- Email: [email protected]
Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3
Molecular and Cellular Probes xxx (2017) 1e4
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3 Jianchang Wang a, e, 1, Yongning Zhang c, 1, Ruoxi Zhang d, Qingan Han d, Jinfeng Wang a, e, Libing Liu a, e, Ruiwen Li b, Wanzhe Yuan b, * a
Hebei Academy of Science and Technology for Inspection and Quarantine, Shijiazhuang 050051, China College of Veterinary Medicine, Agricultural University of Hebei, Baoding 071001, China Institute of Animal Quarantine, Chinese Academy of Inspection and Quarantine, Beijing 100176, China d Hebei Animal Disease Control Center, Shijiazhuang 050050, China e Center of Inspection and Quarantine Technology, Hebei Entry-Exit Inspection and Quarantine Bureau, Shijiazhuang 050051, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 August 2017 Received in revised form 11 September 2017 Accepted 24 September 2017 Available online xxx
The objective of this study was to develop a real-time recombinase polymerase amplification (rt-RPA) assay for the rapid detection of porcine circovirus 3 (PCV3). Specific RPA primers and exo probes were designed for the cap gene of PCV3 within the conserved region of viral genome. The amplification was performed at 38 C for 20 min. The rt-RPA was specific for PCV3, as there was no cross-reaction with other pathogens tested. Using the recombinant plasmid pUC57-PCV3 as template, the analytical sensitivity was 23 copies. Of the 186 clinical samples, PCV3 DNA was identified in the 51 samples by the rtRPA, and the positive rate was 27.4% (51/186). The diagnostic agreement between the rt-RPA and realtime PCR was 96.2%. The R2 value of rt-RPA and real-time PCR was 0.919 by linear regression analysis. The developed rt-RPA assay shows promise for rapid and sensitive detection of PCV3 in diagnostic laboratories and at point-of-need, thus facilitating the prevention and control of PCV3. © 2017 Elsevier Ltd. All rights reserved.
Keywords: PCV3 Cap gene rt-RPA Molecular diagnosis
1. Introduction Porcine circoviruses (PCVs), including PCV1 and PCV2, are nonenveloped, single-stranded circular genomic DNA viruses belonging to the genus Circovirus within the Circoviridae family [1]. PCV1 is considered to be non-pathogenic for pigs [2], while PCV2 is considered as the primary etiological agent of the porcine circorvirus associated diseases (PCVAD) [3], which have become an endemic syndrome and caused severe economic losses in the swine industry worldwide. Recently, PCV3 is associated with diseased pigs in the USA [4,5], China [6,7] and Korea [8]. PCV3 DNA was identified in samples of pigs with porcine dermatitis and nephropathy syndrome (PDNS) [4], reproductive failure [4,6,8], cardiac and multisystemic inflammation [5], and respiratory disease complex [7]. PCV3 DNA was also identified in the sera [9], organs [10] and pen-based oral fluid samples [8] of pigs with no clinical infection signs. Considering the similarities between the clinical presentations associated with * Corresponding author. College of Veterinary Medicine, Agricultural University of Hebei, No.38 Lingyusi Street, Baoding, Hebei 071001, People's Republic of China. E-mail address: [email protected] (W. Yuan). 1 These authors contributed equally to this work.
PCV3 and PCV2, and the severe economic impacts of PCV2 on the swine industry, it is necessary to develop rapid and simple diagnostic methods for PCV3 detection and surveillance. PCR assays for the detection of PCV3 had been described [4,6,12]. While PCR is considered as the gold standard in molecular detection of pathogens, it is impractical for on-site application due to the time-consuming operation and unavoidable expensive thermal cycling equipments. For point-of-need diagnostics in particular, isothermal amplification methods are of great interest due to their convenience, rapid turnaround time, and minimal equipment requirement. Among the existing isothermal techniques, recombinase polymerase amplification (RPA) may be the most applicable approach for the field and point-of-need diagnosis [11]. This study describes the development and evaluation of a real-time RPA (rtRPA) assay for the rapid detection of PCV3. 2. Materials and methods 2.1. Virus strains and clinical samples The plasmid pUC57-PCV3 containing the whole genome of PCV3 had been described previously [12]. PCV1 (strain HB-BD), PCV2b
https://doi.org/10.1016/j.mcp.2017.09.001 0890-8508/© 2017 Elsevier Ltd. All rights reserved.
