deletions (indels) within the ADAMTS9 gene and their associations with growth traits in goat

Journal Pre-proof Detection of two insertion/deletions (indels) within the ADAMTS9 gene and their associations with growth traits in goat Qi Tang, Xuelian Zhang, Xinyu Wang, Ke Wang, Hailong Yan, Haijing Zhu, Xianyong Lan, Qu Lei, Chuanying Pan

PII:

S0921-4488(19)30176-2

DOI:

https://doi.org/10.1016/j.smallrumres.2019.09.015

Reference:

RUMIN 5991

To appear in:

Small Ruminant Research

Received Date:

12 February 2019

Revised Date:

16 September 2019

Accepted Date:

17 September 2019

Please cite this article as: Tang Q, Zhang X, Wang X, Wang K, Yan H, Zhu H, Lan X, Lei Q, Pan C, Detection of two insertion/deletions (indels) within the ADAMTS9 gene and their associations with growth traits in goat, Small Ruminant Research (2019), doi: https://doi.org/10.1016/j.smallrumres.2019.09.015

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Detection of two insertion/deletions (indels) within the ADAMTS9 gene and their associations with growth traits in goat Qi Tang1, Xuelian Zhang1, Xinyu Wang1, Ke Wang1, Hailong Yan1,2,3, Haijing Zhu2, 3, Xianyong Lan1, Qu Lei2,3, Chuanying Pan1* 1. College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China

R. China

-p

3. Life Science Research Center, Yulin University, Yulin, Shaanxi, P. R. China

ro of

2. Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin, Shaanxi, P.

First Author: Qi Tang

re

E-mail: [email protected]

E-mail: [email protected]

lP

*Corresponding Author: Chuanying Pan

na

Tel: +86-29-87092164 Fax: +86-29-87092164

Address: College of Animal Science and Technology, Northwest A&F University,

ur

No.22 Xinong Road, Yangling, Shaanxi 712100, P.R. China.

Highlights:

The insertion/deletions (indels) variations within ADAMTS9 gene of goat were firstly explored in this study

Jo

 

Two novel indels were firstly verified and their associations with growth traits have been analyzed in a large sample of Shaanbei white cashmere (SBWC) goats

Abstract The “A Disintegrin and Metalloproteinase with Thrombospondin Type-1 motifs 9” (ADAMTS9) is a Zn2+dependent metalloproteinases of ADAMTSs family, and it regulates growth and development of mammals. Here, the aim of this study was to explore the genetic variations of ADAMTS9 gene and evaluate their effect on growth performance. Herein, two novel deletions (22-bp and 14-bp) were found and their significant associations were

ro of

detected in Shaanbei white cashmere (SBWC) goats (n = 1006). Further analysis showed low linkage disequilibrium. The results indicated that the 22-bp deletion was related to chest width (CW; P = 0.002), chest width index (CWI; P = 1.18E-04) and chest circumference index (CCI; P = 0.022), and the individuals with II

-p

genotype had lower CW, CWI and CCI. Another 14-bp deletion was associated with height across the hip (P = 0.039) and the II genotype was the dominant genotype. Combination analysis revealed that there were five joint

re

genotypes with relatively high combination frequency, and significant effects were found for them on chest width

lP

(CW; P ≤ 0.020), chest circumference (CC; P ≤ 0.015), chest circumference index (CCI; P ≤ 0.047) and chest width index (CWI; P ≤ 0.006). Individuals with joint genotypes IP2DP2IP3DP3 and IP2DP2IP3IP3 had higher values.

na

Together, these findings hinted that the two novel indels within ADAMTS9 gene were related to growth traits in goat, which may provide functional genetic markers for improving economical traits in goat breeding.

ur

Keywords: goat; ADAMTS9 gene; insertion/deletion (indel); association analysis; growth traits

Jo

1. Introduction

The goat breed resources are quite abundant in China, but a considerable part of them have shortcomings

such as poor meat quality and low production efficiency (Zhao et al., 2014). With the development of goat industry, certain economic characteristics of local breeds should be strengthened. Among the Chinese indigenous varieties, shaanbei white cashmere (SBWC) goat is famous for its stable genetic performance and remarkably high meat

quality. It is mainly distributed in Yulin, Shaanxi Province and is a new dual-purpose (cashmere and meat) type that has been cultivated for many years (Shaanxi Province Engineering & Technology Research Center of Cashmere Goats, 2015). Several studies have reported the growth performance of SBWC goat, but its potential growth and development capabilities haven’t been fully utilized (Wang et al., 2019). Traditional breeding methods is in a low efficiency, long cycle and can’t adapt to production, which causes experts have to spend a mass of time

ro of

on breeding design and cultivating. Thus, screening candidate genes related to growth traits is more worthwhile for improving the breeding efficiency and accuracy of goat.

