- Email: [email protected]
A TG-repeat polymorphism in the 5′-noncoding region of the goat growth hormone receptor gene and search for its association with milk production traits
Small Ruminant Research 67 (2007) 279–284
A TG-repeat polymorphism in the 5-noncoding region of the goat growth hormone receptor gene and search for its association with milk production traits Andrzej Maj ∗ , Małgorzata Korczak, Emilia Bagnicka, Lech Zwierzchowski, Mariusz Pierzchała Institute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrz˛ebiec, 05-552 W´olka Kosowska, Poland Received 30 June 2004; received in revised form 10 August 2005; accepted 25 November 2005 Available online 15 February 2006
Abstract A variable TG-repeat polymorphism was found in the goat growth hormone receptor (GHR) gene 5 -noncoding region. In total 235 goats belonging to two dairy breeds were genotyped, 10 alleles of the GHR gene were detected. The length of the repeat region variants (alleles) was from 305 to 346 bp. Among the 10 alleles identified, eight occurred in homozygous systems. The frequency of the homozygous genotypes was 0.25 for the Polish White Improved breed and 0.28 for the Polish Fawn Improved breed. The mean heterozygosity (H) and polymorphic content coefficients (PIC) at this locus were similar for both breeds. The association of the TG-repeat variants was studied with milk production traits in 157 goats using REML method with repeatability, multi-traits Animal Test-Day Model. No associations were found with dairy traits—milk yield and content of the major milk components (fat, protein, and lactose). Also, no effect was shown of the GHR genotype on the somatic cell count (SCC). © 2005 Elsevier B.V. All rights reserved. Keywords: Growth hormone receptor; Gene polymorphism; Microsatellites; Milk traits; Goat
1. Introduction The biological effects of growth hormone (GH) involve a variety of tissues and the metabolism of all nutrient classes: carbohydrates, lipids, proteins, and minerals. In farm ruminants, these coordinated changes in tissue metabolism alter nutrient partitioning and thus play a key role in increasing growth performance and milk yield (Etherton and Bauman, 1998). Therefore, there is a great interest in using growth hormone to improve production in farm animals. Moreover, the gene ∗ Corresponding author. Tel.: +48 22 756 17 11; fax: +48 22 756 16 99. E-mail address: [email protected] (A. Maj).
0921-4488/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.smallrumres.2005.11.007
encoding GH and other genes related to the so called “somatotropic axis” are considered promising candidate markers for selection purposes (Parmentier et al., 1999). Growth hormone actions on target cells depend on GH receptor (GHR) (Burton et al., 1994). GH binding to GHR causes its dimerization, activation of the GHR-associated JAK2 tyrosine kinase, and tyrosyl phosphorylation of both JAK2 and GHR (Zhu et al., 2001). These events activate a variety of signalling molecules, including MAP kinases, insulin receptor substrates, phosphatidylinositol 3 -phosphate kinase, diacylglycerol, protein kinase C, intracellular calcium, and STAT transcription factors. The GH receptor is a member of the cytokine/hematopoietin superfamily of receptors. The gene coding for
280
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
GHR of most mammalian species consists of nine exons (from 2 to 10) in the translated part and of a long 5 -noncoding region that includes several alternative untranslated exons, of which only exons 1A, 1B, and 1C have been studied in detail in bovine GHR gene (Jiang and Lucy, 2001). Distinct promoters regulate transcription from the alternative exons. The P1 promoter which regulates growth hormone receptor expression in liver, is associated with exon 1A in cattle and sheep (Jiang et al., 1999). From recent publications it is known that some productive traits of cattle, e.g. milk yield and composition are associated with polymorphism of the GHR gene (Aggrey et al., 1999; Falaki et al., 1996; Blott et al., 2003). Lucy et al. (1998) found a length polymorphism in a TG-repeat (microsatellite) in the P1 promoter located 86 bp upstream from the start site of exon 1A in the bovine GHR gene. They found that an 11-TG-repeat allele commonly occurred in Bos indicus cattle while alleles with 16–20 consecutive TGs are most common in taurine breeds. However, the shorter 11-TG-repeat allele can be found at low frequency among European cattle, e.g. in Aberdeen Angus. The goat GHR gene has not been investigated yet. The objective of this study was to search for polymorphic microsatellite repeats within the 5 -region of the goat GHR gene and to verify possible association between this putative polymorphism and productive traits.
2. Materials and methods 2.1. Animals Studies of the GHR gene TG-repeat polymorphism were conducted on 115 dairy Polish White Improved (PWI) and 120 Polish Fawn Improved (PFI) goats (does, bucks and kids). For studying associations between the GHR polymorphism and milk production traits data for 157 dairy goats being from 1st to 6th lactation were used. Goats of the PWI breed were mated with PWI and Saanen bucks, and goats of the PFI breed with PFI and Alpine bucks. The goats were maintained in three herds. The goats were kept in a loose barn with outside run (except winter). During the test period the animals were fed according to the INRA-system (Jarrige, 1988); water was available ad libitum. An authorized veterinarian collected blood samples from jugular vein to tubes containing K3 EDTA. DNA for GHR gene sequencing and genotyping was isolated from blood by the method of Kanai et al. (1994) and amplified by PCR.