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
2
J. Wang et al. / Molecular and Cellular Probes xxx (2017) 1e4
(strain Bd-2014), PCV2d (strain HB-MC1), porcine respiratory and reproductive syndrome virus (PRRSV, strain HB-XL), pseudorabies virus (PRV, strain SH151218) and encephalomyocarditis virus (EMCV, strain BD2) were kept in our laboratory. Porcine parvovirus (PPV, strain BJ-2) was obtained from the commercial attenuated live vaccines. A total of 145 archived tissue samples (lung, liver, spleen, kidney, lymph node and small intestine) were collected from the diseased pigs, and 41 serum samples were collected from the clinically healthy multiparous sows. All samples were collected in the pig farms in Hebei Province from 2014 to July 2017. Specifically, clinical signs of the diseased pig were as follow: 60 samples from pigs with PMWS, 46 samples with diarrhea, 20 samples with reproductive failure, 16 samples with the respiratory disorders, and 3 samples with PDNS. The tissue samples were homogenized with phosphatebuffered saline (PBS, pH 7.4) as a 10% (w/v) suspension and centrifuged for 10 min at 3000 g at 4 C. The supernatant was collected for DNA extraction. The serum samples were used directly for DNA extraction. 2.2. DNA/RNA extraction and RNA reverse transcription Viral DNA was extracted using the TIANamp Virus DNA kit (Tiangen, Beijing, China) according to the manufacturer's instructions. Viral RNA was extracted using the Trizol Reagent (Invitrogen, Waltham, USA) according to the manufacturer's instructions. One hundred nanograms of viral RNA was reverse transcribed to cDNA using the First strand cDNA Synthesis kit (Takara, Dalian, China) according to the manufacturer's instructions. Two hundred microliters of the supernatant or serum was used for DNA extraction using the TIANamp Virus DNA kit (Tiangen, Beijing, China). Total DNA extracted from clinical samples was finally eluted in 50 mL of nuclease-free water. All DNA and cDNA were quantified using a ND-2000c spectrophotometer (NanoDrop, Wilmington, USA) and stored at 80 C until use. 2.3. RPA primers and exo probe The genome sequences of PCV1 (Accession number: EF533941, AY193712), PCV2 (Accession number: PCV2a: AF055391, EF524540, GQ359003, HQ402903, HM038034; PCV2b: AF055393, AF686763, EF524515, GQ359006, KJ679446; PCV2c: EU148503, EU148505; PCV2d: AY181946, HM038017, JQ413808, KM624035, KP231170; PCV2e: EF524532, GU001709) and PCV3 (Accession number: KY354038, KY354039, KX458235, KT869077, NC_031753, KX77 8720, KX966193, KY075990, KY075992, KY075989, KY075988, KY075986, KY075987) strains/isolates were retrieved from the GenBank and aligned using the software program DNAStar (DNASTAR, Madison, USA). Since the cap gene was highly conserved within PCV3 and showed highest diversity between PCV1, PCV2 and PCV3, the cap gene was determined as the molecular target for the rt-RPA. The primers and probes were designed following RPA manufacturer guidelines (TwistDx. Cambridge, UK). The forward primer was PCV3-RPA-F (50 - CGAGTGGAACTTTCCGCATAAGGGT CGTCTTG-30 ); the exo probe was PCV3-RPA-P(GCTGAGCTGGAGAAATTACAGGGCTGAGTG/FAM-dt/A/THF/C/BHQ1-dT/TTCATCTTTAGTATC-C3spacer); the reverse primer was PCV3-RPA-R (50 CACGCCAACCACTTCATTACCCGCCTAAACGA-30 ). The amplicon length was 215 bp. Primers and probes were synthesized by a commercial company (Sangon, Shanghai, China). 2.4. Real-time RPA assay Real-time RPA reactions were performed in a 50 mL volume using a TwistAmp™ exo kit (TwistDX, Cambridge, UK). The reaction
system included 460 nmol/L each RPA primer, 80 nmol/L exo probe, 14 mmol/L magnesium acetate, and 1 mL of viral or 3 mL sample DNA. All reagents except the viral template and magnesium acetate were prepared in a master mix, which was distributed into each 0.2 ml freeze-dried reaction tube containing a dried enzyme pellet. One mL of viral DNA was added to the tubes. Subsequently, magnesium acetate was pipetted into the tube lids, then the lids were closed carefully, the magnesium acetate was centrifuged into the rehydrated material using a minispin centrifuge. The sample was vortexed briefly and spun down once again, and the tubes were immediately placed in the Genie III scanner device to start the reaction at 38 C for 20 min. Samples produced an exponential amplification curve above the threshold of the negative control were considered positive. 2.5. Specificity and sensitivity analysis Ten nanograms of viral DNA or cDNA were used for the analytical specificity analysis. The rt-RPA assay was carried out to amplify the nucleic acids of a panel of viruses including PCV1, PCV2b, PCV2d, PCV3, PPV, PRV, PRRSV, and EMCV, which are important pathogens in swine. Five independent reactions were performed. The plasmid pUC57-PCV3, ranging from 106 to 100 copies/mL, was prepared in TE buffer (10 mmol/L TriseHCl, 1 mmol/L EDTA, pH 7.4) and used for the rt-RPA analytical sensitivity analysis. One microliter of each dilution was amplified by rt-RPA to determine the detection limit of the assay, and five independent reactions were performed. Furthermore, eight independent rt-RPA runs were performed using different copies of pUC57-PCV3 as template, and the data were used for probit regression analysis using the SPSS software (IBM, Armonk, New York). 2.6. Real-time PCR The real-time PCR assay was performed on ABI 7500 instrument (Applied Biosystems, Foster City, California) described previously [12]. The forward primer was PCV3-F (50 - CGGACTTGTAACGAATCCAAACT-30 ), the TaqMan probe was PCV3-P (FAM-50 - CTTTSGT GCCGTAGAAGTCTGTCATTCCA-30 -Eclipse), and the reverse primer was PCV3-R (50 - GGAGCATTTATGCCCCGGAAA-30 ), which were designed basing on the cap gene of PCV3. 2.7. Validation with clinical samples DNAs extracted from 186 clinical samples were detected by the rt-RPA, and the results were compared with those obtained in the real-time PCR described previously [12], which was run in parallel. 3. Results 3.1. Specificity of the rt-RPA Specific amplification was observed with PCV3, and there was no amplification of other viruses tested (Fig. 1). Five independent reactions were repeated and similar results were observed, demonstrating the high specificity of the assay. 3.2. Sensitivity of the rt-RPA Using a dilution range of 106-100 copies/mL of pUC57-PCV3 as template, the data showed that the detection limit of the rt-RPA assay was 101 copies (Fig. 2A). The RPA assay was performed eight times on the molecular standard, in which 106-102 copies DNA molecules were detected in 8/8 runs, 101, 4/8 and 100, 0/8 (Fig. 2B). Due to the inconsistency in the results, a probit regression
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
J. Wang et al. / Molecular and Cellular Probes xxx (2017) 1e4
3
analysis was applied, in which the sensitivity in 95% of cases was determined at 23 copies (Fig. 2B). 3.3. Validation of rt-RPA on clinical samples
Fig. 1. Analytical specificity of the PCV3 real-time RPA assay. Real-time RPA was carried out at 38 C for 20 min using 10 ng of viral DNA or cDNA as template. The results showed rt-RPA only amplified the PCV3 DNA, but not other viruses tested (n ¼ 5). lane 1, PCV3; lane 2, PCV1; lane 3, PCV2b; lane 4, PCV2d; lane 5, PPV; lane 6, PRV; lane 7, PRRSV; lane 8, EMCV.