DNA marker-assisted selection (MAS), including single-nucleotide polymorphisms (SNPs) (Wang et al.,

-p

2019), insertions/deletions (indels) (Li et al., 2018b), copy number variations (CNVs) and structure variation (SVs) were viable paths on improving phenotypic traits in goat (Lande et al., 1990). Compared to other molecular

re

markers (e.g. SNPs, CNVs and SVs), the indel variants were of more superiority in high accuracy and stable

lP

variation (Sun et al., 2013). Hence, the detection of indel variations had been applied in various research fields, such as genetic analysis of biological populations, molecular-assisted breeding of crops and livestock, forensic and

na

medical diagnosis, etc (Huo et al., 2017; Sheng et al., 2018; Wang et al., 2019). The “A Disintegrin and Metalloproteinase with Thrombospondin Type-1 motifs 9” (ADAMTS9), a zinc

ur

metalloprotease enzymes, expressing in mammals and invertebrates. Well founded, it was wildly expressed

Jo

throughout mouse embryo development including skeletal development which occurred entirely within the second half of gestation (Katherine et al., 2005). In early pregnancy, ADAMTS9 was similarly associated with the initial condensation of central mesenchymal of aggregation of mesenchyme in the cartilage center, followed by cartilage formation around the cartilage, and the expression of this gene was also detected in the growth cartilage proliferative zones of vertebral end-plates and long bones (Kanae et al., 2008). As we all know, the development

of bone was correlated with organic growth (González-Cerón et al., 2015). Furthermore, epidermal growth factor receptor (EGFR) and transforming growth factor beta 1 (TGF-beta-1) had been identified to be associated with growth traits, while ADAMTS9 was a vital regulator of them (Du et al., 2013; Chen et al., 2018; Shao et al., 2018; Wang et al., 2018). Above studies suggested that ADAMTS9 plausibly influenced the growth progress of organisms and the underlying genetic mechanisms is waiting for clarification.

ro of

To date, little information about the growth and development within ADAMTS9 gene is available for goat and insertion/deletions (indels) polymorphism studies of this gene are also rare. Therefore, we aimed to explore the possible novel indels of ADAMTS9 gene and evaluate their impact on growth traits of cashmere goats in this study,

-p

so as to provide a basis for the selection of individuals with excellent traits.

2. Materials and methods

re

All experiments of this study were performed in agreement with the International Animal Care and Use

lP

Committee of the Northwest A&F University (IACUC-NWAFU). The care and use of animals completely complied with local animal welfare laws and policies.

na

2.1 Sample and data collection

A total of 1006 unrelated female SBWC goats aged 2-4 years were randomly selected from native breeding

ur

farms in Yulin, northern Shaanxi Province (Wang et al., 2017b; Yang et al., 2017; Cui et al., 2018; Kang et al.,

Jo

2019b). All of the weaned goats were raised in standard conditions and kept on the same diet. Data on growthrelated traits of SBWC goats, including height across the hip (HAT), chest width (CW), chest depth (CD), body height (BH); body length (BL), chest circumference (CC), circumference of cannon bone (CCB), body weight (BW) and hip width (HW), were collected by farm staff (Zhang et al., 2015; Wang et al., 2017b). Body length index (BLI), chest circumference index (CCI), circumference of cannon bone index (CCBI) and chest width index

(CWI) were calculated directly according to the data provided (Jiang et al., 2019).

2.2 Isolation of DNA Genomic DNA from ear tissues was isolated using high salt-extraction method (Aljanabi and Martinez, 1997; Lan XY, 2007). The concentration and quality of DNA had been analyzed using Nanodrop 1000 Spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA). Then all samples were diluted to 20 ng/μL (the working

ro of

concentration) and stored at -20oC for subsequent analysis.

2.3 Primer Design, Amplifications and Genotyping

Based on the goat ADAMTS9 gene (NC_030829) reference sequences in NCBI database, five pairs of primers

-p

for five loci (P1-P5) were designed by Premier 5.0 software to amplify DNA pools covering all the indels region in the dbSNP database (https://www.ncbi.nlm.nih.gov/SNP/index.html) (Table 1). Each PCR reaction mixed 6.5

re

μL 2×MIX (Tsingke, Xi’an, China), 0.4 μL of each primer and 0.5 μL genomic DNA, finally supplement the

lP

reaction system with 5.2 μL ddH2O to 13 μL. To reduce non-specific amplification, a touch-down PCR program was conducted as follows: 95oC predegeneration for 5 min, 18 cycles of 94oC degeneration for 30 s, 68oC annealing

na

for 30 s and 72oC extension for 20 s with 1oC reduced per cycle, then denaturing at 95 oC for 30 s, annealing at 50oC for 30 s and extending at 72oC for 20 s were performed for 28 cycles, with a final 72oC extension for 10 min,

ur

and subsequently cooling at 10oC. Afterwards, the PCR products (4.5 μL) were validated by 3% agarose gel

Jo

electrophoresis at a constant voltage (120 V) for 70 min and then some of them were selected for sequencing to further determine the genotype of individuals (Sangon Biotech, Xi’an; Jiang et al., 2019). Sequence alignment was conducted by using BioXM 2.6 and Chromas 2.4.1 software.

