- Email: [email protected]
Development and evaluation of multiplex PCR in rapid diagnosis of abdominal tuberculosis
Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
Contents lists available at SciVerse ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Mycobacteriology
Development and evaluation of multiplex PCR in rapid diagnosis of abdominal tuberculosis Vinaykumar Hallur a, Meera Sharma a, Sunil Sethi a,⁎, Kusum Sharma a, Abhishek Mewara a, Sunil Dhatwalia a, Rakesh Yadav a, Deepak Bhasin b, Saroj Kant Sinha b, Satyawati Rana b, Kusum Joshi c a b c
Department of Medical Microbiology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Department of Gastroenterology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Department of Histopathology, Postgraduate Institute of Medical Education and Research, Chandigarh, India
a r t i c l e
i n f o
Article history: Received 16 January 2013 Received in revised form 19 February 2013 Accepted 21 February 2013 Keywords: Rapid diagnosis Abdominal tuberculosis Diagnostic accuracy
a b s t r a c t The clinical features of abdominal tuberculosis (TB) are non-specific and establishing a diagnosis remains a challenge. A delay in diagnosis is likely to increase the morbidity in these patients. We developed a multiplex polymerase chain reaction (PCR) using 16SrRNA, IS6110, and devR, and evaluated it in comparison with other conventional tests in clinical suspects of abdominal TB. A total of 183 patients with clinical suspicion of abdominal TB (96 patients with intestinal TB and 87 with peritoneal TB) were enrolled for the study. Endoscopic or intraoperative biopsies were collected from patients suspected of intestinal TB and ascitic fluid was collected from patients with a suspicion of peritoneal TB. Of the intestinal tuberculosis group, there were 40 confirmed cases and 56 controls, while of the peritoneal tuberculosis group there were 37 confirmed cases and 50 controls. Multiplex PCR showed a high sensitivity and specificity in both the intestinal TB and peritoneal TB groups. When combined with histopathology, multiplex PCR could detect 97.5% of all the cases in the intestinal tuberculosis group, while in combination adenosine deaminase levels (ADA) in cases of peritoneal tuberculosis it increased the specificity of diagnosis of peritoneal tuberculosis to 95%. In combination with histopathology in suspected intestinal TB cases, and ADA testing in suspected peritoneal TB cases, it can be used as a highly sensitive, specific, and rapid diagnostic tool with the ability to supplement the limitations of other diagnostic modalities. © 2013 Elsevier Inc. All rights reserved.
1. Introduction Abdominal tuberculosis (TB) remains a challenging diagnosis for physicians. The entity, though uncommon in developed countries has been reported in up to 5% of TB patients and the incidence is expected to increase following the HIV pandemic in both the developing and developed countries (Gan et al., 1995; Safarpor et al., 2007). In India, gastrointestinal tract is the fourth most frequently involved site in extrapulmonary TB after pleura, lymph nodes and bones (Agarwal, Chauhan, and India. Directorate General of Health Services., 2005). Abdominal TB is mainly caused by Mycobacterium tuberculosis and Mycobacterium bovis, though gastrointestinal disease in HIV-positive or immunosuppressed individuals can also be caused by nontubercular mycobacteria (NTM), mainly Mycobacterium intercellulare complex, Mycobacterium genavense, and Mycobacterium chelonae (Yamazaki et al., 2010). The clinical features of abdominal TB are nonspecific and in the absence of pulmonary TB it may be difficult to establish the diagnosis(Shah et al., 2010; Yamada and Alpers, 2003).
