPA assay developed in this study should be highly useful in the
e-
control of EHP, especially in resource-limited settings.
Pr
Acknowledgments
This research was supported by the National Key R&D Program of China (2019YFD0900401),
al
and the National Natural Science Foundation of China-Joint Fund of Shandong People's Government
Jo u
suggestions.
rn
(2017T3011). We are grateful to all the laboratory members for their technical advice and helpful
The authors declared no conflict of interest for this study.
References
Babu, B., Washburn, B.K., Ertek, T.S., Miller, S.H., Riddle, C.B., Knox, G.W., Ochoa-Corona, F.M., Olson, J., Katırcıoğlu, Y.Z., Paret, M.L., 2017. A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay. Journal of virological methods.247, 81–90. Daher, R.K., Stewart, G., Boissinot, M., Bergeron, M.G., 2014. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples.
Journal Pre-proof Clinical chemistry.60, 660–666. Daher, R.K., Stewart, G., Boissinot, M., Bergeron, M.G., 2016. Recombinase Polymerase Amplification for Diagnostic Applications. Clinical chemistry.62, 947–958. Enosawa, M., Kageyama, S., Sawai, K., Watanabe, K., Notomi, T., Onoe, S., Mori, Y., Yokomizo, Y., 2003. Use of loop- mediated isothermal amplification of the IS900 sequence for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. Journal of clinical microbiology.41, 4359–4365. Frimpong, M., Ahor, H.S., Wahed, A.A.E., Agbavor, B., Sarpong, F.N., Laing, K., Wansbrough-Jones,
oo
f
M., Phillips, R.O., 2019. Rapid detection of Mycobacterium ulcerans with isothermal recombinase polymerase amplification assay. PLoS neglected tropical diseases.13, e0007155.
pr
Geng, Y., Wang, J., Liu, L., Lu, Y., Tan, K., Chang, Y.-Z., 2017. Development of real-time
e-
recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2. BMC veterinary research.13, 311.
Pr
Han, J.E., Tang, K.F.J., Pantoja, C.R., Lightner, D.V., Redman, R.M., Le Groumellec, M., 2016. Detection of a new microsporidium Perezia sp. in shrimps Penaeus monodon and P. indicus by
al
histopathology, in situ hybridization and PCR. Diseases of aquatic organisms.120, 165–171.
rn
Jaroenlak, P., Boakye, D.W., Vanichviriyakit, R., Williams, B.A.P., Sritunyalucksana, K., Itsathitphaisarn, O., 2018. Identification, characterization and heparin binding capacity of a
Jo u
spore-wall, virulence protein from the shrimp microsporidian, Enterocytozoon hepatopenaei (EHP). Parasites & vectors.11, 177. Karthikeyan, K., Sharma, A., Mekata, T., Itami, T., Sudhakaran, R., 2017. Rapid and sens itive real-time loop meditated isothermal amplification for the detection of Enterocytozoon hepatopenaei of shrimp. Aquaculture.481, 119–123. Karthikeyan, K., Sudhakaran, R., 2019. Experimental horizontal transmission of Enterocytozoon hepatopenaei in post- larvae of whiteleg shrimp, Litopenaeus vannamei. Journal of fish diseases.42, 397–404. Koo, K.M., Wee, E.J.H., Trau, M., 2016. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification. Theranostics.6, 1415–1424. Kumar, T.S., A, Krishnan, A.N., Rajan, J.J.S., Makesh, M., Jithendran, K.P., Alavandi, S.V., Vijayan,
Journal Pre-proof K.K., 2018. Visual loop-mediated isothermal amplification (LAMP) for the rapid diagnosis of Enterocytozoon hepatopenaei (EHP) infection. Parasitology research.117, 1485–1493. Liu, L., Jiang, L., Yu, Y., Xia, X., Pan, Y., Yan, S., Wang, Y., 2017. Rapid diagnosis of Vibrio owensii responsible for shrimp acute hepatopancreatic necrosis disease with isothermal recombinase polymerase amplification assay. Molecular and cellular probes.33, 4–7. Liu, W.J., Yang, Y.T., Du, S.M., Yi, H.D., Xu, D.N., Cao, N., Jiang, D.L., Huang, Y.M., Tian, Y.B., 2019. Rapid and sensitive detection of goose parvovirus and duck-origin novel goose parvovirus by recombinase polymerase amplification combined with a vertical flow visualization strip.
