Polymorphism of the growth hormone gene and its association with growth traits in Boer goat bucks

Meat Science 81 (2009) 391–395

Contents lists available at ScienceDirect

Meat Science journal homepage: www.elsevier.com/locate/meatsci

Polymorphism of the growth hormone gene and its association with growth traits in Boer goat bucks G.H. Hua a, S.L. Chen a, J.N. Yu a, K.L. Cai a, C.J. Wu a, Q.L. Li a, C.Y. Zhang a, A.X. Liang a, L. Han a, L.Y. Geng a, Z. Shen b, D.Q. Xu b, L.G. Yang a,* a

College of Animal Science and Technology, Key Laboratory under Education Ministry of China for Agricultural Animal Genetics, Breeding, and Reproduction, Huazhong Agricultural University, Shizi Street, Wuhan, Hubei 430070, China b Boer Goat Breeding Farm, Animal Husbandry Bureau of Hubei Province, Wuhan, Hubei 430070, China

a r t i c l e

i n f o

Article history: Received 5 June 2008 Received in revised form 26 August 2008 Accepted 29 August 2008

Keywords: Boer goat Growth hormone Growth PCR–RFLP Polymorphism

a b s t r a c t In the present study, the polymorphism of growth hormone (GH) gene was analyzed as a genetic marker candidate for growth traits in Boer goat bucks. Two single nucleotide polymorphisms (SNPs) – A781G (Ser/Gly35) and A1575G (Leu147), were identified by GH gene sequencing and PCR–RFLP (polymerase chain reaction–restriction fragment length polymorphism) analysis. AA genotype resulted in a significant decrease in birth chest girth (P = 0.03) and weaning weight (P = 0.014) comparing to AB genotype, while CC genotype contributed to weaning height (P = 0.04) greater than CD genotype. When in combination, AACD genotype was undesired for lower scores in a series of growth traits including body weight, length, height, and chest girth at birth and weaning, as well as the pre-weaning daily gain and body weight at age of 11 months. These results indicate that new molecular markers associated with caprine growth traits can be used in MAS (marker-assisted selection) in Boer goat bucks. Ó 2008 Elsevier Ltd. All rights reserved.

1. Introduction In animal industry, growth traits of animal are always of primary concern during breeding for its determinant economical value (Zhang, Shen, & Yang, 2008). The birth cohort studies and growth traits are all subject to significant confounding by genetics, gestation, litter size, sex and environmental variables. With the development of molecular biology and biotechnology, scientists are able to achieve more accurate and efficient selection goal by marker-assisted selection (MAS). Especially for the goat, a special polytocous species with limited litter size, MAS plays much more important role than other polytocous species such as swine in selection program due to the fact that the growth is greatly associated with litter size. In general, fishing out and validating the genetic markers of growth traits is the initial and crucial step to establish a MAS system (Allan et al., 2007). Growth hormone (GH) is an anabolic hormone synthesized and secreted by the somatotroph cells of the anterior lobe of the pituitary in a circadian and pulsatile manner (Ayuk & Sheppard, 2006), the pattern of which plays an important role in postnatal longitudinal growth and development, tissue growth, lactation, reproduction, as well as protein, lipid, and carbohydrate metabolism (Akers, 2006; Ayuk & Sheppard, 2006; McMahon, Radcliff, Lookinqland, & * Corresponding author. Tel./fax: +86 027 87281813. E-mail address: [email protected] (L.G. Yang). 0309-1740/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.meatsci.2008.08.015