2.2. Sequencing of the caprine GHR gene 5 -region Basing on the available sequences of the bovine (GenBank U15731) and ovine (O’Mahoney et al., 1994) GHR genes, and using the Primer3 software (www.genome.wi.mit.edu), primers were designed aimed at PCR amplification of overlapping fragments of the caprine GHR gene 5 -region (Table 1). Polymerase chain reactions were performed using a PCR-mix with: primers at 5.0 pmol/l, 1 U Taq polymerase (Polgen, Ł´od´z, Poland), 1 l Taq polymerase buffer, four dNTPs, each at a final concentration of 0.2 mM, 100 ng of genomic DNA, and H2 O up to 10 l. The number of cycles and temperature of annealing used for each pair of primers are given in Table 1. The yield and specificity of PCR products were evaluated after electrophoresis in 2% agarose gel (Gibco) stained with ethidium bromide. Then the PCR products were purified with GenElute PCR DNA Purification Kit (Sigma–Aldrich Corporation, St. Louis, MO, USA) and sequenced in an ABI 377 sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed using Sequencher (Gene Codes Corporation, Ann Arbor, MI, USA) software. 2.3. Analysis of GHR genotypes Primers GHR3 (labelled at 5 end with fluorescein dye C5) and GHR4 (Table 1) were used for the analysis of the TG-repeat (microsatellite) polymorphism. The PCR products were analysed after 5 min denaturing in a 50% formamide solution containing blue dextran. The fluorescent PCR products were separated in 6% denaturing polyacrylamide gels, using an ALFexpress DNA Sequencer (Amersham Biosciences Corporation, Piscataway, NJ, USA). In each lane 1 l of PCR products were resolved together with a size marker. After automated allele calling using the Allele Links 1.01 software (Amersham Biosciences), individual genotypes were checked by manual inspection before exporting the genotypes to Excel. 2.4. Analysis of milk composition The goats were milked twice a day. Milk samples were taken from each goat once a month during the whole lactation period. The milk yield and content of the major milk components – fat, protein, and lactose and also somatic cell count (SCC) – were collected. The daily milk yield was determined and the fat, protein and lactose content in milk samples were estimated in fresh milk using Milko Scan 104A/B (FOSS A/S, Hillerød,
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
281
Table 1 Sequences of primers and PCR conditions used in this study to amplify different fragments of the caprine GHR gene Pairs of primers
Primer sequences (5 –3 )
Position
Tann (◦ C)
Cycles
Size of PCR product (bp)
1
GHR1 GHR2
F: TGCGTGCACAGCAGCTCAACC R: GGAGGCTCACAAGGCTCAT
<1 692–710
65
33
743
2
GHR3 GHR4
F: CTGGCGTATGGTCTTTGTCA R: TGGTCTTGCTGCTTTCCTAT
625–644 918–937
58
34
313
3
GHR5 GHR6
F: GTGATTGGGAGGGAGGAAGAGA R: CAAGGAGGGAGGGAGGAATAAAG
853–874 >1269
68
33
456
Denmark). Somatic cells were counted by means of a Fossomatic apparatus (FOSS A/S). Somatic cell count and lactose concentration in milk were used as indicators of the health status of the udder.
to earlier studies on whole Polish active goat population (Bagnicka and Łukaszewicz, 1999). The following model was used: yijklmnop = μ + ai + pi + hsj + GMk + Pl + HYSm
2.5. Statistical calculations Altogether 2547 records about daily milk yield, fat, protein for 157 goats with 25 different TG-repeat genotypes and 1017 records about lactose content, and SCC for 52 goats with 20 different TG-repeat genotypes were used in statistical analysis. For calculations only GHR genotypes carried by more than three animals were considered. Eighty-eight goats were of the PWI and 69 of the PFI breed. The SCC values (expressed in thousands) were transformed to the natural logarithm scale (ln of SCC). Milk traits were investigated between 1999 and 2004 and each year constituted a different class of the year of kidding. Three seasons of kidding were established, with the first class covering kidding from November through February next year, the second one—in March, and the third class in the rest of a year. Three classes of parity were distinguished, with the third class comprising goats with more then two lactations (parity 3–6). The animals were also grouped according to litter size, with the 1st class comprising goats with a single kid and the 2nd with twins or triplets. The combined effect of herd, year and season of kidding was evaluated by dividing the animals into 27 classes for milk yield, fat and protein content and 15 classes for lactose content and SCC. Ninety-nine classes of test day for milk yield, fat and protein content and 55 classes for lactose content and SCC were distinguished. In order to determine the impact of the polymorphism of the GHR gene on the investigated traits the REML method was used with repeatability, multi-traits Animal Model based on test day information. The DMU program was used for computation (Madsen and Jansen, 2000). The basic effects in the model were chosen according
+ LSn + TDo + (Σbp DIMp )ijklmnop + β1 (x2 − x¯ )ijklmnop + eijklmnop where yijklmnop is the observed mean value of a trait, μ the overall mean, ai the random effect of animal, pi the random permanent environment of animal, hsj the random effect of herd-sire, GMk the fixed effect of genotype, Pl the fixed effect of parity, HYSm the fixed effect of herd-year-season of kidding, LSn the fixed effect of litter size, TDo the fixed effect of test day, (bp DIMp )ijklmnop the regressions on days between kidding and milking (DIM), standardized and converted to Legendre polynomials (LPs) the up to the fifth power of LPs (p = 1–5), β1 (x2 − x¯ )ijklmnop the regression on milk yield for fat, protein and lactose content and log (SCC), and eijklmnop is the random error. Legendre polynomials are commonly used for testday models (Kettungen et al., 2000). The effect of breed was not considered in the model because its impact was not significant on any of the investigated traits. The differences of the observed and expected frequencies of genotypes within breeds were tested using the Fisher’s exact test (Raymond and Rousset, 1995a,b) to confirm (or deny) that analysed populations were in Hardy–Weinberg equilibrium. Moreover, observed frequencies of alleles and genotypes between breeds were estimated using Fisher’s test with the null hypothesis that allelic and genotypic distribution is identical across populations. Calculation were performed using Genepop Version 3.4 (Raymond and Rousset, 1995a,b). Heterozygosity (H) was calculated according to a formula described by Nei (1978); polymorphism information content (PIC) was calculated according to a formula described by Botstein et al. (1980).