⁎ Corresponding author. Tel.: +91-1722755161; fax: +91-172-2744401. E-mail address: [email protected] (S. Sethi). 0732-8893/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2013.02.022
The conventional methods for diagnosis of abdominal TB like histopathology and culture on solid media suffer with low sensitivity (ranging from 0–40%) and high turnaround time (V. Singh et al., 1996). Other tests like BACTEC MGIT 960, adenosine deaminase levels (ADA) and molecular tests like polymerase chain reaction (PCR) have been used for the diagnosis of abdominal TB, and have the advantage of being more rapid and sensitive. The use of PCR has been proposed in a few studies to increase the sensitivity (30–82.6%) and specificity (95–100%) of the diagnosis of abdominal TB (Yonal and Hamzaoglu, 2010). Majority of the PCR assays evaluated for diagnosis of abdominal TB have targeted IS6110 gene, as there are multiple copies of IS6110 in the M. tuberculosis genome (1–25 copies/genome), which was thought to confer higher sensitivity to PCR assays (Narayanan, 2004). However, it has been shown that some Indian strains of M. tuberculosis do not contain IS6110 or have low copy numbers of this gene, thus missing these cases (Das et al., 1995). Such cases can be detected using multiplex PCR approach, including other well characterized genes in the assay like devR for M. tuberculosis and16SrRNAwhich recognizes Mycobacterium species. DevR is a component of devR-devS, a 2-component regulatory system which is differentially expressed in virulent strains of M. tuberculosis, and is well conserved (Kinger and Tyagi, 1993; K. K. Singh et al., 2000). A multiplex
52
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
PCR targeting these genes would increase the sensitivity of detection as well as allow identification of other pathogenic NTM causing gastrointestinal disease. In the present study we developed a multiplex PCR for the diagnosis of abdominal TB (intestinal TB and peritoneal TB), targeting 3 genes viz.16SrRNA for Mycobacteria spp., M. tuberculosis complex specific IS6110 and devR, and compared it with simple PCR targeting each of these genes individually in both the groups, and also with ADA levels in peritoneal TB group. 2. Material and methods 2.1. Subjects A total of 183 samples (80 endoscopic biopsies, 16 intraoperative biopsies and 87 ascitic fluid samples) were obtained from 183 patients with clinical suspicion of abdominal TB (96 patients with intestinal TB and 87 with peritoneal TB) attending the outpatient department or admitted to the Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India, from February 2010 to July 2011. The study was approved by the Institute Ethics Committee of PGIMER, Chandigarh, and written informed consent was obtained from all the subjects enrolled in the study. The following inclusion criteria were used for patients in the two groups: Intestinal TB group included patients with presence of constitutional features (fever, night sweats, fatigue, and loss of appetite), abdominal pain, alteration in bowel habit (diarrhea, constipation, or both), acute abdomen, and abdominal mass; Peritoneal TB group included patients with the above constitutional features, abdominal pain, ascites and palpable abdominal masses formed by mesenteric lymph nodes. Patients with disseminated and miliary TB were excluded from the study. A detailed history was recorded and thorough clinical examination was done for each patient. All patients were subjected to routine radiological and laboratory investigations. Patients in whom the diagnosis of intestinal TB or peritoneal TB, was confirmed by laboratory investigations, viz. presence of acid fast bacilli (AFB) on smear examination, and/or culture positivity for M. tuberculosis, and/or caseating granulomas on histopathology, or a clinical response to anti-tubercular treatment (ATT) were included in the test groups, and patients in whom an alternate diagnosis was established following complete clinical, radiological, and laboratory investigations were included in the control groups. The patients in the control group for intestinal TB comprised of 22 patients with idiopathic ulcerative colitis; 14 with Crohn’s disease; 12 with intestinal malignancy; and 8 others with conditions like typhoid perforation, cytomegalovirus colitis, and peptic ulcer disease. The control group for peritoneal TB consisted of 23 patients with chronic liver disease; 7 with congestive heart failure; 7 with peritoneal malignancy; and 13 others with conditions like pancreatitis, bacterial sepsis with multiorgan dysfunction, peptic ulcer disease with perforation peritonitis, and chronic kidney disease. All the 183 subjects were followed over a period of 6 months and clinical response to ATT in confirmed TB cases was recorded by regression of lesions and absence of any systemic symptoms (fever, cough, and weight loss). 2.2. Sample collection and processing All the samples (endoscopic biopsies, intraoperative biopsies and ascitic fluid) were collected, transported to the laboratory, and