Fig. 2. Performance of the PCV3 real-time RPA assay. (A) Fluorescence development over time using a dilution range of 106 -100 copies of the PCV3 standard DNA. (B) Probit regression analysis using SPSS software on data of eight PCV3 real-time RPA test runs on the DNA standards. The limit of detection at 95% probability (23 molecules) is depicted by a rhomboid.
Of 186 clinical samples, 51 samples were positive for PCV3 DNA (27.4%) in rt-RPA, while 58 samples were positive for PCV3 DNA (31.2%) in real-time PCR (Table 1). Of the 135 samples tested negative in rt-RPA, 128 samples were negative and the other 7 were positive as tested in the real-time PCR assay. The Ct values of the 7 positive samples ranged from 36.14 to 38.36, which contained low amounts of PCV3 DNA. The overall diagnostic agreement between rt-RPA and real-time PCR was 96.2% (179/186). For the positive samples, it took only 5 min-14 min in the rt-RPA assay, while the real-time RT-PCR took much longer (about 35 mine52 min) with the Ct values ranging from 25.65 to 38.15 (data not shown). These results indicated that the performance of the rt-RPA assay was comparable to real-time PCR, but the rt-RPA assay is much faster. The threshold time (TT) and cycle threshold (Ct) values of rt-RPA and real-time PCR were respectively well at an R2 value of 0.919 (Fig. 3). 4. Discussion RPA is an isothermal amplification method that can rapidly detect nucleic acids without complex laboratory equipment, and numerous RPA-based assays have been developed for the detection of diverse pathogens [11,13e19]. This study describes an rt-RPA assay based on exo probe for rapid and sensitive detection of PCV3. The rt-RPA was analytically specific and sensitive, indicating that this assay is reliable and can provide rapid and accurate detection. In this study, the RPA primers and probe were designed based on the cap gene of the strain PCV3/CN/Hubei-618/2016 (KY354039). Through alignment analysis, there was no mismatch in the forward primer in the circulating strains, only one mismatch in the reverse primer in the strain 2164 (KX458235), and there were 1e2 mismatches towards the 50 end of the probe in the strains 2164 (KX458235), 29160 (KT869077), PCV3/CN/Fujian-5/2016(KY07 5986), PCV3/CN/Fujian-12/2016 (KY075987), PCV3/CN/Henan-13/ 2016 (KY075988) and PCV3/CN/Chongqing-147/2016 (KY075990). The RPA is tolerant to 5-9 mismatches in primer and probe showing no influence on the performance of the assay [15,20], and mismatches toward the 50 end appear to be more easily tolerated by RPA [21]. Based on the above facts, the rt-RPA would perform well despite the presence of the mismatches in the reverse primer and probe. It is assumed the assay would detect all the circulating PCV3, based on targeting a conserved region, but this was not confirmed by testing the validated viruses. The rt-RPA assay should be further tested to more PCV3 DNA extracts or clinical samples from various regions worldwide to evaluate performance of the assay for detecting various strains of the virus circulating. The described conventional PCR assay required agarose gel electrophoresis [6], and the real-time PCR assays involved the expensive thermal cycler devices [4,12]. The above facts made their application in the field and the resource-limited settings difficult. The PCV3 rt-RPA was performed on the portable tube scanner Genie III (OptiGene, West Sussex, UK), which weighs only 1.75 kg with the size of 25 cm 16.5 cm 8.5 cm and can be charged by battery. The use of Genie III in the rt-RPA assay makes the point-ofneed detection of PCV3 feasible. Moreover, RPA reagents are cold chain independent [16,22] and RPA is tolerant to common PCR inhibitors [17,23]. The rt-RPA assay was more rapid, as it took only 5
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
4
J. Wang et al. / Molecular and Cellular Probes xxx (2017) 1e4
Table 1 Comparison of PCV3 real-time RPA with real-time PCR on clinical samples. Clinical signs
PMWS Diarrhea Reproductive disorders Respiratory disorders PDNS Clinical healthy Total
Sample number
Real-time RPA
Real-time PCR
Positive
Negative
Positive
Negative
60 46 20 16 3 41 186
12 24 2 0 2 11 51
48 22 18 16 1 30 135
12 28 2 0 2 13 57
48 18 18 16 1 28 129
Fig. 3. Comparison between performances of the real-time RPA and real-time PCR on clinical samples. DNA extracts of the positive clinical samples were screened. Linear regression analysis of real-time RPA threshold time (TT) values (y axis) and real-time PCR cycle threshold (Ct) values (x axis) were determined by Prism software, and the R2 value was 0.919.