2.4 Statistical analysis Genotype and allele frequencies were calculated directly. Following Nei’s methods, population genetic

diversity indices, including homozygosity (Ho), heterozygosity (He), effective allele numbers (Ne) and polymorphism information content (PIC) were performed (Nei M., 1973; Lan et al., 2007). Moreover, Haplotype analysis and Linkage Disequilibrium (LD) tests across the two indel loci of ADAMTS9 gene in SBWC breed were operated using the SHEsis online platform (http://analysis.biox.cn; Kang et al., 2019a; Li et al., 2009). The association analysis of the indels within ADAMTS9 gene and the body measurement traits in SBWC

ro of

population was tested via student t-test and one-way ANOVA followed by a LSD Multiple Comparison test in SPSS software (version 24.0). Then using the Benjamini-Hochberg method, the P values were corrected to control the false detection rate (FDR). To assess the relationship between each individual, the basic linear model was used

-p

as follows: Yijk = μ+Ai+Gj+eijk, in which Yijk is the growth-related traits measured on each animal, μ is the overall mean of each trait, Ai is the fixed effect of age, Gj is the fixed effect of genotype or joint genotype, and e ijk is the

re

random residual error (Wang et al., 2017b; Yang et al., 2017; Zhao et al., 2013; Jin et al., 2018). The least square

lP

means with standard errors for different genotypes and growth traits were used (Zhang et al., 2015).

3. Results

na

3.1 Indel selecting, genotyping and sequencing

Five pairs of primers were designed for five loci (P1-P5) in total, and all of them were able to amplify the

ur

DNA pool by PCR successfully (Table 1). Among the five loci, only two indel variants showed polymorphism in

Jo

the analyzed population: one of 22-bp indel (intron 37) (g.146211_146232del.TGTGTAGTACTGTGATAAAACA; rs639397062; P2) and another of 14-bp indel (intron 39) (g.159010_159023del.GCCCTCTCTCTCTT; rs653192605; P3). The remaining three sites (P1, P4, P5) were all in single band (The results were not shown). Genotyping for the P2 locus (22-bp indel) and P3 locus (14-bp indel) of ADAMTS9 gene was successfully genotyped and the non-targeted bands accompanied with heterozygote was heteroduplex (Wang et al., 2010). Both

electrophoresis maps and sequencing maps of two indels were presented in Fig. 1 and Fig. 2. Preliminary tests had found that the 22-bp indel in P2 locus within SBWC goats was in a low frequency, so the method based on the mathematical expectation (ME) strategy was used to identify this locus and five individuals were mixed in a 30 μL reaction pool. The individuals were genotyped separately to assign the genotype specifically if multiple bands were observed in the pool (Yang et al., 2016; Yang et al., 2019).

ro of

3.2 Analysis of genetic diversity The genotypic frequencies and allelic frequencies were calculated for the two indels of ADAMTS9 gene to determine the genotype distribution in SBWC goats (Table 2). Genetic parameters demonstrated that both indel

-p

loci were at the Hardy-Weinberg equilibrium (P > 0.05) and classified as low diversity (0 < PIC < 0.25) in the tested population. Using pairwise linkage disequilibrium analysis, three haplotypes and their frequencies were

re

reconstructed for the indels: IP2IP3 (0.798), IP2DP3 (0.169) and DP2IP3 (0.033). And based on the results of r2 = 0.007

lP

and D’ = 0.974, we inferred that the P2 locus (22-bp indel) and the P3 locus (14-bp) were not closely linked (Fig. 3).

na

3.3 Associations of the ADAMTS9 gene genetic variations with growth traits in goat The association of ADAMTS9 indel loci and growth traits was analyzed and the results had been shown in the

ur

Table 3. The P2 locus (22-bp indel) was obviously related with chest width (CW; P = 0.002), chest width index

Jo

(CWI; P = 1.18E-04) and chest circumference index (CCI; P = 0.022). Individuals with II genotype had lower CW, CWI and CCI compared to that of genotype ID. The P3 locus (14-bp indel) was associated with height across the hip (HAT; P = 0.039), and the individuals with II genotype had higher values for HAT than either ID or DD. Furthermore, according to the haplotype analysis, five joint genotypes with relatively high combination frequencies were obtained. And among them, chest width (CW; P ≤ 0.020), chest circumference (CC; P ≤ 0.015),

chest circumference index (CCI; P ≤ 0.047) and chest width index (CWI; P ≤ 0.006) were in a significant difference. Notably, IP2DP2IP3DP3 and IP2DP2IP3IP3, these two joint genotypes were in a great advantage of phenotype.