282
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
3. Results
Table 3 Number of records, means and standard deviations of investigated traits
Basing on the sequences of the bovine and ovine GHR genes available in the GenBank database, we designed three pairs of PCR primers enabling amplification of the 5 -region of the caprine GHR gene. Using these primers we amplified and then sequenced three overlapping fragments of the 5 -region. Altogether, these fragments were combined into a 1269-bp sequence which was deposited in the GenBank database under the accession no. AY358031. A (TG)14 -repeat was found within the caprine GHR gene 5 -noncoding region at position 828–855, starting 84 bp upstream from the putative transcription initiation site. This region corresponded roughly to promoter P1 preceding exon 1A in the bovine GHR gene. Moreover, a 317-bp long interspersed repetitive element (LINE-1) was identified at location 482 bp upstream from the transcription initiation site. Further analysis of the GHR gene 5 -region in 235 goats from two breeds (PWI and PFI) showed that the length of the TG-repeat differed between individuals. A total of 10 alleles of the GHR gene were detected in the two breeds, the length of the amplified fragment containing the variable TG-repeat ranging from 305 to 346 bp (Table 2). The frequency of the alleles varied between 0.01 and 0.48, allele 2 (313 bp) being the most frequent in both breeds. Among the 10 alleles identified, eight occurred in homozygous systems. The frequency of the homozygous genotypes was 0.25 for the PWI and 0.28 for the PFI breed. The mean heterozygosity (H) and polymorphic content (PIC) coefficients at this locus were similar for both breeds (Table 2).
Trait
N
Mean
S.D.
Daily milk yield (kg) Fat (%) Protein (%) Lactose (%) SCC (thousand) SCC (ln)
2547 2547 2547 1017 1017 1017
2.38 3.35 3.26 4.39 1756 6.76
1.04 1.10 0.81 0.32 2385 1.10
No significant difference between the expected and observed frequencies of genotypes was noted (Fig. 1). Differences in the genotype and allele frequencies were significant (P < 0.01) between the breeds. Codominant Mendelian inheritance of TG-repeat alleles was observed in two goat families (Fig. 2). Data about milk yield, fat and protein content derived from 157 does and about lactose content and SCC from 52 does were used for association studies. The number of observations, mean values, and standard deviations of the investigated traits are shown in Table 3. The average daily milk yield during lactation and the contents of milk components were rather high. A high variation was observed for milk yield. For fat content the variation was medium while for protein and lactose content it was low. The average somatic cell count and its variation were very high, indicating probably that some goats had problems with subclinical mastitis. No associations were found between TG-repeat length polymorphism and dairy traits – milk yield and content of the major milk components – fat, protein, and lactose (not shown). Also, no effect was shown of the GHR genotype on the somatic cell count (SCC).
Table 2 Allele frequencies in GHR gene and mean heterozygosity (H) and polymorphic content (PIC) in goats of two breeds, Fisher’s exact test of the null hypothesis that the allelic distribution is identical across populations Allele
Length of allele (bp)
Polish white improved (n = 115)a
Polish fawn improved (n = 120)a
Combined for two breeds (n = 235)a
1 2 3 4 5 6 7 8 9 10 Fisher’s exact test H PIC
305 313 320 327 331 333 336 338 341 346
0.07 0.48 0.03 0.11 0.02 0.08 0.10 0.04 0.01 0.06 P < 0.01 0.74 0.71
0.08 0.48 0.07 0.01 0.06 0.03 0.05 0.07 0.08 0.07
0.08 0.48 0.05 0.06 0.04 0.06 0.08 0.05 0.04 0.07
0.74 0.72
0.74 0.72
a
n: Number of animals tested.
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
283
Fig. 1. Observed and expected frequencies of TG-repeat (microsatellite) genotypes within the 5 -noncoding region of the goat GHR gene. Numerical symbols were used for the GHR genotypes; the numbers under abscissa represent symbols of alleles of the lengths showed in Table 2. Thus, “1/0” represent heterozygote with alleles 305 and 346 bp; “3/3” represents 320-bp homozygote, etc.
4. Discussion A TG-repeat occurs in homologous positions of the GHR gene 5 -noncoding region in most studied mammalian species—human (Pekhletsky et al., 1997), mouse (Menon et al., 1995), sheep (O’Mahoney et al., 1994), and cattle (Lucy et al., 1998). The repeat was found to be polymorphic in cattle (Lucy et al., 1998) and in the European bison (Bison bonasus; our unpublished data). The GT-repeat polymorphism in the P1 promoter of bovine GHR gene was first described by Lucy et al. (1998). Five alleles were found with variable TG-repeat
number. Later on, Hale et al. (2000) reported an association between the microsatellite marker and growth rates in Angus steers (weaning weight and carcass weight). The present study, performed on 235 goats from two breeds (Polish White Improved and Polish Fawn Improved) for the first time showed the presence of a variable TG-repeat within the caprine GHR gene 5 noncoding regions. The position of the microsatellite was roughly the same as in the bovine GHR gene—the P1 promoter preceding exon 1A. Ten alleles were found with the length of the amplified fragment ranging from
Fig. 2. Mendelian inheritance of GHR gene TG-repeat (microsatellite) alleles and genotypes in two families of goats.