min-14 min to detect the positive samples, while the real-time PCR need approximately 35 mine52 min (Ct ranging from 25.65 to 38.15). The above characteristics make the rt-RPA assay ideal for point-of-need detection of PCV3, which is especially important for pig farms located in remote and rural areas. The PCV3 DNA detection rate was 27.4% (51/186) by the rt-RPA in this study, which was in accordance with the study made by T. Stadejek et al., (25.0%, 46/184) [9], lower than the studies made by S. Zheng et al., (59.46%, 132/222) [10] and Taeyong Kwon et al., (44.2%,159/360) [8]. In our study, the PCV3 DNA was detected in 27.5% (40/145) of the samples from diseased pigs and in 26.8% (11/ 41) of samples from clinical healthy pigs, which demonstrated the similar PCV3 positive rate in both kinds of clinical samples. The above result was different from the study in Korea [8], which showed that the PCV3 positive rate for samples from sick pigs was higher. Furthermore, it was interesting that the PCV3 positive rate for samples from pigs with diarrhea was highest in our study (52.2%, 24/46). In conclusion, the developed rt-RPA assay with high analytical specificity and sensitivity is a simple, rapid and reliable method for PCV3 detection. The features of the rt-RPA assay make it suitable to be potentially applied in the rapid detection of PCV3 in diagnostic laboratories, quarantine stations and ports, especially in the resource-limited settings. Conflicts of interest statement The authors declare that they have no competing interests. Acknowledgement This work was supported by the National Key R&D Program of
China (2016YFD0501102), Natural Science Foundation Youth Project of Hebei Province (C2017325001), Science and Technology Project Foundation of Hebei Province (16226604D), the Youth Elite Project of the Chinese Academy of Inspection and Quarantine (CAIQ-YC-20140205) and partially supported by the fund for onehundred outstanding innovative talents from Hebei institution of higher learning (SLRC2017039).
References [1] A. Mankertz, R. Caliskan, K. Hattermann, B. Hillenbrand, P. Kurzendoerfer, B. Mueller, et al., Molecular biology of Porcine circovirus: analyses of gene expression and viral replication, Vet. Microbiol. 98 (2004) 81e88. [2] I. Tischer, W. Mields, D. Wolff, M. Vagt, W. Griem, Studies on epidemiology and pathogenicity of porcine circovirus, Arch. Virol. 91 (1986) 271e276. [3] I.M. Brunborg, T. Moldal, C.M. Jonassen, Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR, J. Virol. Methods 122 (2004) 171e178. [4] R. Palinski, P. Pineyro, P. Shang, F. Yuan, R. Guo, Y. Fang, et al., A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure, J. Virol. (2017) 91. [5] T.G. Phan, F. Giannitti, S. Rossow, D. Marthaler, T. Knutson, L. Li, et al., Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation, Virol. J. 13 (2016) 184. [6] X. Ku, F. Chen, P. Li, Y. Wang, X. Yu, S. Fan, et al., Identification and genetic characterization of porcine circovirus type 3 in China, Transbound. Emerg. Dis. 64 (2017) 703e708. [7] H. Shen, X. Liu, P. Zhang, L. Wang, Y. Liu, L. Zhang, et al., Genome characterization of a porcine circovirus type 3 in South China, Transbound. Emerg. Dis. (2017), https://doi.org/10.1111/tbed.12639. [8] T. Kwon, S. J Yoo, C.-K. Park, Y.S. Lyoo, Prevalence of novel porcine circovirus 3 in Korean pig populations, Veterinary Microbiol. 207 (2017) 178e180. [9] T. Stadejek, A. Wozniak, D. Milek, K. Biernacka, First detection of porcine circovirus type 3 on commercial pig farms in Poland, Transbound. Emerg. Dis. 64 (2017) 1350e1353. [10] S. Zheng, X. Wu, L. Zhang, C. Xin, Y. Liu, J. Shi, et al., The occurrence of porcine circovirus 3 without clinical infection signs in Shandong Province, Transbound. Emerg. Dis. 64 (2017) 1337e1341. [11] H.M. Amer, A. Abd El Wahed, M.A. Shalaby, F.N. Almajhdi, F.T. Hufert, M. Weidmann, A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay, J. Virol. Methods 193 (2013) 337e340. [12] J. Wang, Y. Zhang, L. Liu, X. Pang, W. Yuan, Development of a TaqMan-based real-time PCR assay for the specific detection of porcine circovirus 3, J. Virol. Methods 248 (2017) 177e180. [13] O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes, DNA detection using recombination proteins, PLoS Biol. 4 (2006) e204. [14] J. Wang, L. Liu, R. Li, Q. Fu, W. Yuan, Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification, Arch. Virol. 161 (2016) 1015e1018. [15] A. Abd El Wahed, A. El-Deeb, M. El-Tholoth, H. Abd El Kader, A. Ahmed, S. Hassan, et al., A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus, PLoS One 8 (2013) e71642. [16] O. Faye, B. Soropogui, P. Patel, A.A. El Wahed, C. Loucoubar, G. Fall, et al., Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015, Euro Surveill. (2015) 20. [17] M.D. Moore, L.A. Jaykus, Development of a recombinase polymerase amplification assay for detection of epidemic human noroviruses, Sci. Rep. 7 (2017) 40244. [18] J. Wang, L. Liu, X. Sun, W. Yuan, Recombinase polymerase amplification assaya simple, fast and cost-effective alternative to real time PCR for specific detection of feline Herpesvirus-1, PLoS One 12 (2017) e0166903. [19] J.C. Wang, W.Z. Yuan, Q.A. Han, J.F. Wang, L.B. Liu, Reverse transcription recombinase polymerase amplification assay for the rapid detection of type 2 porcine reproductive and respiratory syndrome virus, J. Virol. Methods 243 (2017) 55e60. [20] D.S. Boyle, D.A. Lehman, L. Lillis, D. Peterson, M. Singhal, N. Armes, et al., Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification, MBio (2013) 4. [21] R.K. Daher, G. Stewart, M. Boissinot, D.K. Boudreau, M.G. Bergeron, Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology, Mol. Cell Probes 29 (2015) 116e121. [22] L. Lillis, J. Siverson, A. Lee, J. Cantera, M. Parker, O. Piepenburg, et al., Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care, Mol. Cell Probes 30 (2016) 74e78. [23] R.K. Daher, G. Stewart, M. Boissinot, M.G. Bergeron, Recombinase polymerase amplification for diagnostic applications, Clin. Chem. 62 (2016) 947e958.