4. Discussion Goat industry accounts for a large proportion in the Chinese national economy, so improving the production properties of goat is of great significance for enhancing economic performance and improving living quality.

ro of

Growth traits of goat are important economic and quantitative traits and need to be further improvement due to the slow growth rate. With the progress of biotechnology, marker assisted selection (MAS) plays an increasingly important role in goat breeding and many quantitative trait loci (QTL) that affect the important economic traits of

-p

goat have been successfully positioned (Shen W et al., 2004). ADAMTS9 was the most conservative extracellular zinc metalloproteinase of the ADAMTS family, with great significance in the assembly and degradation of

re

extracellular matrix, the construction of connective tissue, angiogenesis as well as cell migration (Kelwick et al.,

lP

2015; InesDesanlis et al., 2018; Schnellmann et al., 2018; Wei et al., 2018). Also, metalloproteinase played an important role in cartilage, intramembranous ossification and postnatal bone remodeling (Aiken et al., 2018). It’s

na

reported that ADAMTS1 was an early response gene of osteoblast parathyroid hormone, belonging to the same family with ADAMTS9, and had been verified to promote the growth of collagen gel osteoblasts. Studies had shown

ur

that mice lacking ADAMTS1 were smaller compared with wild-type (WT) mice, while over-expression of this gene

Jo

would increase bone mineral density, thus further confirmed ADAMTS1 was an effective regulator of bone remodeling (Hu et al., 2012). On the other hand, miR-190b was able to inhibit lipid accumulation and increase insulin sensitivity by targeting IGF1 and ADAMTS9, indicating that the ADAMTS9 gene was involved in the metabolism of the body, and then might affecting growth traits (Indrikis et al., 2018; Xu et al., 2018). To the best of our knowledge, genetic polymorphisms referring to growth traits on mammal of ADAMTS9 gene had not been

reported until now. Therefore, we hope to explore genetic variations in ADAMTS9 gene, with the aim of making identified polymorphisms serve as molecular markers for improving in growth traits of goat. In this study, we preliminarily screened out two novel indel (22-bp indel and 14-bp indel) within the goat ADAMTS9 gene, respectively. To verify the association between the indels and some growth indicators, a large sample of goats had been analyzed. The results indicated that the mutation of ADAMTS9 gene was associated with

ro of

partial growth traits. The 22-bp indel was associated with chest width (CW), chest width index (CWI) and chest circumference index (CCI) and the genotype ID was optimal, speculating that it might be the result of heterosis. The number of DD genotype at this locus was extremely small without practical guiding significance, so the DD

-p

genotype was not analyzed (Chen et al., 2019). As for the 14-bp indel, height across the hip (HAT) was significantly different and the II genotype had a better phenotype in SBWC goats, demonstrating that the allele I might increase

re

the phenotypic traits in goat. Further analysis revealed that these two loci showed low linkage disequilibrium,

lP

consistent with the association analysis. In addition, both loci were in low polymorphism and were at HardyWeinberg equilibrium (P > 0.05) in the tested population, explaining that they were genetically stable despite the

na

function of natural selection, artificial selection, migration and genetic drift. Combining with our analysis, this gene might be a growth-promoting gene. This was consistent with the truth we know that zinc deficiency inhibits

ur

growth and development of organisms because ADAMTS9 was a Zn2+-dependent metalloproteinase, and the

Jo

deficiency of zine might lead to the loss of enzyme activity (Coleman et al., 2005). Evidence suggested that when the allele of ADAMTS9 gene was mutated, this secreted enzyme would be confined to the cell surface, leading to the reduction of versican proteolysis and accumulation of extracellular matrix (ECM), ultimately damaging the growth of cells (Nandadasa et al., 2015). This might explain why these two indels of ADAMTS9 had such remarkable influence on growth traits.

In the present study, although both indels were detected in the intron region, which did not alter the amino acid composition and structure of the encoded protein, they had significant effects on growth traits (P < 0.05), consisted with previous studies. For example, a 16bp deletion in intron17 of lysine demethylase 6A (KDM6A) gene was significantly correlated with first-born litter size (P < 0.01) (Cui et al., 2018). Additionally, Li et al. had identified three novel intronic indel polymorphisms of the prion protein (PRNP) gene could regulate multiple

ro of

growth traits (Li et al., 2018a). In many eukaryotes, introns could affect transcription rate, nuclear export, and transcriptional stability without acting as a transcription factor binding site, thereby changing gene expression level (Shaul et al., 2017). In general, on account of the vital regulatory function in body metabolism, maintains bone

-p

development and homeostasis, ADAMTS9 gene could emerge as a meaningful basis for marker assisted selection (MAS). According to the association results of joint genotypes, cultivating and selecting the individuals with

re

IP2DP2IP3DP3 and IP2DP2IP3IP3 may become to the new directions for reference in future breeding. Meanwhile, further

lP

studies should be converged on the stability and molecular mechanism of this gene in regulating growth and development to change the current situation that slow growth is still important limiting factors for the mutton

na

industry despite an abundance of goat breeds in China (Wang et al., 2017a). Moreover, since SBWC goat is a breed mainly for fiber production, it remains to be explored whether the mutations of ADAMTS9 has any effects on

ur

cashmere traits

Jo

5. Conclusion

Two novel indels in the ADAMTS9 gene were firstly verified in SBWC goats and were significantly associated

with part of growth traits via association analysis, which suggesting that ADAMTS9 could be regarded as a potential molecular marker for important economic traits in the goat industry.