284
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
305 to 346 bp (approximately 10–30 TG-repeats, respectively). Although microsatellites are most often considered to be neutral markers, recent evidence suggests that polyTG elements might have functional significance. They often adopt a left-handed double helical conformation of DNA called Z-DNA that may be important in mutagenesis, recombination, and control of gene expression (Majewski and Ott, 2000). The length of the GT-repeats has been shown to influence gene transcription rates of several human genes, including EGF receptor, matrix metalloproteinase-9, and type I collagen ␣2; in all the cases gene transcription rates were positively associated with the length of the GT-repeat (Hadjiyannakis et al., 2001). In this study, a novel short tandem repeat (STR) polymorphism was found within the 5 -noncoding region of the goat GHR gene. Also, for the first time the associations were studied between GHR gene polymorphism and goat production traits. However, our data showed that the GT-repeat polymorphism in the GHR gene has not effect on the goat dairy traits under study. Therefore, the TG-repeat polymorphism in P1 promoter of the goat GHR gene does not seem a useful marker for milk production traits. Acknowledgements This study was funded by the Ministry of Education and Science, Poland, grants PBZ-KBN-036/P06/12 and 3 P06D 02525 and the IGHZ project S.I.-1.2. References Aggrey, S.E., Yao, J., Sabour, M.P., Lin, C.Y., Zadworny, D., Hayes, J.F., Kunlein, U., 1999. Markers within the regulatory region of the growth hormone receptor gene and their association with milkrelated traits in Holsteins. J. Hered. 90, 148–151. Bagnicka, E., Łukaszewicz, M., 1999. Genetic and environmental variation of dairy traits in Polish goats. Anim. Sci. Pap. Rep. 17, 59–65. Blott, S., Kim, J.J., Moisio, S., Schmidt-Kuntzel, A., Cornet, A., Berzi, P., Cambisano, N., Ford, C., Grisart, B., Johnson, D., Karim, L., Simon, P., Snell, R., Spelman, R., Wong, J., Vilkki, J., Georges, M., Farnir, F., Coppieters, W., 2003. Molecular dissection of a quantitative trait locus. A phenylalanine-to-tyrosine substitution in the transmembrane domain of the bovine growth hormone receptor is associated with a major effect on milk yield and composition. Genetics 163, 253–266. Botstein, D., White, R.L., Skalnick, M.H., Davies, R.W., 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am. J. Hum. Genet. 32, 314–331. Burton, J.L., McBride, B.W., Block, E., Glimm, D.R., Kenelly, J.J., 1994. A review of bovine growth hormone. Can. J. Anim. Sci. 74, 167–201.
Etherton, T.D., Bauman, D.E., 1998. Biology of somatotropin in growth and lactation of domestic animals. Physiol. Rev. 78, 745–761. Falaki, M., Gengler, N., Sneyers, M., Prandi, A., Massart, S., Formigoni, A., Burny, A., Portetelle, D., Renaville, R., 1996. Relationships of polymorphisms for growth hormone and growth hormone receptor genes with milk production traits for Italian Holstein–Friesian bulls. J. Dairy Sci. 79, 1446–1453. Hadjiyannakis, S., Zheng, H., Hendy, G.N., Goodyer, C.G., 2001. GTrepeat polymorphism in the 5 -flanking region of the human growth hormone receptor gene. Mol. Cell. Probes 15, 239–242. Hale, C.S., Herring, W.O., Shibuya, H., Lucy, M.C., Lubahn, D.B., Keisler, D.H., Johnsson, G.S., 2000. Decreased growth in Angus steers with a short TG-microsatellite allele in the P1 promoter of the growth hormone receptor gene. J. Anim. Sci. 78, 2099–2104. Jarrige, R. (Ed.), 1988. Alimentation Des Bovins, Ovins and Caprins. INRA, Paris, p. 465. Jiang, H., Lucy, M.C., 2001. Variants of the 5 -untranslated region of the bovine growth hormone receptor mRNA: isolation, expression and effects on translational efficiency. Gene 265, 45–53. Jiang, H., Okamura, C.S., Lucy, M.C., 1999. Isolation and characterization of a novel promoter for the bovine growth hormone receptor gene. J. Biol. Chem. 274, 7893–7900. Kanai, N., Fujii, T., Saito, K., Yokoyama, T., 1994. Rapid and simple method for preparation of genomic DNA from easily obtained clotted blood. J. Clin. Pathol. 47, 1043–1044. Kettungen, A., M¨antysaari, E.A., P¨os¨o, J., 2000. Estimation of genetic parameters for daily milk yield of primiparous Ayrshire cows by random regression test-day models. Livest. Prod. Sci. 66, 251–261. Lucy, M.C., Johnsson, G.S., Shibuya, H., Boyd, C.K., Herring, W.O., Werin, M., 1998. Rapid communication: polymorphic (GT)n microsatellite in the bovine somatotropine receptor gene promoter. J. Anim. Sci. 76, 2209–2210. Madsen, P., Jansen, J., 2000. A user’s guide to DMU. A package for analysing multivariate mixed models. Version 6. Release 4. Majewski, J., Ott, J., 2000. GT-repeats are associated with recombination on human chromosome 22. Genome Res. 10, 1108– 1114. Menon, R.K., Stephan, D.A., Manbir, S., Morris, S.M., Zou, L., 1995. Cloning the promoter-regulatory region on the murine growth hormone receptor. J. Biol. Chem. 270, 8851–8859. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. O’Mahoney, J.V., Brandon, M.R., Adams, T.E., 1994. Identification of a liver-specific promoter for the ovine growth hormone receptor. Mol. Cell. Endocrinol. 101, 129–139. Parmentier, I., Portetelle, D., Gengler, N., Prandi, A., Bertozzi, C., Vleurick, L., Gilson, R., Renaville, R., 1999. Candidate gene markers associated with somatotropic axis and milk selection. Domest. Anim. Endocrinol. 17, 139–148. Pekhletsky, R.I., Chernov, B.K., Rubtsov, P.M., 1997. Variants of the 5 untranslated sequence of human growth hormone receptor mRNA. Mol. Cell. Endocrinol. 90, 103–109. Raymond, M., Rousset, F., 1995a. An exact test for population differentiation. Evolution 49, 1280–1283. Raymond, M., Rousset, F., 1995b. Genepop (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86, 248–249. Zhu, T., Goh, E.L.K., Graichen, R., Ling, L., Lobie, P.E., 2001. Signal transduction via the growth hormone receptor. Cell. Signal. 13, 599–616.