Tucker, 2001; Ohlsson, Bengtsson, Isaksson, Andreassen, & Slootweg, 1998; ThidarMyint et al., 2008). Effects of GH on growth are observed in several tissues, including bone, muscle and adipose tissue. Besides, a lot of studies carried out in ruminants confirm a role of GH in regulation of mammary growth (Akers, 2006; Sejrsen, Purup, Vestergaard, & Foldager, 2000; Sejrsen, Purup, Vestergaard, Weber, & Knight, 1999). GH gene, with its functional and positional potential, has been widely used for marker in several livestock species, including the cattle (i.e., Bos taurus and Bos indicus) (Beauchemin, Thomas, Franke, & Silver, 2006; Dybus, 2002; Falaki et al., 1996, 1997; Ge, Davis, Hines, Irvin, & Simmen, 2003; Katoh, Kouno, Okazaki, Suzuki, & Obara, 2008; Khatami, Lazebnyi, Maksimenko, & Sulimova, 2005; Lagziel, Lipkin, Ezra, Soller, & Weller, 1999; Lagziel, Lipkin, & Soller, 1996; Lee et al., 1996; Lucy et al., 1993; Pereira, de Alencar, de Oliveira, & de Regitano, 2005; Sabour, Lin, Lee, & McAllister, 1996; Sabour, Lin, & Smtth, 1997; Sneyers et al., 1994; Sodhi et al., 2007; Thomas, Silver, & Enns, 2006; Thomas et al., 2007; Yao, Aggerey, Zadworny, Hayes, & Kuhnlein, 1996; Zhou et al., 2005), the sheep (Ovis aries) (Marques et al., 2006), and the goat (Capra hirus) (Boutinaud, Rousseau, Keisler, & Jammes, 2003; Malveiro et al., 2001). However, studies about the associations of GH polymorphisms with growth traits are mainly carried out in the cattle. It has been reported that the restriction fragment length polymorphisms (RFLPs) of GH-TaqI were associated with body weight at 7 and 13 months of age in Belgian White Blue bulls (Sneyers et al.,

392

G.H. Hua et al. / Meat Science 81 (2009) 391–395

1994). Significant effects were found for bGH genotype on yearling weight, with positive effects associated with the LV (leucine/valine) genotype in the Canchim beef cattle (5/8 Charolais + 3/8 Zebu) (Pereira, de Alencar, de Oliveira, & de Regitano, 2005). Furthermore, Brangus (i.e., 3/8 Brahman vs. 5/8 Angus composite) bulls with a heterozygous GH-MspI RFLP genotype had greater average daily gain and carcass ultrasound measures than homozygous genotypes (Thomas et al., 2006). In goats, studies mainly focus on correlations between the GH single strand conformation polymorphism (SSCP) and the milk production traits. For example, Malveiro et al. (2001) reported that two of goat GH (gGH) SSCP patterns (GH2-N and GH2-Z) were positively associated with milk production in the 108 goats of Portuguese Algarvia breed. The evaluation of an association effect between the SSCP patterns of gGH with milk, fat and protein yields and fat and protein percentages suggests a positive effect of pattern A/B of exon 4 and of pattern A/B of exon 2 with milk yield and of pattern A/B of exon 1 and pattern B/B of exon 2 with protein percentage (Boutinaud et al., 2003). To our knowledge, few reports focused on the MAS of the caprine growth traits. Some researchers detected 5 substitution mutations in the 50 region of GH by PCR–SSCP and found that AA genotype had significantly higher weight at birth and yearling, compared to BB and AB genotype in 50 Boer goats (P < 0.05) (Min, Li, Sun, Pan, & Chen, 2005), and other researchers detected 7 SNPs in gGH exon 4 and 5 in Black Bengal goat without association analyses (Gupta et al. (2007). Moreover, the results in other species cannot work equally in the goat, for example, the polymorphism of ovine fecundity major genes FecB and FecX was not tested in the caprine (Hua, Chen, Ai, & Yang, 2007). Hence, it is necessary to find more useful genetic markers in growth traits in Boer goats for genetic improvement of the goat. The Boer goat is a meat purpose breed well known for its rapid growth, excellent meat quality, great adaption, and exceptional resistance to diseases, high non-seasonal fertility and kidding percentage (Greyling, 2000; Malan, 2000). Because of the widespread use of artificial insemination (AI) techniques in caprine reproduction industry, the bucks are used widely as sires in crossbreeding to improve the performance of indigenous breeds of the goats in China. Therefore, as part of the MAS program aimed at improving growth traits in bucks of the Boer goat, we have identified polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) at the exons 2 and 4 of gGH. The objective of this study was to establish an association of genotypes with parts of growth traits such as body weight and size at birth, weaning and age of 11 months in Boer goat bucks. 2. Materials and methods 2.1. Experimental goat flocks and sampling All procedures involving animals were approved by the Animal Care and Use Committee of Huazhong Agricultural University. A total of 154 Boer goat bucks were examined in this study, which were obtained from the Boer Goat Breeding Farm in Hubei Province, China. The traits evaluated including the body weight, body length, body height, chest girth at birth and weaning (80-day after birth), pre-weaning daily gain and the body weight at 11 months of age. Approximate 10 ml blood per goat was collected aseptically from the jugular vein and kept in a tube containing anticoagulant EDTA (Ethylenediaminetetraacetic acid). All samples were delivered back to the laboratory in an ice box. The genomic DNA was extracted from white blood cells using standard phenol-chloroform extraction protocol (Joseph & David, 2002). The DNA samples were dissolved in TE buffer which was made from 10 mM Tris–Cl (pH 7.5) and 1 mM EDTA (pH 8.0) and were stored at 20 °C for use.