Conflict of interest statement

We confirm that this manuscript has not been published in whole or in part and is not being considered for publication elsewhere. There are no any ethical conflicts of interest for all authors. The corresponding authors, Dr. CY Pan takes responsibility on behalf of all authors for the authorship, authenticity and integrity of this manuscript, and affirms that all authors and acknowledged contributors have read and approved this manuscript.

Acknowledgements

ro of

This work was funded by the National Natural Science Foundation of China (No.31760650; No.31702115) and Provincial Key Projects of Shaanxi (2014KTDZ02-01).We greatly thanked the staffs of Shaanbei white cashmere goat breeding farm, Shaanxi province, P.R. China for their collecting samples.

-p

Abbreviations

ADAMTS9, A disintegrin and metalloproteinase with thrombospondin Type-1 motifs 9; SBWC, shaanbei white

re

cashmere; MAS, marker assisted selection; Indels, insertion/deletions; SNPs, single nucleotide polymorphisms;

lP

CNVs, copy number variations; SVs, structure variations; PCR, polymerase chain reaction; SPSS, Statistical product and service solutions; Ho, homozygosity; He, heterozygosity; Ne, effective allele numbers; PIC,

na

polymorphism information content; HWE, Hardy-Weinberg equilibrium; LD, linkage disequilibrium; HAT, height across the hip; CW, chest width; CD, chest depth; BH, body height; BL, body length; CC, chest circumference;

ur

CCB, circumference of cannon bone; HW, hip width; BW, body weight; BLI, body length index; CCI, chest

Jo

circumference index; CCBI, circumference of cannon bone index; CWI, chest width index.

References

Aljanabi SM, Martinez I, 1997. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Res. 25, 4692-4693.

Aiken A, Khokha R, 2010. Unraveling metalloproteinase function in skeletal biology and disease using genetically altered mice. Biochim Biophys Acta. 1803(1), 121-132. Chen L, Tang J, Feng Y, Li S, Xiang Q, He X, Ren G, Peng W, Xiang T, 2018. ADAMTS9 is silenced by epigenetic disruption in colorectal cancer and inhibits cell growth and metastasis by regulating Akt/p53 Signaling. Cell Physiol Biochem. 44(4), 1370-1380.

Chen M, Wang J, Liu N, Cui W, Dong W, Xing B, Pan C, 2019. Pig SOX9: Expression profiles of Sertoli cell (SCs) and a functional 18 bp indel affecting testis weight. Theriogenology. 138, 94-101. Coleman, Helen Turnbull Waite Coleman, 2005. Adamts-7 degrades comp in a Zn2+-and pH-dependent manner and is significantly upregulated in the cartilage and synovium of patients with rheumatoid arthritis. Osteoarthritis and Cartilage. 13(1), 42-43. Cui Y, Yan HL, Wang K, Xu H, Zhang XL, Zhu HJ, Liu JW, Qu L, Lan XY, Pan CY, 2018. Insertion/Deletion within the KDM6A gene is significantly associated with litter size in goat. Front Genet. 9, 91. Du W, Wang S, Zhou Q, Li X, Chu J, Chang Z, Tao Q, Ng EK, Fang J, Sung JJ, Yu J, 2013. ADAMTS9 is a functional tumor suppressor through inhibiting AKT/mTOR pathway and associated with poor survival in gastric cancer. Oncogene. 32(28), 3319-3328. González-Cerón F, Rekaya R, Aggrey SE, 2015. Genetic analysis of bone quality traits and growth in a random mating broiler population. Poult Sci. 94(5), 883-889. Hu L, Jonsson KB, Andersén H, Edenro A, Bohlooly-Y M, Melhus H, Lind T, 2012. Over-expression of Adamts1 in mice alters bone mineral density. J

ro of

Bone Miner Metab. 30(3), 304-311.

Huo Z, Luo X, Zhan X, Chu Q, Xu Q, Yao J, Pang H, 2017. Genetic analysis of indel markers in three loci associated with Parkinson's disease. PLoS One. 12(9), e0184269.

Indrikis K, Giedrius T, Sanita K, Didzis E, Ronalds K, Severi L, Markus JR, Marika M, Aare K, Jukka K, Priit J, Raine K, Tatjana K, 2018. Linking organismal growth, coping styles, stress reactivity, and metabolism via responses against a selective serotonin reuptake inhibitor in an insect.

-p

Scientific Reports. 8, 8599.

Ines D, Hannah LF, Dylan RE, Grant NW, 2018. ADAMTS9, a member of the ADAMTS family, in Xenopus development. Gene Expression Patterns.

re

29, 72-81.