A TG-repeat polymorphism in the 5-noncoding region of the goat growth hormone receptor gene and search for its association with milk production traits Andrzej Maj ∗ , Małgorzata Korczak, Emilia Bagnicka, Lech Zwierzchowski, Mariusz Pierzchała Institute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrz˛ebiec, 05-552 W´olka Kosowska, Poland Received 30 June 2004; received in revised form 10 August 2005; accepted 25 November 2005 Available online 15 February 2006
Abstract A variable TG-repeat polymorphism was found in the goat growth hormone receptor (GHR) gene 5 -noncoding region. In total 235 goats belonging to two dairy breeds were genotyped, 10 alleles of the GHR gene were detected. The length of the repeat region variants (alleles) was from 305 to 346 bp. Among the 10 alleles identified, eight occurred in homozygous systems. The frequency of the homozygous genotypes was 0.25 for the Polish White Improved breed and 0.28 for the Polish Fawn Improved breed. The mean heterozygosity (H) and polymorphic content coefficients (PIC) at this locus were similar for both breeds. The association of the TG-repeat variants was studied with milk production traits in 157 goats using REML method with repeatability, multi-traits Animal Test-Day Model. No associations were found with dairy traits—milk yield and content of the major milk components (fat, protein, and lactose). Also, no effect was shown of the GHR genotype on the somatic cell count (SCC). © 2005 Elsevier B.V. All rights reserved. Keywords: Growth hormone receptor; Gene polymorphism; Microsatellites; Milk traits; Goat
1. Introduction The biological effects of growth hormone (GH) involve a variety of tissues and the metabolism of all nutrient classes: carbohydrates, lipids, proteins, and minerals. In farm ruminants, these coordinated changes in tissue metabolism alter nutrient partitioning and thus play a key role in increasing growth performance and milk yield (Etherton and Bauman, 1998). Therefore, there is a great interest in using growth hormone to improve production in farm animals. Moreover, the gene ∗ Corresponding author. Tel.: +48 22 756 17 11; fax: +48 22 756 16 99. E-mail address: [email protected] (A. Maj).
0921-4488/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.smallrumres.2005.11.007
encoding GH and other genes related to the so called “somatotropic axis” are considered promising candidate markers for selection purposes (Parmentier et al., 1999). Growth hormone actions on target cells depend on GH receptor (GHR) (Burton et al., 1994). GH binding to GHR causes its dimerization, activation of the GHR-associated JAK2 tyrosine kinase, and tyrosyl phosphorylation of both JAK2 and GHR (Zhu et al., 2001). These events activate a variety of signalling molecules, including MAP kinases, insulin receptor substrates, phosphatidylinositol 3 -phosphate kinase, diacylglycerol, protein kinase C, intracellular calcium, and STAT transcription factors. The GH receptor is a member of the cytokine/hematopoietin superfamily of receptors. The gene coding for
280
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
GHR of most mammalian species consists of nine exons (from 2 to 10) in the translated part and of a long 5 -noncoding region that includes several alternative untranslated exons, of which only exons 1A, 1B, and 1C have been studied in detail in bovine GHR gene (Jiang and Lucy, 2001). Distinct promoters regulate transcription from the alternative exons. The P1 promoter which regulates growth hormone receptor expression in liver, is associated with exon 1A in cattle and sheep (Jiang et al., 1999). From recent publications it is known that some productive traits of cattle, e.g. milk yield and composition are associated with polymorphism of the GHR gene (Aggrey et al., 1999; Falaki et al., 1996; Blott et al., 2003). Lucy et al. (1998) found a length polymorphism in a TG-repeat (microsatellite) in the P1 promoter located 86 bp upstream from the start site of exon 1A in the bovine GHR gene. They found that an 11-TG-repeat allele commonly occurred in Bos indicus cattle while alleles with 16–20 consecutive TGs are most common in taurine breeds. However, the shorter 11-TG-repeat allele can be found at low frequency among European cattle, e.g. in Aberdeen Angus. The goat GHR gene has not been investigated yet. The objective of this study was to search for polymorphic microsatellite repeats within the 5 -region of the goat GHR gene and to verify possible association between this putative polymorphism and productive traits.
2. Materials and methods 2.1. Animals Studies of the GHR gene TG-repeat polymorphism were conducted on 115 dairy Polish White Improved (PWI) and 120 Polish Fawn Improved (PFI) goats (does, bucks and kids). For studying associations between the GHR polymorphism and milk production traits data for 157 dairy goats being from 1st to 6th lactation were used. Goats of the PWI breed were mated with PWI and Saanen bucks, and goats of the PFI breed with PFI and Alpine bucks. The goats were maintained in three herds. The goats were kept in a loose barn with outside run (except winter). During the test period the animals were fed according to the INRA-system (Jarrige, 1988); water was available ad libitum. An authorized veterinarian collected blood samples from jugular vein to tubes containing K3 EDTA. DNA for GHR gene sequencing and genotyping was isolated from blood by the method of Kanai et al. (1994) and amplified by PCR.