2.2. Primer synthesis and PCR–RFLP reactions The primers (AuGCT, Beijing, China) were designed on the basis of DNA sequence of the gGH (Accession: D00476) using the oligonucleotide design tool Primer 5.0 software (Table 1). Both PCR reactions were performed in a 20 ll mixture containing 10 pmol primers, 200 lM dNTP (deoxyribonucleotide triphosphate), 2 ll 10  reaction buffer which contained 1.5 mM MgCl2, 1 unit of Taq-DNA polymerase (Promega, Madison, WI), and 50 ng genomic DNA as template. Touch-down PCR method was used to optimize the reaction accuracy: 94 °C for 5 min, 35 cycles of 95 °C for 30 s, touchdown annealing from 65 °C to 52 °C for 30 s (1 °C per cycle), 72 °C for 45 s, and a final extension at 72 °C for 7 min. PCR products were electrophoretically separated on 2% agarose gel (5 V/cm), stained with ethidium bromide and excised for sequencing (AuGCT, Beijing, China). RFLP analysis was conducted to detect polymorphism sites. The PCR amplicons were digested with HaeIII restriction endonuclease (TaKaRa, Tokyo, Japan) and electrophoretically separated. The 422 bp fragments were visualized through ethidium bromide staining in 2% of agarose gel. The 116 bp amplicons were detected by 12% PAGE (polyacrylamide gel electrophoresis) and subsequent silver staining. 2.3. Statistical analysis Associations of the animal genotypes with growth traits were calculated by analyzing variance of quantitative traits, which included the body weight, body length, body height, and chest girth at birth and weaning, as well as the pre-weaning daily gain and body weight at 11 months of age, using General Linear Model of SAS (SAS Inst. Inc., Cary, NC.). The model showed as follows:

Y ijk ¼ l þ Gi þ Lj þ Nk þ eijks where yijk was phenotypic value of traits; l was the population mean; Gi was fixed effect of genotype; Lj was fixed effect of contemporary group; Nk was fixed effect of year; eijks was random residual error. The Bonferroni test is used for multiple testing. 3. Result 3.1. Genotypes and haplotypes diversities Two regions of the GH gene were amplified from caprine genomic DNA as expected (Fig. 1). Two SNPs located in exons 2 (A781G) and 4 (A1575G) were identified by sequencing directly. The sequence has been accepted by the Genebank (Accession: EU048226). The transition of A781G caused an amino acid change from Ser to Gly at the residue 35, while the other substitution A1575G did not change the coding potential. However, both polymorphisms destroyed the restriction site recognized by endonuclease HaeIII. The following DNA restriction fragments were generated by the GH-Hae polymorphisms: 366 and 56 bp for AA genotype, 422, 366 and 56 bp for AB genotype (Fig. 2); 88 and 28 bp for CC genotype, 116, 88 and 28 bp

Table 1 The name and sequence of the growth hormone gene (GH) primers and their PCR product size and amplified region Primer name

Primer sequence

Product size

Amplified region

GH1F GH1R GH2F GH2R

CTCTGCCTGCCCTGGACT GGAGAAGCAGAAGGCAACC TCAGCAGAGTCTTCACCAAC CAACAACGCCATCCTCAC

422 bp

Exons 2 and 3

116 bp

Exon 4

393

G.H. Hua et al. / Meat Science 81 (2009) 391–395

Fig. 1. Electrophoretic profile for the GH fragments amplified by PCR in a 2% (w/v) (5 V/cm) agarose gel. A strand with 422 bp (Lanes 1 to 4) or 116 bp (Lanes 5 to 8) appeared to represent amplicons using primer GHF1/GHR1 or GHF2/GHR2 respectively. M represented a marker with 100 bp DNA ladder (1500 bp, 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp).