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3 Jianchang Wang a, e, 1, Yongning Zhang c, 1, Ruoxi Zhang d, Qingan Han d, Jinfeng Wang a, e, Libing Liu a, e, Ruiwen Li b, Wanzhe Yuan b, * a
Hebei Academy of Science and Technology for Inspection and Quarantine, Shijiazhuang 050051, China College of Veterinary Medicine, Agricultural University of Hebei, Baoding 071001, China Institute of Animal Quarantine, Chinese Academy of Inspection and Quarantine, Beijing 100176, China d Hebei Animal Disease Control Center, Shijiazhuang 050050, China e Center of Inspection and Quarantine Technology, Hebei Entry-Exit Inspection and Quarantine Bureau, Shijiazhuang 050051, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 August 2017 Received in revised form 11 September 2017 Accepted 24 September 2017 Available online xxx
The objective of this study was to develop a real-time recombinase polymerase amplification (rt-RPA) assay for the rapid detection of porcine circovirus 3 (PCV3). Specific RPA primers and exo probes were designed for the cap gene of PCV3 within the conserved region of viral genome. The amplification was performed at 38 C for 20 min. The rt-RPA was specific for PCV3, as there was no cross-reaction with other pathogens tested. Using the recombinant plasmid pUC57-PCV3 as template, the analytical sensitivity was 23 copies. Of the 186 clinical samples, PCV3 DNA was identified in the 51 samples by the rtRPA, and the positive rate was 27.4% (51/186). The diagnostic agreement between the rt-RPA and realtime PCR was 96.2%. The R2 value of rt-RPA and real-time PCR was 0.919 by linear regression analysis. The developed rt-RPA assay shows promise for rapid and sensitive detection of PCV3 in diagnostic laboratories and at point-of-need, thus facilitating the prevention and control of PCV3. © 2017 Elsevier Ltd. All rights reserved.
Keywords: PCV3 Cap gene rt-RPA Molecular diagnosis
1. Introduction Porcine circoviruses (PCVs), including PCV1 and PCV2, are nonenveloped, single-stranded circular genomic DNA viruses belonging to the genus Circovirus within the Circoviridae family [1]. PCV1 is considered to be non-pathogenic for pigs [2], while PCV2 is considered as the primary etiological agent of the porcine circorvirus associated diseases (PCVAD) [3], which have become an endemic syndrome and caused severe economic losses in the swine industry worldwide. Recently, PCV3 is associated with diseased pigs in the USA [4,5], China [6,7] and Korea [8]. PCV3 DNA was identified in samples of pigs with porcine dermatitis and nephropathy syndrome (PDNS) [4], reproductive failure [4,6,8], cardiac and multisystemic inflammation [5], and respiratory disease complex [7]. PCV3 DNA was also identified in the sera [9], organs [10] and pen-based oral fluid samples [8] of pigs with no clinical infection signs. Considering the similarities between the clinical presentations associated with * Corresponding author. College of Veterinary Medicine, Agricultural University of Hebei, No.38 Lingyusi Street, Baoding, Hebei 071001, People's Republic of China. E-mail address: [email protected] (W. Yuan). 1 These authors contributed equally to this work.
PCV3 and PCV2, and the severe economic impacts of PCV2 on the swine industry, it is necessary to develop rapid and simple diagnostic methods for PCV3 detection and surveillance. PCR assays for the detection of PCV3 had been described [4,6,12]. While PCR is considered as the gold standard in molecular detection of pathogens, it is impractical for on-site application due to the time-consuming operation and unavoidable expensive thermal cycling equipments. For point-of-need diagnostics in particular, isothermal amplification methods are of great interest due to their convenience, rapid turnaround time, and minimal equipment requirement. Among the existing isothermal techniques, recombinase polymerase amplification (RPA) may be the most applicable approach for the field and point-of-need diagnosis [11]. This study describes the development and evaluation of a real-time RPA (rtRPA) assay for the rapid detection of PCV3. 2. Materials and methods 2.1. Virus strains and clinical samples The plasmid pUC57-PCV3 containing the whole genome of PCV3 had been described previously [12]. PCV1 (strain HB-BD), PCV2b
https://doi.org/10.1016/j.mcp.2017.09.001 0890-8508/© 2017 Elsevier Ltd. All rights reserved.