oo
f
Journal of virological methods.266, 34–40.
Liu, Y., Wang, X.y., Wei, X.m., Gao, Z.t., Han, J.-p., 2018a. Rapid Authentication of Ginkgo biloba
pr
Herbal Products Using the Recombinase Polymerase Amplification Assay. Scientific Reports.8,
e-
1–8.
Liu, Y.M., Qiu, L., Sheng, A.Z., Wan, X.Y., Cheng, D.Y., Huang, J., 2018b. Quantitative detection
invertebrate pathology.151, 191–196.
Pr
method of Enterocytozoon hepatopenaei using TaqMan probe real- time PCR. Journal of
al
Ma, B., Yu, H., Fang, J., Sun, C., Zhang, M., 2019. Employing DNA binding dye to improve
rn
detection of Enterocytozoon hepatopenaei in real-time LAMP. Scientific Reports.9, 15860. Nagdev, K.J., Kashyap, R.S., Parida, M.M., Kapgate, R.C., Purohit, H.J., Taori, G.M., Daginawala,
Jo u
H.F., 2011. Loop- mediated isothermal amplification for rapid and reliable diagnosis of tuberculous meningitis. Journal of clinical microbiology.49, 1861–1865. Nasarudin, S.N.S.'a., Zainudin, N.S., Bernadus, M., Nawi, A.M., Hanafiah, A., Osman, E., 2015. Loop- mediated isothermal amplification for rapid molecular detection of Enterocytozoon bieneusi in faecal specimens. Journal of medical microbiology.64, 1329–1334. Piepenburg, O., Williams, C.H., Stemple, D.L., Armes, N.A., 2006. DNA detection using recombination proteins. PLoS biology.4, e204. Salachan, P.V., Jaroenlak, P., Thitamadee, S., Itsathitphaisarn, O., Sritunyalucksana, K., 2017. Laboratory cohabitation challenge model for shrimp hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP). BMC veterinary research.13, 9. Southern, T.R., Jolly, C.E., Lester, M.E., Hayman, J.R., 2007. EnP1, a microsporidian spore wall protein that enables spores to adhere to and infect host cells in vitro. Eukaryotic cell.6,
Journal Pre-proof 1354–1362. Strayer-Scherer, A., Jones, J.B., Paret, M.L., 2019. Recombinase Polymerase Amplification Assay for Field Detection of Tomato Bacterial Spot Pathogens. Phytopathology.109, 690–700. Suebsing, R., Prombun, P., Srisala, J., Kiatpathomchai, W., 2013. Loop-mediated isothermal amplification combined with colorimetric nanogold for detection of the microsporidian Enterocytozoon hepatopenaei in penaeid shrimp. Journal of applied microbiology.114, 1254–1263. Tang, K.F.J., Aranguren, L.F., Piamsomboon, P., Han, J.E., Maskaykina, I.Y., Schmidt, M.M., 2017.
oo
f
Detection of the microsporidian Enterocytozoon hepatopenaei (EHP) and Taura syndrome virus in Penaeus vannamei cultured in Venezuela. Aquaculture.480, 17–21.
pr
Tang, K.F.J., Pantoja, C.R., Redman, R.M., Han, J.E., Tran, L.H., Lightner, D.V., 2015. Development
e-
of in situ hybridization and PCR assays for the detection of Enterocytozoon hepatopenaei (EHP), a microsporidian parasite infecting penaeid shrimp. Journal of invertebrate pathology.130, 37–41.