Jiang QR, Debele GD, Gu KT, Du C, Ma L, Wu P, Wang JP, Bu DP, 2019. Effects of diets with low energy level and rumen-protected lysine supplementation for perinatal period on colostrum quality, growth performance of pre-weaning calves. Chinese Journal of Animal Nutrition. 31(7).

lP

Jiang RR, Tian YD, Kang XT, Li ZJ, 2019. Two indels mutation in the promoter region of the QPCTL gene is significantly associated with body weight and carcass traits in chickens. Animal genetic. 50(3), 279-282.

Jin Y, Yang Q, Gao J, Tang Q, Duan B, Yu T, Qi X, Liu J, Wang R, Dang R, Lei C, Chen H, Lan X, 2018. Detection of insertions/deletions within SIRT1, SIRT2 and SIRT3 genes and their associations with body measurement traits in cattle. Biochem Genet. 56(6), 663-676.

na

Kanae K, Keiichiro N, Ryusuke M, Yuichiro Y, Satoshi H, Kadir D, Ichiro N, Yoshifumi N, Aiji O, 2008. Expression of ADAMTS-9 in mouse growth plate cartilage. Matrix Biology. 27(1), 24-25.

Kang Z, Zhang S, He L, Zhu H, Wang Z, Yan H, Huang Y, Dang R, Lei C, Chen H,Qu L, Lan X, Pan C, 2019a. A 14-bp functional deletion within the

ur

CMTM2 gene is significantly associated with litter size in goat. Theriogenology. 139, 49-57. Kang Z, Jiang E, Wang K, Pan C, Chen H, Yan H, Zhu H, Liu J, Qu L, Lan X, 2019b. Goat membrane associated ring-CH-type finger 1 (MARCH1)

Jo

mRNA expression and association with litter size. Theriogenology. 128, 8-16. Katherine A. Jungers, Carine Le Goff, Robert P.T. Somerville, Suneel S. Apte, 2005. ADAMTS9 is widely expressed during mouse embryo development. Gene Expression Patterns. 5, 609-617.

Kelwick R, Wagstaff L, Decock J, Roghi C, Cooley LS, Robinson SD, Arnold H, Gavrilović J, Jaworski DM, Yamamoto K, Nagase H, Seubert B, Krüger A, Edwards DR, 2015. Metalloproteinase-dependent and -independent processes contribute to inhibition of breast cancer cell migration, angiogenesis and liver metastasis by a disintegrin and metalloproteinase with thrombospondin motifs-15. Int J Cancer. 136(4), 14-26. Lan XY, Pan CY, Chen H, Zhang CL, Li JY, Zhao M, Lei CZ, Zhang AL, Zhang L, 2007. An AluI PCR-RFLP detecting a silent allele at the goat POU1F1 locus and its association with production traits. Small Ruminant Research. 73, 8-12. Lande R, Thompson R, 1990. Efficiency of marker-assisted selection in the improvement of quantitative traits. Genetics. 24(3), 743-756.

Li J, Erdenee S, Zhang S, Wei Z, Zhang M, Jin Y, Wu H, Chen H, Sun X, Xu H, Cai Y, Lan X, 2018a. Genetic effects of PRNP gene insertion/deletion (indel) on phenotypic traits in sheep. Prion 12(1), 42-53. Li WY, Liu DL, Tang SQ, Tian XX, Han RL, TianYD, Li H,Li GX, Li WT, Liu XJ, Kang XT, Li ZJ, 2018b. A multiallelic indel in the promoter region of the Cyclin-dependent kinase inhibitor 3 gene is significantly associated with body weight and carcass traits in chickens. Poultry science DOI: 10.3382/ps/pey404. Li Z, Zhang Z, He Z, Tang W, Li T, Zeng Z, He L, Shi Y, 2009. A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHEsis (http://analysis.bio-x.cn). Cell Res. 19(4), 519-523. Nandadasa S, Nelson CM, Apte SS, 2015. ADAMTS9-mediated extracellular matrix dynamics regulates umbilical cord vascular smooth muscle differentiation and rotation. Cell Rep. 11(10), 1519-1528. Nei M., 1973. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci. 70, 3321–3323. Schnellmann R, Sack R, Hess D, Annis DS, Mosher DF, Apte SS, Chiquet-Ehrismann R, 2018. A selective extracellular matrix proteomics approach

ro of

identifies fibronectin proteolysis by A Disintegrin-like and Metalloprotease Domain with Thrombospondin Type 1 Motifs (ADAMTS16) and its impact on spheroid morphogenesis. Mol Cell Proteomics. 17(7), 1410-1425.

Shao B, Feng Y, Zhang H, Yu F, Li Q, Tan C, Xu H, Ying J, Li L, Yang D, Peng W, Tang J, Li S, Ren G, Tao Q, Xiang T, 2018. The 3p14.2 tumour suppressor ADAMTS9 is inactivated by promoter CpG methylation and inhibits tumour cell growth in breast cancer. J Cell Mol Med. 22(2), 12571271.