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
2
J. Wang et al. / Molecular and Cellular Probes xxx (2017) 1e4
(strain Bd-2014), PCV2d (strain HB-MC1), porcine respiratory and reproductive syndrome virus (PRRSV, strain HB-XL), pseudorabies virus (PRV, strain SH151218) and encephalomyocarditis virus (EMCV, strain BD2) were kept in our laboratory. Porcine parvovirus (PPV, strain BJ-2) was obtained from the commercial attenuated live vaccines. A total of 145 archived tissue samples (lung, liver, spleen, kidney, lymph node and small intestine) were collected from the diseased pigs, and 41 serum samples were collected from the clinically healthy multiparous sows. All samples were collected in the pig farms in Hebei Province from 2014 to July 2017. Specifically, clinical signs of the diseased pig were as follow: 60 samples from pigs with PMWS, 46 samples with diarrhea, 20 samples with reproductive failure, 16 samples with the respiratory disorders, and 3 samples with PDNS. The tissue samples were homogenized with phosphatebuffered saline (PBS, pH 7.4) as a 10% (w/v) suspension and centrifuged for 10 min at 3000 g at 4 C. The supernatant was collected for DNA extraction. The serum samples were used directly for DNA extraction. 2.2. DNA/RNA extraction and RNA reverse transcription Viral DNA was extracted using the TIANamp Virus DNA kit (Tiangen, Beijing, China) according to the manufacturer's instructions. Viral RNA was extracted using the Trizol Reagent (Invitrogen, Waltham, USA) according to the manufacturer's instructions. One hundred nanograms of viral RNA was reverse transcribed to cDNA using the First strand cDNA Synthesis kit (Takara, Dalian, China) according to the manufacturer's instructions. Two hundred microliters of the supernatant or serum was used for DNA extraction using the TIANamp Virus DNA kit (Tiangen, Beijing, China). Total DNA extracted from clinical samples was finally eluted in 50 mL of nuclease-free water. All DNA and cDNA were quantified using a ND-2000c spectrophotometer (NanoDrop, Wilmington, USA) and stored at 80 C until use. 2.3. RPA primers and exo probe The genome sequences of PCV1 (Accession number: EF533941, AY193712), PCV2 (Accession number: PCV2a: AF055391, EF524540, GQ359003, HQ402903, HM038034; PCV2b: AF055393, AF686763, EF524515, GQ359006, KJ679446; PCV2c: EU148503, EU148505; PCV2d: AY181946, HM038017, JQ413808, KM624035, KP231170; PCV2e: EF524532, GU001709) and PCV3 (Accession number: KY354038, KY354039, KX458235, KT869077, NC_031753, KX77 8720, KX966193, KY075990, KY075992, KY075989, KY075988, KY075986, KY075987) strains/isolates were retrieved from the GenBank and aligned using the software program DNAStar (DNASTAR, Madison, USA). Since the cap gene was highly conserved within PCV3 and showed highest diversity between PCV1, PCV2 and PCV3, the cap gene was determined as the molecular target for the rt-RPA. The primers and probes were designed following RPA manufacturer guidelines (TwistDx. Cambridge, UK). The forward primer was PCV3-RPA-F (50 - CGAGTGGAACTTTCCGCATAAGGGT CGTCTTG-30 ); the exo probe was PCV3-RPA-P(GCTGAGCTGGAGAAATTACAGGGCTGAGTG/FAM-dt/A/THF/C/BHQ1-dT/TTCATCTTTAGTATC-C3spacer); the reverse primer was PCV3-RPA-R (50 CACGCCAACCACTTCATTACCCGCCTAAACGA-30 ). The amplicon length was 215 bp. Primers and probes were synthesized by a commercial company (Sangon, Shanghai, China). 2.4. Real-time RPA assay Real-time RPA reactions were performed in a 50 mL volume using a TwistAmp™ exo kit (TwistDX, Cambridge, UK). The reaction
system included 460 nmol/L each RPA primer, 80 nmol/L exo probe, 14 mmol/L magnesium acetate, and 1 mL of viral or 3 mL sample DNA. All reagents except the viral template and magnesium acetate were prepared in a master mix, which was distributed into each 0.2 ml freeze-dried reaction tube containing a dried enzyme pellet. One mL of viral DNA was added to the tubes. Subsequently, magnesium acetate was pipetted into the tube lids, then the lids were closed carefully, the magnesium acetate was centrifuged into the rehydrated material using a minispin centrifuge. The sample was vortexed briefly and spun down once again, and the tubes were immediately placed in the Genie III scanner device to start the reaction at 38 C for 20 min. Samples produced an exponential amplification curve above the threshold of the negative control were considered positive. 2.5. Specificity and sensitivity analysis Ten nanograms of viral DNA or cDNA were used for the analytical specificity analysis. The rt-RPA assay was carried out to amplify the nucleic acids of a panel of viruses including PCV1, PCV2b, PCV2d, PCV3, PPV, PRV, PRRSV, and EMCV, which are important pathogens in swine. Five independent reactions were performed. The plasmid pUC57-PCV3, ranging from 106 to 100 copies/mL, was prepared in TE buffer (10 mmol/L TriseHCl, 1 mmol/L EDTA, pH 7.4) and used for the rt-RPA analytical sensitivity analysis. One microliter of each dilution was amplified by rt-RPA to determine the detection limit of the assay, and five independent reactions were performed. Furthermore, eight independent rt-RPA runs were performed using different copies of pUC57-PCV3 as template, and the data were used for probit regression analysis using the SPSS software (IBM, Armonk, New York). 2.6. Real-time PCR The real-time PCR assay was performed on ABI 7500 instrument (Applied Biosystems, Foster City, California) described previously [12]. The forward primer was PCV3-F (50 - CGGACTTGTAACGAATCCAAACT-30 ), the TaqMan probe was PCV3-P (FAM-50 - CTTTSGT GCCGTAGAAGTCTGTCATTCCA-30 -Eclipse), and the reverse primer was PCV3-R (50 - GGAGCATTTATGCCCCGGAAA-30 ), which were designed basing on the cap gene of PCV3. 2.7. Validation with clinical samples DNAs extracted from 186 clinical samples were detected by the rt-RPA, and the results were compared with those obtained in the real-time PCR described previously [12], which was run in parallel. 3. Results 3.1. Specificity of the rt-RPA Specific amplification was observed with PCV3, and there was no amplification of other viruses tested (Fig. 1). Five independent reactions were repeated and similar results were observed, demonstrating the high specificity of the assay. 3.2. Sensitivity of the rt-RPA Using a dilution range of 106-100 copies/mL of pUC57-PCV3 as template, the data showed that the detection limit of the rt-RPA assay was 101 copies (Fig. 2A). The RPA assay was performed eight times on the molecular standard, in which 106-102 copies DNA molecules were detected in 8/8 runs, 101, 4/8 and 100, 0/8 (Fig. 2B). Due to the inconsistency in the results, a probit regression
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
J. Wang et al. / Molecular and Cellular Probes xxx (2017) 1e4
3
analysis was applied, in which the sensitivity in 95% of cases was determined at 23 copies (Fig. 2B). 3.3. Validation of rt-RPA on clinical samples
Fig. 1. Analytical specificity of the PCV3 real-time RPA assay. Real-time RPA was carried out at 38 C for 20 min using 10 ng of viral DNA or cDNA as template. The results showed rt-RPA only amplified the PCV3 DNA, but not other viruses tested (n ¼ 5). lane 1, PCV3; lane 2, PCV1; lane 3, PCV2b; lane 4, PCV2d; lane 5, PPV; lane 6, PRV; lane 7, PRRSV; lane 8, EMCV.