Fig. 3. Representative genotyping of GH gene at locus A1575G by polyacrylamide gel electrophoresis. Strands with 88 bp for CC genotype, 116 and 88 bp for CD genotype appeared at this locus. M represented a marker with pBR322 DNA/MspI (622 bp, 527 bp, 404 bp, 309 bp, 242 bp, 238 bp, 217 bp, 201 bp, 190 bp, 180 bp, 160 bp, 147 bp, 123 bp, 110 bp, 90 bp, 76 bp, 67 bp, 34 bp, 26 bp, 15 bp, 9 bp) (TaKaRa, Tokyo, Japan). The small fragments of 28 bp were invisible in the gel.

for CD genotype (Fig. 3). At A781G locus, 129 bucks were heterozygous (AB) and 25 bucks were homozygous (AA) but no homozygous (BB) individuals were found. At A1575G locus, 22 bucks were heterozygous (CD) and 132 bucks were homozygous (CC) but no homozygous (DD) individuals were found (Table 2).

Table 2 The allelic and genotypic frequencies, combined genotypic and haplotypic frequencies for sequence polymorphisms in the growth hormone gene (GH) in Boer bucks

3.2. Association of genotypes with growth traits

A1575G

In the tested Boer goat population, goats with AB genotype weighed about 2 kg heavier than those with AA genotype at weaning, and measured about 1.4 cm greater than those with AA genotype in chest girth at birth (P < 0.05). Moreover, there was a tendency that AB genotype individuals had better performance in other aspects such as body weight and size at birth and growth rate than AA genotype although no significant differences appeared (P > 0.05). Besides, CD genotype animals measured about 2.3 cm smaller than CC genotype individuals in height at weaning (P < 0.05), and the tendency that CD genotype animals had worse performance in other aspects existed although no statistic differences (P > 0.05) presented (Table 3). The combined genotype analyses of loci A781G and A1575G showed that AACD genotype was remarkably associated with lower birth weight, length, height, chest girth, weaning weight, preweaning daily gain and body weight at age of 11 months than ABCD genotype (P < 0.05), with lower body length, height and chest girth at weaning than the AACC genotype (P < 0.05). No significant differences of association with growth traits appeared between other genotypes (P > 0.05, Table 4). 4. Discussion 4.1. The absence of certain genotype In this research, GH polymorphisms in 154 Boer goat bucks were mapped down to loci A781G and A1575G. Nevertheless, neither BB nor DD homozygote genotype was observed in this study. The A781G polymorphism was also detected in other flocks such as

Fig. 2. Representative genotyping of GH gene at locus A781G by agarous gel electrophoresis. Strands with 366 for AA genotype, 422 and 366 for AB genotype appeared at this locus. M represented a marker with 100 bp DNA ladder (1500 bp, 1,000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp). The 56 bp fragments were invisible in the gel.

Locus

Genotype

Genotype frequency

Allele/haplotypic frequency

A781G

AA(25) AB(129) CC(132) CD(22) AACC(15) ABCC(117) AACD(10) ABCD(12)

0.1623 0.8377 0.8571 0.1429 0.0974 0.7597 0.0649 0.0844

A 0.5812 B 0.4188 C 0.9286 D 0.0714 AC 0.5101 BC 0.4161 AD 0.0738 BD 0

Haplotype

Figures in brackets mean the number of goats.