-p

Shaul O, 2017. How introns enhance gene expression. The International Journal of Biochemistry & Cell Biology. 91, 145-155.

Shen W, Li L, Pan QJ, Qin GQ, Geng SM, 2004. Genetic effect of the marker assisted selection on economic traits of goats. HEREDITAS. 26(5), 625-

re

630.

Sheng X, Bao Y, Zhang JS, Li M, Li YN, Xu QN, Zhang SH, Li CT, 2018. Research progress on indel genetic marker in forensic science. Fa Yi Xue Za Zhi. 34(4), 420-427.

lP

Sun K, Zhang SH, Zhu RX, Zhao SM, Li CT, 2013. Progress in InDel as a new generation of genetic marker. Fa Yi Xue Za Zhi. 29(2), 134-139, 143. Wang GZ, Chen SS, Chao TL, Ji ZB, Hou L, Qin ZJ, Wang JM, 2017a. Analysis of genetic diversity of Chinese dairy goats via microsatellite markers. J Anim Sci. 95(5), 2304-2313.

Wang K, Cui Y, Wang Z, Yan HL,Meng Z, Zhu HJ, Qu L, Lan XY, Pan CY, 2019. One 16 bp insertion/deletion (indel) within the KDM6A gene revealing

na

strong associations with growth traits in goat. Gene. 686, 16-20.

Wang Q, Hao R, Zhao X, Huang R, Zheng Z, Deng Y, Chen W, Du X, 2018. Identification of EGFR in pearl oyster (Pinctada fucata martensii) and correlation analysis of its expression and growth traits. Biosci Biotechnol Biochem. 82(7), 1073-1080.

ur

Wang X, Lian L, Zhao C, Deng X, Wu C, 2010. Nature identification of nontargeted bands accompanied with heterozygote in nondenatured polyacrylamide gel electrophoresis. Journal of Agricultural Biotechnology 18(3), 616-622.

Jo

Wang XY, Yang Q, Wang K, Zhang SH, Pan CY, Chen H, Qu L, Yan HL, Lan XY, 2017b. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim Genet. 48, 735-736.

Wang XY, Yang Q, Wang K, Yan HL, Pan CY, Chen H, Liu JW, Zhu HJ, Qu L, Lan XY, 2019. Two strongly linked single nucleotide polymorphisms (Q320P and V397I) in GDF9 gene are associated with litter size in cashmere goats. Theriogenology. 125, 115-121.

Wei JL, Fu W, Hettinghouse A, He WJ, Lipson KE, Liu CJ, 2018. Role of ADAMTS-12 in protecting against inflammatory arthritis in mice by interacting with and inactivating proinflammatory connective tissue growth facto. Arthritis & Rheumatology. 70(11), 1745-1756. Xu M, Zheng XM, Jiang F, Qiu WQ, 2018. MicroRNA-190b regulates lipid metabolism and insulin sensitivity by targeting IGF-1 and ADAMTS9 in non-alcoholic fatty liver disease. Journal of Cellular Biochemistry. 119(7), 5864-5874. Yang Q, Zhang SL, Li J, Wang XY, Peng K, Lan XY, Pan CY, 2019. Development of a touch-down multiplex PCR method for simultaneously rapidly

detecting three novel insertion/deletions (indels) within one gene: an example for goat GHR gene. Animal Biotechnology. 30(4), 366-371. Yang Q, Zhang S, Liu L, Cao X, Lei C, Qi X, Lin F, Qu W, Qi X, Liu J, Wang R, Chen H, Lan X, 2016. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene. Prion. 10(5), 409-419. Yang Q, Yan HL, Li J, Xu H, Wang K, Zhu HJ, Chen H, Qu L, Lan XY, 2017. A novel 14-bp duplicated deletion within goat GHR gene is significantly associated with growth traits and litter size. Anim Genet. 48, 499-500. Zhang XY, Wu XF, Jia WC, Pan CY, Li X, Lei CZ, Chen H, Lan XY, 2015. Novel nucleotide variations, haplotypes structure and associations with growth-related traits of goat at motif-binding factor (atbf1) gene. Asian Australas J Anim Sci. 28, 1394-1406. Zhao H, Wu XF, Cai HF, Pan CY, Lei CZ, Chen H, Lan XY, 2013. Genetic variants and effects on milk traits of the caprine paired-like homeodomain transcription factor 2 (PITX2) gene in dairy goat. Gene. 532, 203-210. Zhao W, Zhong T, Wang LJ, Li L, Zhang HP, 2014. Extensive female-mediated gene flow and low phylogeography among seventeen goat breeds in

Jo

ur

na

lP

re

-p

ro of

southwest China. Biochem Genet. 52, 355-364.