Fig. 2. Performance of the PCV3 real-time RPA assay. (A) Fluorescence development over time using a dilution range of 106 -100 copies of the PCV3 standard DNA. (B) Probit regression analysis using SPSS software on data of eight PCV3 real-time RPA test runs on the DNA standards. The limit of detection at 95% probability (23 molecules) is depicted by a rhomboid.
Of 186 clinical samples, 51 samples were positive for PCV3 DNA (27.4%) in rt-RPA, while 58 samples were positive for PCV3 DNA (31.2%) in real-time PCR (Table 1). Of the 135 samples tested negative in rt-RPA, 128 samples were negative and the other 7 were positive as tested in the real-time PCR assay. The Ct values of the 7 positive samples ranged from 36.14 to 38.36, which contained low amounts of PCV3 DNA. The overall diagnostic agreement between rt-RPA and real-time PCR was 96.2% (179/186). For the positive samples, it took only 5 min-14 min in the rt-RPA assay, while the real-time RT-PCR took much longer (about 35 mine52 min) with the Ct values ranging from 25.65 to 38.15 (data not shown). These results indicated that the performance of the rt-RPA assay was comparable to real-time PCR, but the rt-RPA assay is much faster. The threshold time (TT) and cycle threshold (Ct) values of rt-RPA and real-time PCR were respectively well at an R2 value of 0.919 (Fig. 3). 4. Discussion RPA is an isothermal amplification method that can rapidly detect nucleic acids without complex laboratory equipment, and numerous RPA-based assays have been developed for the detection of diverse pathogens [11,13e19]. This study describes an rt-RPA assay based on exo probe for rapid and sensitive detection of PCV3. The rt-RPA was analytically specific and sensitive, indicating that this assay is reliable and can provide rapid and accurate detection. In this study, the RPA primers and probe were designed based on the cap gene of the strain PCV3/CN/Hubei-618/2016 (KY354039). Through alignment analysis, there was no mismatch in the forward primer in the circulating strains, only one mismatch in the reverse primer in the strain 2164 (KX458235), and there were 1e2 mismatches towards the 50 end of the probe in the strains 2164 (KX458235), 29160 (KT869077), PCV3/CN/Fujian-5/2016(KY07 5986), PCV3/CN/Fujian-12/2016 (KY075987), PCV3/CN/Henan-13/ 2016 (KY075988) and PCV3/CN/Chongqing-147/2016 (KY075990). The RPA is tolerant to 5-9 mismatches in primer and probe showing no influence on the performance of the assay [15,20], and mismatches toward the 50 end appear to be more easily tolerated by RPA [21]. Based on the above facts, the rt-RPA would perform well despite the presence of the mismatches in the reverse primer and probe. It is assumed the assay would detect all the circulating PCV3, based on targeting a conserved region, but this was not confirmed by testing the validated viruses. The rt-RPA assay should be further tested to more PCV3 DNA extracts or clinical samples from various regions worldwide to evaluate performance of the assay for detecting various strains of the virus circulating. The described conventional PCR assay required agarose gel electrophoresis [6], and the real-time PCR assays involved the expensive thermal cycler devices [4,12]. The above facts made their application in the field and the resource-limited settings difficult. The PCV3 rt-RPA was performed on the portable tube scanner Genie III (OptiGene, West Sussex, UK), which weighs only 1.75 kg with the size of 25 cm 16.5 cm 8.5 cm and can be charged by battery. The use of Genie III in the rt-RPA assay makes the point-ofneed detection of PCV3 feasible. Moreover, RPA reagents are cold chain independent [16,22] and RPA is tolerant to common PCR inhibitors [17,23]. The rt-RPA assay was more rapid, as it took only 5
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001
4
J. Wang et al. / Molecular and Cellular Probes xxx (2017) 1e4
Table 1 Comparison of PCV3 real-time RPA with real-time PCR on clinical samples. Clinical signs
PMWS Diarrhea Reproductive disorders Respiratory disorders PDNS Clinical healthy Total
Sample number
Real-time RPA
Real-time PCR
Positive
Negative
Positive
Negative
60 46 20 16 3 41 186
12 24 2 0 2 11 51
48 22 18 16 1 30 135
12 28 2 0 2 13 57
48 18 18 16 1 28 129
Fig. 3. Comparison between performances of the real-time RPA and real-time PCR on clinical samples. DNA extracts of the positive clinical samples were screened. Linear regression analysis of real-time RPA threshold time (TT) values (y axis) and real-time PCR cycle threshold (Ct) values (x axis) were determined by Prism software, and the R2 value was 0.919.
min-14 min to detect the positive samples, while the real-time PCR need approximately 35 mine52 min (Ct ranging from 25.65 to 38.15). The above characteristics make the rt-RPA assay ideal for point-of-need detection of PCV3, which is especially important for pig farms located in remote and rural areas. The PCV3 DNA detection rate was 27.4% (51/186) by the rt-RPA in this study, which was in accordance with the study made by T. Stadejek et al., (25.0%, 46/184) [9], lower than the studies made by S. Zheng et al., (59.46%, 132/222) [10] and Taeyong Kwon et al., (44.2%,159/360) [8]. In our study, the PCV3 DNA was detected in 27.5% (40/145) of the samples from diseased pigs and in 26.8% (11/ 41) of samples from clinical healthy pigs, which demonstrated the similar PCV3 positive rate in both kinds of clinical samples. The above result was different from the study in Korea [8], which showed that the PCV3 positive rate for samples from sick pigs was higher. Furthermore, it was interesting that the PCV3 positive rate for samples from pigs with diarrhea was highest in our study (52.2%, 24/46). In conclusion, the developed rt-RPA assay with high analytical specificity and sensitivity is a simple, rapid and reliable method for PCV3 detection. The features of the rt-RPA assay make it suitable to be potentially applied in the rapid detection of PCV3 in diagnostic laboratories, quarantine stations and ports, especially in the resource-limited settings. Conflicts of interest statement The authors declare that they have no competing interests. Acknowledgement This work was supported by the National Key R&D Program of
China (2016YFD0501102), Natural Science Foundation Youth Project of Hebei Province (C2017325001), Science and Technology Project Foundation of Hebei Province (16226604D), the Youth Elite Project of the Chinese Academy of Inspection and Quarantine (CAIQ-YC-20140205) and partially supported by the fund for onehundred outstanding innovative talents from Hebei institution of higher learning (SLRC2017039).