LuBei white goat (n = 50), Boer goat (n = 79), the first filial generation of LuBei white and Boer goat (n = 105), Chengdu-Ma goat (n = 37) by Hae-RFLPs (Bai, Wang, & Yin, 2005; Li et al., 2004). Consistent with our research, the result showed that GH gene at Hae site had polymorphisms in seven flocks and presented none genotype BB. In the present and previous study, the BB genotype was absent in both purebreds and crossbreeds in 536 individuals of the goat as mentioned above. Due to important roles of GH in the oocyte maturation and embryo development (Kiapekou et al., 2005; Papadopoulou et al., 2006; Rajesh, Yong, Zhu, Chia, & Yu, 2007), it is an interesting phenomenon worth of further investigation on mutations that influence growth variation. 4.2. Effects of GH genotypes on the growth traits in Boer goat The growth traits are complex quantitative traits involving multiple genes, loci and interactions. Till now, more than 10 variants of the gGH have been detected (Bai et al., 2005; Boutinaud et al., 2003; Gupta et al., 2007; Li et al., 2004; Malveiro et al., 2001; Min et al., 2005). Some of them focused on the milk production traits (Boutinaud et al., 2003; Malveiro et al., 2001). Some studies described only the polymorphism, not the association analyses (Bai et al., 2005; Gupta et al., 2007; Li et al., 2004). This study was designed as the first step in detecting genetic markers for growth performance of Boer goat bucks, which would eventually provide useful information for the MAS program. In the present study, we assessed the association between different GH genotypes and growth traits including the body weight, body length, body height, and chest girth at birth and weaning, pre-weaning daily gain and body weight at 11 months of age of Boer goat bucks. The effects of different genotypes were estimated. The quantified results showed that GH is an important growth-regulating gene in goats. Analyses of single SNP indicated that two sites have varied effects on growth traits. However, when in combination, two SNPs displayed more profound impacts than in separation. If a combination of genotypes give us a goat with better economic values, this combination would be preferable above all the separate genotypes. The combined genotype AACD was associ-

394

G.H. Hua et al. / Meat Science 81 (2009) 391–395

Table 3 Effects of the growth hormone gene genotypes on body weight and size at birth and weaning, as well as the pre-weaning daily gain and body weight at 11 months of age in Boer goat bucks Growth trait

Birth weight (kg) Birth length (cm) Birth height (cm) Birth chest girth (cm) Weaning weight (kg) Weaning length (cm) Weaning height (cm) Weaning chest girth (cm) Pre-weaning gain/day (kg/day) 11-month weight (kg)

Locus A781G

Locus A1575G

Genotype AA

Genotype AB

P-value

Genotype CC

Genotype CD

P-value

3.99 ± 0.28 30.73 ± 1.07 31.69 ± 0.98 32.58 ± 1.10 14.45 ± 0.81 48.70 ± 0.56 47.53 ± 0.88 54.86 ± 1.48 0.13 ± 0.01 32.15 ± 1.63

4.17 ± 0.23 31.52 ± 0.93 32.48 ± 0.82 33.99 ± 0.92 16.40±0.38 49.08 ± 1.16 48.11 ± 0.42 55.31 ± 0.56 0.15 ± 0.01 33.94 ± 1.81

0.29 0.17 0.17 0.03 0.014 0.74 0.51 0.58 0.06 0.14

3.89 ± 0.08 31.46 ± 0.93 33.06 ± 0.34 34.94 ± 2.03 15.48 ± 0.47 48.85 ± 0.56 48.31 ± 0.38 54.30 ± 0.66 0.15 ± 0.01 33.91 ± 1.55

3.69 ± 0.18 31.51 ± 1.11 31.88 ± 0.73 31.22 ± 3.42 14.74 ± 1.01 48.07 ± 1.19 46.01 ± 0.88 53.81 ± 1.41 0.14 ± 0.01 33.18 ± 1.76

0.29 0.94 0.12 0.25 0.47 0.52 0.04 0.73 0.33 0.56

The data are expressed as least square means ± standard errors.

Table 4 Effects of the GH gene combined genotypes on body weight and size at birth and weaning, as well as the pre-weaning daily gain and body weight at 11 months of age of Boer bucks Growth traits

Birth weight (kg) Birth length (cm) Birth height (cm) Birth chest girth (cm) Weaning weight (kg) Weaning length (cm) Weaning height (cm) Weaning chest girth (cm) Pre-weaning gain/day (kg/day) 11-month weight (kg)

Combined genotype AACC

AACD

ABCC

ABCD

4.292 ± 0.303 ab 31.489 ± 1.153ab 32.950 ± 1.059a 33.454 ± 1.218ab 16.029 ± 1.183ab 51.231 ± 1.423a 49.244 ± 1.077a 56.733 ± 1.686a 0.151 ± 0.014ab 33.930 ± 2.560ab

3.643 ± 0.336b 29.923 ± 1.176b 29.638 ± 1.351b 31.516 ± 1.351b 11.777 ± 1.392b 46.016 ± 1.675 b 45.081 ± 1.267b 50.846 ± 1.984b 0.102 ± 0.016b 30.097 ± 2.688b