Pr
Tourtip, S., Wongtripop, S., Stentiford, G.D., Bateman, K.S., Sriurairatana, S., Chavadej, J., Sritunyalucksana, K., Withyachumnarnkul, B., 2009. Enterocytozoon hepatopenaei sp. nov.
al
(Microsporida: Enterocytozoonidae), a parasite of the black tiger shrimp Penaeus monodon
pathology.102, 21–29.
rn
(Decapoda: Penaeidae): Fine structure and phylogenetic relationships. Journal of invertebrate
Jo u
Xia, X., Yu, Y., Hu, L., Weidmann, M., Pan, Y., Yan, S., Wang, Y., 2015. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real- time, isothermal recombinase polymerase amplification assay. Archives of virology.160, 987–994. Table 1 Primers for RPA, PCR and real-time PCR assays. Product size Assay
Primers
Sequence (5'-3')
References (bp)
F1
TTAAAAGCCATTGAGTTTGTTGAGAGTAGCG
R1
GTAAGAGCATCGCTTTCGCCTCCGTTGGTCC
F2
CATTGAGTTTGTTGAGAGTAGCGGAACGGAT
R2
CTAAGAGCATCGCTTTCGCCTCCGTTGGTC
F3
GCGGAACGGATAGGG
RPA
Real-time
118
This study
111
This study
185
This study
Journal Pre-proof PCR
R3
GCATTGTCGGCATAG
F4
TGAGAGATGGCTCCCACGT
R4
TACTATCCCCAGAGCCCGA
510
Tang et al.
pr
oo
f
PCR
Fig. 1 Two primers (F1/R1 and F2/R2) for the detection of EHP. Lane 1, Trans2K DNA marker;
Jo u
rn
al
Pr
e-
lanes 2 and 3, DNA products amplified with primers F1/R1 and F2/R2.
Fig. 2 (A) Optimization of EHP-RPA reaction temperature. Lane 1, Trans2K DNA marker; lanes 2–5, DNA products amplified through 25, 30, 35, 40 or 45°C RPA reaction. (B) Optimization of EHP-RPA reaction time. Lane 1, Trans2K DNA marker; lanes 2–5, DNA products amplified through 10, 20, 30 or 40 min RPA reactions.
Journal Pre-proof
Fig. 3 Specificity of the RPA assay in EHP detection. Three different pathogen templates were
f
used along with EHP. Lane 1, Trans2K DNA Marker; lane 2, Enterocytozoon hepatopenaei (EHP);
oo
lane 3, infectious hypodermal and hematopoietic necrosis virus (IHHNV); lane 4, white spot
Jo u
rn
al
Pr
e-
pr
syndrome virus (WSSV); lane 5, acute hepatopancreatic necrosis disease (AHPND).
Fig. 4 (A) Sensitivity of PCR in EHP detection. Lane1, Trans2K DNA marker; lanes 2 – 11, PCR using 10- fold diluted standard plasmid (8 × 109 – 8 × 100 ). (B) Sensitivity of EHP-RPA in EHP detection. Lane1, Trans2K DNA marker; lanes 2 – 11, PCR products using 10- fold diluted standard plasmid (8 × 109 – 8 × 100 ) as template.
Pr
e-
pr
oo
f
Journal Pre-proof
al
Fig. 5 (A) Amplification curve of real-time PCR for EHP with plasmid standard templates. (B)
Jo u
rn
Standard curve of real-time PCR for EHP.
Journal Pre-proof Highlights RPA has the lowest reaction temperature among all the PCR-based methods for the detection of EHP. EHP-RPA detection method have no cross-reactivity with other pathogens.
The sensitivity of EHP-RPA was higher than PCR but lower than real-time PCR.
Jo u
rn
al
Pr
e-
pr
oo
f