2.2. Sequencing of the caprine GHR gene 5 -region Basing on the available sequences of the bovine (GenBank U15731) and ovine (O’Mahoney et al., 1994) GHR genes, and using the Primer3 software (www.genome.wi.mit.edu), primers were designed aimed at PCR amplification of overlapping fragments of the caprine GHR gene 5 -region (Table 1). Polymerase chain reactions were performed using a PCR-mix with: primers at 5.0 pmol/l, 1 U Taq polymerase (Polgen, Ł´od´z, Poland), 1 l Taq polymerase buffer, four dNTPs, each at a final concentration of 0.2 mM, 100 ng of genomic DNA, and H2 O up to 10 l. The number of cycles and temperature of annealing used for each pair of primers are given in Table 1. The yield and specificity of PCR products were evaluated after electrophoresis in 2% agarose gel (Gibco) stained with ethidium bromide. Then the PCR products were purified with GenElute PCR DNA Purification Kit (Sigma–Aldrich Corporation, St. Louis, MO, USA) and sequenced in an ABI 377 sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were analysed using Sequencher (Gene Codes Corporation, Ann Arbor, MI, USA) software. 2.3. Analysis of GHR genotypes Primers GHR3 (labelled at 5 end with fluorescein dye C5) and GHR4 (Table 1) were used for the analysis of the TG-repeat (microsatellite) polymorphism. The PCR products were analysed after 5 min denaturing in a 50% formamide solution containing blue dextran. The fluorescent PCR products were separated in 6% denaturing polyacrylamide gels, using an ALFexpress DNA Sequencer (Amersham Biosciences Corporation, Piscataway, NJ, USA). In each lane 1 l of PCR products were resolved together with a size marker. After automated allele calling using the Allele Links 1.01 software (Amersham Biosciences), individual genotypes were checked by manual inspection before exporting the genotypes to Excel. 2.4. Analysis of milk composition The goats were milked twice a day. Milk samples were taken from each goat once a month during the whole lactation period. The milk yield and content of the major milk components – fat, protein, and lactose and also somatic cell count (SCC) – were collected. The daily milk yield was determined and the fat, protein and lactose content in milk samples were estimated in fresh milk using Milko Scan 104A/B (FOSS A/S, Hillerød,
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
281
Table 1 Sequences of primers and PCR conditions used in this study to amplify different fragments of the caprine GHR gene Pairs of primers
Primer sequences (5 –3 )
Position
Tann (◦ C)
Cycles
Size of PCR product (bp)
1
GHR1 GHR2
F: TGCGTGCACAGCAGCTCAACC R: GGAGGCTCACAAGGCTCAT
<1 692–710
65
33
743
2
GHR3 GHR4
F: CTGGCGTATGGTCTTTGTCA R: TGGTCTTGCTGCTTTCCTAT
625–644 918–937
58
34
313
3
GHR5 GHR6
F: GTGATTGGGAGGGAGGAAGAGA R: CAAGGAGGGAGGGAGGAATAAAG
853–874 >1269
68
33
456
Denmark). Somatic cells were counted by means of a Fossomatic apparatus (FOSS A/S). Somatic cell count and lactose concentration in milk were used as indicators of the health status of the udder.
to earlier studies on whole Polish active goat population (Bagnicka and Łukaszewicz, 1999). The following model was used: yijklmnop = μ + ai + pi + hsj + GMk + Pl + HYSm
2.5. Statistical calculations Altogether 2547 records about daily milk yield, fat, protein for 157 goats with 25 different TG-repeat genotypes and 1017 records about lactose content, and SCC for 52 goats with 20 different TG-repeat genotypes were used in statistical analysis. For calculations only GHR genotypes carried by more than three animals were considered. Eighty-eight goats were of the PWI and 69 of the PFI breed. The SCC values (expressed in thousands) were transformed to the natural logarithm scale (ln of SCC). Milk traits were investigated between 1999 and 2004 and each year constituted a different class of the year of kidding. Three seasons of kidding were established, with the first class covering kidding from November through February next year, the second one—in March, and the third class in the rest of a year. Three classes of parity were distinguished, with the third class comprising goats with more then two lactations (parity 3–6). The animals were also grouped according to litter size, with the 1st class comprising goats with a single kid and the 2nd with twins or triplets. The combined effect of herd, year and season of kidding was evaluated by dividing the animals into 27 classes for milk yield, fat and protein content and 15 classes for lactose content and SCC. Ninety-nine classes of test day for milk yield, fat and protein content and 55 classes for lactose content and SCC were distinguished. In order to determine the impact of the polymorphism of the GHR gene on the investigated traits the REML method was used with repeatability, multi-traits Animal Model based on test day information. The DMU program was used for computation (Madsen and Jansen, 2000). The basic effects in the model were chosen according
+ LSn + TDo + (Σbp DIMp )ijklmnop + β1 (x2 − x¯ )ijklmnop + eijklmnop where yijklmnop is the observed mean value of a trait, μ the overall mean, ai the random effect of animal, pi the random permanent environment of animal, hsj the random effect of herd-sire, GMk the fixed effect of genotype, Pl the fixed effect of parity, HYSm the fixed effect of herd-year-season of kidding, LSn the fixed effect of litter size, TDo the fixed effect of test day, (bp DIMp )ijklmnop the regressions on days between kidding and milking (DIM), standardized and converted to Legendre polynomials (LPs) the up to the fifth power of LPs (p = 1–5), β1 (x2 − x¯ )ijklmnop the regression on milk yield for fat, protein and lactose content and log (SCC), and eijklmnop is the random error. Legendre polynomials are commonly used for testday models (Kettungen et al., 2000). The effect of breed was not considered in the model because its impact was not significant on any of the investigated traits. The differences of the observed and expected frequencies of genotypes within breeds were tested using the Fisher’s exact test (Raymond and Rousset, 1995a,b) to confirm (or deny) that analysed populations were in Hardy–Weinberg equilibrium. Moreover, observed frequencies of alleles and genotypes between breeds were estimated using Fisher’s test with the null hypothesis that allelic and genotypic distribution is identical across populations. Calculation were performed using Genepop Version 3.4 (Raymond and Rousset, 1995a,b). Heterozygosity (H) was calculated according to a formula described by Nei (1978); polymorphism information content (PIC) was calculated according to a formula described by Botstein et al. (1980).