4.140 ± 0.230ab 32.416 ± 0.805ab 33.824 ± 0.925a 33.824 ± 0.925ab 15.432 ± 0.468ab 48.567 ± 0.561ab 48.141 ± 0.425ab 54.004 ± 0.665ab 0.151 ± 0.005a 33.841 ± 2.082ab

4.296 ± 0.291a 32.758 ± 1.041a 34.798 ± 1.197a 34.197 ± 1.034a 17.166 ± 1.277a 49.953 ± 1.537ab 47.814 ± 1.163ab 56.454 ± 1.820ab 0.171 ± 0.015a 35.821 ± 2.607a

The data are expressed as least square means ± standard errors. Within a row, means without a common letter differ at P < 0.05.

ated with poor birth condition and performance. Bucks with AACD genotype should be abandoned in the selection program for fastgrowth line. The real importance for breeding is the economical values of the different traits after all (Liefers, Veerkamp, Te Pas, Chilliard, & Van der Lende, 2005). This effect is probably due to allele interactions. Studies in some other livestock also documented combined genotypes with the similar effects. Thomas et al. (2007) reported that heterozygous genotypes for two GH polymorphisms appeared advantageous for traits of muscularity and adiposity in the cooperating breeding program. Two genotype combinations of three SNPs within the leptin gene were defined which had a good milk yield and fertility (Liefers et al., 2005). Acknowledgements This work was financially supported by the National High Technology Research and Development Program of China (863 Program) (No. 2007AA10Z152), and Hubei Provincial Position Foundation for Creation in Agricultural Science and Technology (No. 2007-620). References Akers, R. M. (2006). Major advances associated with hormone and growth factor regulation of mammary growth and lactation in dairy cows. Journal of Dairy Science, 89(4), 1222–1234. Allan, M. F., Thallman, R. M., Cushman, R. A., Echternkamp, S. E., White, S. N., Kuehn, L. A., et al. (2007). Association of a single nucleotide polymorphism in SPP1 with growth traits and twinning in a cattle population selected for twinning rate. Journal of Animal Science, 85(2), 341–347. Ayuk, J., & Sheppard, M. C. (2006). Growth hormone and its disorders. Postgraduate Medical Journal, 82(963), 24–30. Bai, W. L., Wang, J., & Yin, R. Y. (2005). Study on genetic polymorphism of HaeIII site of GH gene in Chengdu-Ma goat and Boer goat. Heilongjiang Animal Science and Veterinary Medicine, 8, 13–14 (in Chinese, with English abstract).

Beauchemin, V. R., Thomas, M. G., Franke, D. E., & Silver, G. A. (2006). Evaluation of DNA polymorphisms involving growth hormone relative to growth and carcass characteristics in Brahman steers. Genetics and Molecular Research, 5(3), 438–447. Boutinaud, M., Rousseau, C., Keisler, D. H., & Jammes, H. (2003). Growth hormone and milking frequency act differently on goat mammary gland in late lactation. Journal of Dairy Science, 86(2), 509–520. Dybus, A. (2002). Associations between Leu/Val polymorphism of growth hormone gene and milk production traits in Black-and-White cattle. Archives of Animal Breeding, 45(5), 421–428. Falaki, M., Gengler, N., Sneyers, M., Prandi, A., Massart, S., Formigoni, A., et al. (1996). Relationships of polymorphism for growth hormone and growth hormone receptor genes with milk production traits for Italian Holstein–Friesian bulls. Journal of Dairy Science, 79(8), 1446–1453. Falaki, M., Prandi, A., Corradini, C., Snevers, M., Genqler, N., Massart, S., et al. (1997). Relationships of growth hormone gene and milk protein polymorphisms to milk production traits in Simmental cattle. Journal of Dairy Research, 64(1), 47– 56. Ge, W., Davis, M. E., Hines, H. C., Irvin, K. M., & Simmen, R. C. (2003). Association of single nucleotide polymorphism in the growth hormone and growth hormone receptor genes with blood serum insulin-like growth factor I concentration and growth traits in Angus cattle. Journal of Animal Science, 81(3), 641–648. Greyling, J. P. C. (2000). Reproduction traits in the Boer goat doe. Small Ruminant Research, 36(2), 171–177. Gupta, N., Ahlawat, S. P. S., Kumar, D., Gupta, S. C., Pandey, A., & Malik, G. (2007). Single nucleotide polymorphism in growth hormone gene exon-4 and exon-5 using PCR–SSCP in Black Bengal goats – A prolific meat breed of India. Meat Science, 76(4), 658–665. Hua, G. H., Chen, S. L., Ai, J. T., & Yang, L. G. (2007). None of polymorphism of ovine fecundity major genes FecB and FecX was tested in goat. Animal Reproduction Science. doi:10.1016/j.anireprosci.2007.08.013. Joseph, S., & David, W. R. (2002). In P. T. Huang, (Ed.), Molecular cloning a laboratory manual (3rd ed.) Beijing: Science Press. Katoh, K., Kouno, S., Okazaki, A., Suzuki, K., & Obara, Y. (2008). Interaction of GH polymorphism with body weight and endocrine functions in Japanese black calves. Domestic Animal Endocrinology, 34(1), 25–30. Khatami, S. R., Lazebnyi, O. E., Maksimenko, V. F., & Sulimova, G. E. (2005). Association of DNA polymorphisms of the growth hormone and prolactin genes with milk productivity in Yaroslavl and black-and-white cattle. Genetika, 41(2), 229–236. Kiapekou, E., Loutradis, D., Drakakis, P., Zapanti, E., Mastorakos, G., & Antsaklis, A. (2005). Effects of GH and IGF-I on the in vitro maturation of mouse oocytes. Hormones (Athens Greece), 4(3), 155–160.