Table 1 PCR primer sequences of the goat ADAMTS9 gene for genotype detection. ID

Intron

P1-rs662574104 (P1-del.33-bp)

8

P2-rs639397062 (P2-del.22-bp)

37

P3-rs653192605 (P3-del.14-bp)

39

P4-rs663636275 (P4-del.14-bp)

19

P5-rs668212411 (P5-del.10-bp)

38

Primer sequences (5′–3′)

Amplifcation length (bp)

Predicted indel size (bp)

298/265

33

243/221

22

198/184

14

220/206

14

F: TTAGAATGTGGGGCAAAACGG R: GGATAAGAGATTGTGGAACTGGG F: AGGAGGGTTTTGAGCATCCG R: CTTTAGTGCGATCTCGGGCA F: TGGCCTGGAGATTCGAGTTTT R: GCAGATGAGCAGGAGACACA F: CTCAAACGCTTAGTTTTCCCCA

F: ATTACCTGGGAGCTTGTTGA

ro of

R: GTGTGTGTGGGCATTGTGG 196/186

Jo

ur

na

lP

re

-p

R: TTTGAGTGAATCTGGATGGG

10

Table 2 Genotypic and allelic frequencies and population indexes for ADAMTS9 gene in SBWC goats.

Loci

Sample Genotypic frequencies sizes II ID DD 0.937 0.061 (n = 564) (n = 37)

0.002 (n = 1)

P3 1006 (14-bp)

0.716 0.266 0.018 (n = 720) (n = 268) (n = 18)

Population parameters

I

D

Ho

He

Ne

PIC

P values

0.968

0.032

0.937

0.063

1.067

0.061

0.632

0.849

0.151

0.744

0.257

1.345

0.224

0.222

P (HWE)

Jo

ur

na

lP

re

-p

ro of

P2 602 (22-bp)

Allelic frequencies

Table 3 Least square means of growth traits for different genotypes of P2 (22-bp) and P3 (14-bp) loci within ADAMTS9 gene in SBWC goats (mean ± SE).

Loci

22-bp

14-bp

Growth

Genotypes

traits

II

ID

DD

CW(cm)

18.75B±0.16 (n = 541)

20.77A±0.63 (n = 37)

—

0.002

CCI(%)

155.32b±0.87 (n = 540)

163.09a±2.41 (n = 37)

—

0.022

CWI(%)

67.21B±0.458 (n = 539)

74.20A±1.68 (n = 37)

—

1.180E-04

HAH(cm)

61.35a±0.16 (n = 705)

60.55b±0.28 (n = 258)

60.82ab±1.05 (n = 14)

0.039

P values

ro of

Note: a or b within the same column with different superscripts indicate P < 0.05, while A or B indicate P < 0.01.

Jo

ur

na

lP

re

-p

CW, chest width; CCI, chest circumference index; CWI, chest width index; HAT, height across the hip.

Table 4 Least square means of growth traits for joint genotypes of P2 (22-bp) and P3 (14-bp) loci within ADAMTS9 gene in SBWC goats (mean ± SE). Growth

Joint genotypes (Frequencies)

traits

IP2IP2IP3IP3 (0.637)

IP2IP2IP3DP3 (0.270) IP2DP2IP3IP3 (0.053) IP2IP2DP3DP3 (0.029) IP2DP2IP3DP3 (0.011)

CW(cm)

18.80b±0.19 (n = 366)

18.73b±0.31 (n = 161)

20.29ab±0.64 (n = 31)

17.54b±0.99 (n = 14)

23.25a±1.81 (n = 6)

P ≤ 0.020

CC(cm)

89.51a±0.48 (n = 365)

89.44a±0.74 (n = 160)

91.81a±1.40 (n = 31)

81.63b±2.90 (n = 14)

94.00a±2.22 (n = 6)

P ≤ 0.015

CCI(%)

156.11b±1.03 (n = 366)

154.52b±1.68 (n = 160)

160.63ab±2.44 (n = 31)

142.43c±3.89 (n = 14)

175.81a±5.96 (n = 6)

P ≤ 0.047

CWI(%)

67.58b±0.55 (n = 364)

66.88b±0.85 (n = 161)

72.98a±1.53 (n = 31)

62.36b±2.86 (n = 14)

80.54a±6.50 (n = 6)

P ≤ 0.006

Jo

ur

na

lP

re

-p

ro of

P values

Jo

ur

na

lP

re

-p

ro of

Fig. 1 The electrophoresis map and sequencing map of goat ADAMTS9 gene P2 locus (22-bp indel) (Note: marker I, M).

Jo

ur

na

lP

re

-p

ro of

Fig. 2 The electrophoresis map and sequencing map of goat ADAMTS9 gene P3 locus (14-bp indel) (Note: marker I, M).

Jo

ur

na

lP

re

-p

ro of

Fig. 3 Linkage disequilibrium (LD) plot of P2 (22-bp indel) and P3 (14-bp indel). (A) D’ = 0.974; (B) r2 = 0.007.