282
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
3. Results
Table 3 Number of records, means and standard deviations of investigated traits
Basing on the sequences of the bovine and ovine GHR genes available in the GenBank database, we designed three pairs of PCR primers enabling amplification of the 5 -region of the caprine GHR gene. Using these primers we amplified and then sequenced three overlapping fragments of the 5 -region. Altogether, these fragments were combined into a 1269-bp sequence which was deposited in the GenBank database under the accession no. AY358031. A (TG)14 -repeat was found within the caprine GHR gene 5 -noncoding region at position 828–855, starting 84 bp upstream from the putative transcription initiation site. This region corresponded roughly to promoter P1 preceding exon 1A in the bovine GHR gene. Moreover, a 317-bp long interspersed repetitive element (LINE-1) was identified at location 482 bp upstream from the transcription initiation site. Further analysis of the GHR gene 5 -region in 235 goats from two breeds (PWI and PFI) showed that the length of the TG-repeat differed between individuals. A total of 10 alleles of the GHR gene were detected in the two breeds, the length of the amplified fragment containing the variable TG-repeat ranging from 305 to 346 bp (Table 2). The frequency of the alleles varied between 0.01 and 0.48, allele 2 (313 bp) being the most frequent in both breeds. Among the 10 alleles identified, eight occurred in homozygous systems. The frequency of the homozygous genotypes was 0.25 for the PWI and 0.28 for the PFI breed. The mean heterozygosity (H) and polymorphic content (PIC) coefficients at this locus were similar for both breeds (Table 2).
Trait
N
Mean
S.D.
Daily milk yield (kg) Fat (%) Protein (%) Lactose (%) SCC (thousand) SCC (ln)
2547 2547 2547 1017 1017 1017
2.38 3.35 3.26 4.39 1756 6.76
1.04 1.10 0.81 0.32 2385 1.10
No significant difference between the expected and observed frequencies of genotypes was noted (Fig. 1). Differences in the genotype and allele frequencies were significant (P < 0.01) between the breeds. Codominant Mendelian inheritance of TG-repeat alleles was observed in two goat families (Fig. 2). Data about milk yield, fat and protein content derived from 157 does and about lactose content and SCC from 52 does were used for association studies. The number of observations, mean values, and standard deviations of the investigated traits are shown in Table 3. The average daily milk yield during lactation and the contents of milk components were rather high. A high variation was observed for milk yield. For fat content the variation was medium while for protein and lactose content it was low. The average somatic cell count and its variation were very high, indicating probably that some goats had problems with subclinical mastitis. No associations were found between TG-repeat length polymorphism and dairy traits – milk yield and content of the major milk components – fat, protein, and lactose (not shown). Also, no effect was shown of the GHR genotype on the somatic cell count (SCC).
Table 2 Allele frequencies in GHR gene and mean heterozygosity (H) and polymorphic content (PIC) in goats of two breeds, Fisher’s exact test of the null hypothesis that the allelic distribution is identical across populations Allele
Length of allele (bp)
Polish white improved (n = 115)a
Polish fawn improved (n = 120)a
Combined for two breeds (n = 235)a
1 2 3 4 5 6 7 8 9 10 Fisher’s exact test H PIC
305 313 320 327 331 333 336 338 341 346
0.07 0.48 0.03 0.11 0.02 0.08 0.10 0.04 0.01 0.06 P < 0.01 0.74 0.71
0.08 0.48 0.07 0.01 0.06 0.03 0.05 0.07 0.08 0.07
0.08 0.48 0.05 0.06 0.04 0.06 0.08 0.05 0.04 0.07
0.74 0.72
0.74 0.72
a
n: Number of animals tested.
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
283
Fig. 1. Observed and expected frequencies of TG-repeat (microsatellite) genotypes within the 5 -noncoding region of the goat GHR gene. Numerical symbols were used for the GHR genotypes; the numbers under abscissa represent symbols of alleles of the lengths showed in Table 2. Thus, “1/0” represent heterozygote with alleles 305 and 346 bp; “3/3” represents 320-bp homozygote, etc.
4. Discussion A TG-repeat occurs in homologous positions of the GHR gene 5 -noncoding region in most studied mammalian species—human (Pekhletsky et al., 1997), mouse (Menon et al., 1995), sheep (O’Mahoney et al., 1994), and cattle (Lucy et al., 1998). The repeat was found to be polymorphic in cattle (Lucy et al., 1998) and in the European bison (Bison bonasus; our unpublished data). The GT-repeat polymorphism in the P1 promoter of bovine GHR gene was first described by Lucy et al. (1998). Five alleles were found with variable TG-repeat
number. Later on, Hale et al. (2000) reported an association between the microsatellite marker and growth rates in Angus steers (weaning weight and carcass weight). The present study, performed on 235 goats from two breeds (Polish White Improved and Polish Fawn Improved) for the first time showed the presence of a variable TG-repeat within the caprine GHR gene 5 noncoding regions. The position of the microsatellite was roughly the same as in the bovine GHR gene—the P1 promoter preceding exon 1A. Ten alleles were found with the length of the amplified fragment ranging from
Fig. 2. Mendelian inheritance of GHR gene TG-repeat (microsatellite) alleles and genotypes in two families of goats.