G.H. Hua et al. / Meat Science 81 (2009) 391–395 Lagziel, A., Lipkin, E., Ezra, E., Soller, M., & Weller, J. I. (1999). An MspI polymorphism at the bovine growth hormone (bGH) gene is linked to a locus affecting milk protein percentage. Animal Genetics, 30(4), 296–299. Lagziel, A., Lipkin, E., & Soller, M. (1996). Association between SSCP haplotypes at the bovine growth hormone gene and milk protein percentage. Genetics, 142(3), 945–951. Lee, B. K., Lin, G. F., Crooker, B. A., Murtauqh, M. P., Hansen, L. B., & Chester-Jones, H. (1996). Association of somatotropin (bST) gene polymorphism at the 5th exon with selection for milk yield in Holstein cows. Domestic Animal Endocrinology, 13(4), 373–381. Li, M. Y., Pan, Q. H., Pan, Y. C., Shen, W., Min, L. J., & Ren, Z. Y. (2004). Polymorphism analysis of goat growth hormone (GH) gene by PCR-RFLP. Journal of Laiyang Agricultural Colleague, 21(1), 6–9 (in Chinese, with English abstract). Liefers, S. C., Veerkamp, R. F., Te Pas, M. F., Chilliard, Y., & Van der Lende, T. (2005). Genetics and physiology of leptin in periparturient dairy cows. Domestic Animal Endocrinology, 29(1), 227–238. Lucy, M. C., Hauser, S. D., Eppard, P. J., Krivi, G. G., Clark, J. H., Bauman, D. E., et al. (1993). Variants of somatotropin in cattle: Gene frequencies in major dairy breeds and associated milk production. Domestic Animal Endocrinology, 10(4), 325–333. Malan, S. W. (2000). The improved Boer goat. Small Ruminant Research, 36(2), 165–170. Malveiro, E., Pereira, M., Marques, P. X., Santos, I. C., Belo, C., Renaville, R., et al. (2001). Polymorphisms at the five exons of the growth hormone gene in the algarvia goat: Possible association with milk traits. Small Ruminant Research, 41(2), 163–170. Marques, Mdo. R., Santos, I. C., Carolino, N., Belo, C. C., Renaville, R., & Cravador, A. (2006). Effects of genetic polymorphisms at the growth hormone gene on milk yield in Serra da Estrela sheep. Journal of Dairy Research, 73(4), 394–405. McMahon, C. D., Radcliff, R. P., Lookinqland, K. J., & Tucker, H. A. (2001). Neuroregulation of growth hormone secretion in domestic animals. Domestic Animal Endocrinology, 20(2), 65–87. Min, L. J., Li, M. Y., Sun, G. Q., Pan, Q. J., & Chen, H. (2005). Relationship between polymorphism of growth hormone gene and production traits in goats. Yi Chuan Xue Bao, 32(6), 650–654 (in Chinese, with English abstract). Ohlsson, C., Bengtsson, B., Isaksson, O., Andreassen, T., & Slootweg, M. (1998). Growth hormone and bone. Endocrine Reviews, 19(1), 55–79. Papadopoulou, E., Sifakis, S., Giahnakis, E., Fragouli, Y., Karkavitsas, N., Koumantakis, E., et al. (2006). Increased human placental growth hormone at midtrimester pregnancies may be an index of intrauterine growth retardation related to preeclampsia. Growth Hormone and IGF Research, 16(5–6), 290–296. Pereira, A. P., de Alencar, M. M., de Oliveira, H. N., & de Regitano, L. C. (2005). Association of GH and IGF-1 polymorphisms with growth traits in a synthetic beef cattle breed. Genetics and Molecular Biology, 28(2), 230–236.