References [1] A. Mankertz, R. Caliskan, K. Hattermann, B. Hillenbrand, P. Kurzendoerfer, B. Mueller, et al., Molecular biology of Porcine circovirus: analyses of gene expression and viral replication, Vet. Microbiol. 98 (2004) 81e88. [2] I. Tischer, W. Mields, D. Wolff, M. Vagt, W. Griem, Studies on epidemiology and pathogenicity of porcine circovirus, Arch. Virol. 91 (1986) 271e276. [3] I.M. Brunborg, T. Moldal, C.M. Jonassen, Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR, J. Virol. Methods 122 (2004) 171e178. [4] R. Palinski, P. Pineyro, P. Shang, F. Yuan, R. Guo, Y. Fang, et al., A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure, J. Virol. (2017) 91. [5] T.G. Phan, F. Giannitti, S. Rossow, D. Marthaler, T. Knutson, L. Li, et al., Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation, Virol. J. 13 (2016) 184. [6] X. Ku, F. Chen, P. Li, Y. Wang, X. Yu, S. Fan, et al., Identification and genetic characterization of porcine circovirus type 3 in China, Transbound. Emerg. Dis. 64 (2017) 703e708. [7] H. Shen, X. Liu, P. Zhang, L. Wang, Y. Liu, L. Zhang, et al., Genome characterization of a porcine circovirus type 3 in South China, Transbound. Emerg. Dis. (2017), https://doi.org/10.1111/tbed.12639. [8] T. Kwon, S. J Yoo, C.-K. Park, Y.S. Lyoo, Prevalence of novel porcine circovirus 3 in Korean pig populations, Veterinary Microbiol. 207 (2017) 178e180. [9] T. Stadejek, A. Wozniak, D. Milek, K. Biernacka, First detection of porcine circovirus type 3 on commercial pig farms in Poland, Transbound. Emerg. Dis. 64 (2017) 1350e1353. [10] S. Zheng, X. Wu, L. Zhang, C. Xin, Y. Liu, J. Shi, et al., The occurrence of porcine circovirus 3 without clinical infection signs in Shandong Province, Transbound. Emerg. Dis. 64 (2017) 1337e1341. [11] H.M. Amer, A. Abd El Wahed, M.A. Shalaby, F.N. Almajhdi, F.T. Hufert, M. Weidmann, A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay, J. Virol. Methods 193 (2013) 337e340. [12] J. Wang, Y. Zhang, L. Liu, X. Pang, W. Yuan, Development of a TaqMan-based real-time PCR assay for the specific detection of porcine circovirus 3, J. Virol. Methods 248 (2017) 177e180. [13] O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes, DNA detection using recombination proteins, PLoS Biol. 4 (2006) e204. [14] J. Wang, L. Liu, R. Li, Q. Fu, W. Yuan, Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification, Arch. Virol. 161 (2016) 1015e1018. [15] A. Abd El Wahed, A. El-Deeb, M. El-Tholoth, H. Abd El Kader, A. Ahmed, S. Hassan, et al., A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus, PLoS One 8 (2013) e71642. [16] O. Faye, B. Soropogui, P. Patel, A.A. El Wahed, C. Loucoubar, G. Fall, et al., Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015, Euro Surveill. (2015) 20. [17] M.D. Moore, L.A. Jaykus, Development of a recombinase polymerase amplification assay for detection of epidemic human noroviruses, Sci. Rep. 7 (2017) 40244. [18] J. Wang, L. Liu, X. Sun, W. Yuan, Recombinase polymerase amplification assaya simple, fast and cost-effective alternative to real time PCR for specific detection of feline Herpesvirus-1, PLoS One 12 (2017) e0166903. [19] J.C. Wang, W.Z. Yuan, Q.A. Han, J.F. Wang, L.B. Liu, Reverse transcription recombinase polymerase amplification assay for the rapid detection of type 2 porcine reproductive and respiratory syndrome virus, J. Virol. Methods 243 (2017) 55e60. [20] D.S. Boyle, D.A. Lehman, L. Lillis, D. Peterson, M. Singhal, N. Armes, et al., Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification, MBio (2013) 4. [21] R.K. Daher, G. Stewart, M. Boissinot, D.K. Boudreau, M.G. Bergeron, Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology, Mol. Cell Probes 29 (2015) 116e121. [22] L. Lillis, J. Siverson, A. Lee, J. Cantera, M. Parker, O. Piepenburg, et al., Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care, Mol. Cell Probes 30 (2016) 74e78. [23] R.K. Daher, G. Stewart, M. Boissinot, M.G. Bergeron, Recombinase polymerase amplification for diagnostic applications, Clin. Chem. 62 (2016) 947e958.
Please cite this article in press as: J. Wang, et al., Recombinase polymerase amplification assay for rapid detection of porcine circovirus 3, Molecular and Cellular Probes (2017), https://doi.org/10.1016/j.mcp.2017.09.001