284
A. Maj et al. / Small Ruminant Research 67 (2007) 279–284
305 to 346 bp (approximately 10–30 TG-repeats, respectively). Although microsatellites are most often considered to be neutral markers, recent evidence suggests that polyTG elements might have functional significance. They often adopt a left-handed double helical conformation of DNA called Z-DNA that may be important in mutagenesis, recombination, and control of gene expression (Majewski and Ott, 2000). The length of the GT-repeats has been shown to influence gene transcription rates of several human genes, including EGF receptor, matrix metalloproteinase-9, and type I collagen ␣2; in all the cases gene transcription rates were positively associated with the length of the GT-repeat (Hadjiyannakis et al., 2001). In this study, a novel short tandem repeat (STR) polymorphism was found within the 5 -noncoding region of the goat GHR gene. Also, for the first time the associations were studied between GHR gene polymorphism and goat production traits. However, our data showed that the GT-repeat polymorphism in the GHR gene has not effect on the goat dairy traits under study. Therefore, the TG-repeat polymorphism in P1 promoter of the goat GHR gene does not seem a useful marker for milk production traits. Acknowledgements This study was funded by the Ministry of Education and Science, Poland, grants PBZ-KBN-036/P06/12 and 3 P06D 02525 and the IGHZ project S.I.-1.2. References Aggrey, S.E., Yao, J., Sabour, M.P., Lin, C.Y., Zadworny, D., Hayes, J.F., Kunlein, U., 1999. Markers within the regulatory region of the growth hormone receptor gene and their association with milkrelated traits in Holsteins. J. Hered. 90, 148–151. Bagnicka, E., Łukaszewicz, M., 1999. Genetic and environmental variation of dairy traits in Polish goats. Anim. Sci. Pap. Rep. 17, 59–65. Blott, S., Kim, J.J., Moisio, S., Schmidt-Kuntzel, A., Cornet, A., Berzi, P., Cambisano, N., Ford, C., Grisart, B., Johnson, D., Karim, L., Simon, P., Snell, R., Spelman, R., Wong, J., Vilkki, J., Georges, M., Farnir, F., Coppieters, W., 2003. Molecular dissection of a quantitative trait locus. A phenylalanine-to-tyrosine substitution in the transmembrane domain of the bovine growth hormone receptor is associated with a major effect on milk yield and composition. Genetics 163, 253–266. Botstein, D., White, R.L., Skalnick, M.H., Davies, R.W., 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am. J. Hum. Genet. 32, 314–331. Burton, J.L., McBride, B.W., Block, E., Glimm, D.R., Kenelly, J.J., 1994. A review of bovine growth hormone. Can. J. Anim. Sci. 74, 167–201.
Etherton, T.D., Bauman, D.E., 1998. Biology of somatotropin in growth and lactation of domestic animals. Physiol. Rev. 78, 745–761. Falaki, M., Gengler, N., Sneyers, M., Prandi, A., Massart, S., Formigoni, A., Burny, A., Portetelle, D., Renaville, R., 1996. Relationships of polymorphisms for growth hormone and growth hormone receptor genes with milk production traits for Italian Holstein–Friesian bulls. J. Dairy Sci. 79, 1446–1453. Hadjiyannakis, S., Zheng, H., Hendy, G.N., Goodyer, C.G., 2001. GTrepeat polymorphism in the 5 -flanking region of the human growth hormone receptor gene. Mol. Cell. Probes 15, 239–242. Hale, C.S., Herring, W.O., Shibuya, H., Lucy, M.C., Lubahn, D.B., Keisler, D.H., Johnsson, G.S., 2000. Decreased growth in Angus steers with a short TG-microsatellite allele in the P1 promoter of the growth hormone receptor gene. J. Anim. Sci. 78, 2099–2104. Jarrige, R. (Ed.), 1988. Alimentation Des Bovins, Ovins and Caprins. INRA, Paris, p. 465. Jiang, H., Lucy, M.C., 2001. Variants of the 5 -untranslated region of the bovine growth hormone receptor mRNA: isolation, expression and effects on translational efficiency. Gene 265, 45–53. Jiang, H., Okamura, C.S., Lucy, M.C., 1999. Isolation and characterization of a novel promoter for the bovine growth hormone receptor gene. J. Biol. Chem. 274, 7893–7900. Kanai, N., Fujii, T., Saito, K., Yokoyama, T., 1994. Rapid and simple method for preparation of genomic DNA from easily obtained clotted blood. J. Clin. Pathol. 47, 1043–1044. Kettungen, A., M¨antysaari, E.A., P¨os¨o, J., 2000. Estimation of genetic parameters for daily milk yield of primiparous Ayrshire cows by random regression test-day models. Livest. Prod. Sci. 66, 251–261. Lucy, M.C., Johnsson, G.S., Shibuya, H., Boyd, C.K., Herring, W.O., Werin, M., 1998. Rapid communication: polymorphic (GT)n microsatellite in the bovine somatotropine receptor gene promoter. J. Anim. Sci. 76, 2209–2210. Madsen, P., Jansen, J., 2000. A user’s guide to DMU. A package for analysing multivariate mixed models. Version 6. Release 4. Majewski, J., Ott, J., 2000. GT-repeats are associated with recombination on human chromosome 22. Genome Res. 10, 1108– 1114. Menon, R.K., Stephan, D.A., Manbir, S., Morris, S.M., Zou, L., 1995. Cloning the promoter-regulatory region on the murine growth hormone receptor. J. Biol. Chem. 270, 8851–8859. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. O’Mahoney, J.V., Brandon, M.R., Adams, T.E., 1994. Identification of a liver-specific promoter for the ovine growth hormone receptor. Mol. Cell. Endocrinol. 101, 129–139. Parmentier, I., Portetelle, D., Gengler, N., Prandi, A., Bertozzi, C., Vleurick, L., Gilson, R., Renaville, R., 1999. Candidate gene markers associated with somatotropic axis and milk selection. Domest. Anim. Endocrinol. 17, 139–148. Pekhletsky, R.I., Chernov, B.K., Rubtsov, P.M., 1997. Variants of the 5 untranslated sequence of human growth hormone receptor mRNA. Mol. Cell. Endocrinol. 90, 103–109. Raymond, M., Rousset, F., 1995a. An exact test for population differentiation. Evolution 49, 1280–1283. Raymond, M., Rousset, F., 1995b. Genepop (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86, 248–249. Zhu, T., Goh, E.L.K., Graichen, R., Ling, L., Lobie, P.E., 2001. Signal transduction via the growth hormone receptor. Cell. Signal. 13, 599–616.