395

Rajesh, H., Yong, Y. Y., Zhu, M., Chia, D., & Yu, S. L. (2007). Growth hormone deficiency and supplementation at in-vitro fertilisation. Singapore Medical Journal, 48(6), 514–518. Sabour, M. P., Lin, C. Y., Lee, A. J., & McAllister, A. J. (1996). Association between milk protein genetic variants and genetic values of Canadian Holstein bulls for milk yield traits. Journal of Dairy Science, 79(6), 1050–1056. Sabour, M. P., Lin, C. Y., & Smtth, C. (1997). Association of genetic variants of bovine growth hormone with milk production traits in Holstein cattle. Journal of Animal Breeding and Genetics, 114, 435–442. Sejrsen, K., Purup, S., Vestergaard, M., & Foldager, J. (2000). High body weight gain and reduced bovine mammary growth: Physiological basis and implications for milk yield potential. Domestic Animal Endocrinology, 19(2), 93–104. Sejrsen, K., Purup, S., Vestergaard, M., Weber, M. S., & Knight, C. H. (1999). Growth hormone and mammary development. Domestic Animal Endocrinology, 17(2–3), 117–129. Sneyers, M., Renaville, R., Falaki, M., Massart, S., Devolder, A., Boonen, F., et al. (1994). TaqI restriction fragment length polymorphisms for growth hormone in bovine breeds and their association with quantitative traits. Growth Regulation, 4(3), 108–112. Sodhi, M., Mukesh, M., Prakash, B., Mishra, B. P., Sobti, R. C., Singh, K. P., et al. (2007). MspI allelic pattern of bovine growth hormone gene in Indian zebu cattle (Bos indicus) breeds. Biochemical Genetics, 45(1–2), 145–153. ThidarMyint, H., Yoshida, H., Ito, T., He, M., Inoue, H., & Kuwayama, H. (2008). Combined administration of ghrelin and GHRH synergistically stimulates GH release in Holstein preweaning calves. Domestic Animal Endocrinology, 34(1), 118–123. Thomas, M. G., Enns, R. M., Shirley, K. L., Garcia, M. D., Garrett, A. J., & Silver, G. A. (2007). Associations of DNA polymorphisms in growth hormone and its transcriptional regulators with growth and carcass traits in two populations of Brangus bulls. Genetics and Molecular Research, 6(1), 222–237. Thomas, M. G., Silver, G. A., & Enns, R. M. (2006). Relationships of DNA polymorphisms in growth hormone (GH) to growth and carcass traits observed in a population of Brangus bulls with a larger number of sires. International Plant and Animal Genome, XIV, 526. Yao, J., Aggerey, S. E., Zadworny, D., Hayes, J. E., & Kuhnlein, U. (1996). Sequence variations in the bovine growth hormone gene characterized by single strand conformation polymorphism (SSCP) analysis and their association with milk production traits in Holstein. Genetics, 144(4), 1809–1816. Zhang, C. Y., Shen, Z., & Yang, L. G. (2008). Variance components and Genetic parameters for weight and size at birth in the Boer Goat. Livestock Science, 115(1), 73–79. Zhou, G. L., Liu, H. G., Liu, C., Guo, S. L., Zhu, Q., & Wu, Y. H. (2005). Association of genetic polymorphism in GH gene with milk production traits in Beijing Holstein cows. Journal of Biosciences, 30(5), 595–598.