processed as per standard protocols (Drossman et al., 2005; Isenberg and American Society for Microbiology, 2004; Vestal and United States. National Communicable Disease Center. Laboratory Consultation and Development Section., 1969). Briefly, tissue samples were homogenized using tissue homogenizer and subjected to digestion and decontamination using the NALC-NaOH method as per standard protocol described elsewhere (Vestal and United States. National Communicable Disease Center. Laboratory Consultation and Development Section., 1969). About 100 mL of ascitic fluid sample was centrifuged at 3000 rpm for 20 minutes to obtain a cell pellet which was reconstituted in 1 mL of sterile phosphate-buffered saline (pH 7.2). The sediment obtained from tissue and fluid was divided into different volumes and subjected to Ziehl Neelsen staining (100 μL), Auramine O staining (100 μL), culture on LJ media (100 μL), and BACTEC MGIT 960 (500 μL) as per standard protocols (Department of Medical Microbiology). In addition, the tissue samples were also subjected to histological examination by hematoxylin eosin and Ziehl Neelsen staining (Department of Histopathology), and ADA level (Department of Gastroenterology) were estimated for ascitic fluids using modified Giusti method as per the standard protocol described elsewhere(Bandyopadhyay et al., 2008). An ADA level of more than 36 IU was taken as positive(M. P. Sharma and Bhatia, 2004). All the readings were taken by two independent observers for each of the tests, who were blinded to the patient's clinical and demographic data and the results of other investigations. 2.3. DNA extraction DNA was extracted from the sediments using the standard protocol of Van Embden et al. with minor modifications (van Embden et al., 1993). Briefly, 200 μL of the sediment was suspended in 400 μL of Tris-EDTA buffer and heated at 100 °C for 5 minutes. After cooling to room temperature, 40 μL of lysozyme was added and the suspension was incubated at 37 °C for 2 hours, after which 80 μL of 10% SDS and 5 μL proteinase K were added and the mixture was vortexed and incubated at 65 °C for 30 minutes. This was followed by addition of 30 μL of 5M NaCl and 64 μL of cetyl-N,N,N-trimethyl ammonium bromide (CTAB/NaCl) solution and incubation of 30 minutes at 65 °C. The DNA contaminants were removed by phenol: chloroform: isoamyl alcohol (25:24:1) treatment and subsequently DNA was precipitated by addition of 0.6 volumes of isopropanol. The precipitate was washed with 70% ethanol, dried, dissolved in 30 μL of Tris EDTA buffer, and stored at −70 °C till used. All tests were performed within 72 hours of collecting the samples. 2.4. Simple PCR assays Simple PCR assays were standardized with different temperatures and concentrations of reagents. All the reagents used for the PCR were obtained from Sigma Genosys (Sigma-Aldrich Chemicals Pvt. Ltd., Bangalore, India). The oligonucleotide primers listed in Table 1 were used for the PCR assays. The master mix (50 μL) was prepared by adding PCR buffer 10X, dNTP mix (10 mmol/L), all primers used in equimolar concentrations (10 pmol/L), Taq polymerase (5U/μL), DNA(3 μL) template and PCR grade water. DNA amplification was done in a thermocycler (Master cycler, Eppendorf, USA) for 35 cycles following an initial denaturation for 5 minutes as follows: denaturation at 95 °C for 1 minutes, annealing at 55 °C, 62 °C, and 62 °C for
Table 1 List of primers. Gene
Forward
Reverse
16SrRNA (590bp genus specific) (Richter et al., 1995) IS6110 (123bp Complex specific) (M. Sharma et al., 2010) devR (162 bp complex specific) (Haldar et al., 2009)
5′AGAGTTTGATCCTGGCTCAG3′ 5′CCTGCGAGCGTAGGTCGG3′ 5′ATCTGTTGTCCCGCATGCC 3′
5′TTTCACGAACAACGCGACAA3′ 5′CTCGTCCAGCGCCGCTTCGG3′ 5′GTCCAGCGCCCACATCTTT3′
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
16SrRNA, IS6110, and devR for 1 min, respectively, and extension at 72 °C for 1 minutes, followed by final extension at 72 °C for 1 minute. Each batch of the PCR assays included a positive control viz. DNA from H37Rv and PCR grade water was used as negative control. The amplified products were run in 1.5% agarose gel containing ethidium bromide, and visualized in ultra-violet light in a gel documentation system in the Department of Medical Microbiology (AlphaImager 3400, AlphaInnotech, USA). 2.5. Multiplex PCR The above three primer sets were combined in an equimolar ratio in a single tube and standardized with different temperatures for multiplex PCR in the Department of Medical Microbiology. The optimum annealing temperature used was 57 °C for the multiplex PCR, while the rest of the protocol was similar to the single PCR assays. The results of the multiplex PCR were interpreted as M. tuberculosis infection when bands for all three genes were present and/or band against IS6110 (123bp) and/or devR (162bp) was present, while the presence of only 16SrRNA (590bp) band was interpreted as NTM infection. 2.6. Statistical analysis Because culture is negative in many cases of extrapulmonary TB and none of the tests employed for the diagnosis of abdominal TB are 100% sensitive, we considered the following criteria for defining a case of abdominal TB: (A) positive culture for M. tuberculosis (B) presence of AFB on smear examination and/or caseating granulomas on histopathology with AFB (if culture negative) (C) clinical response to ATT (if all above were negative). Sensitivity, specificity, positive predictive values, and negative predictive values with confidence intervals were calculated for each test using standard formulae. The statistical analysis was carried out using the software SPSS, v. 17.0 (SPSS South Asia Pvt. Ltd., Bangalore, India).
53
3. Results A total of 183 clinical suspects of abdominal TB were enrolled in the study (96 patients with intestinal TB and 87 with peritoneal TB). No adverse events were observed while obtaining samples from the patients for the study. The demographic and clinical details of the patients in the two study groups (intestinal and peritoneal TB) are given in the Table 2. In the intestinal TB group, constipation was the most common feature present in 75% (30/40) of the patients, followed by loss of weight in 70% (28/40), moderate anemia in 70% (28/40) and abdominal pain in 67.3% (27/40) cases. In the peritoneal TB group, the most common feature was abdominal distension in 97.3% (36/37) patients, followed by fever in 94.6% (35/37) and loss of weight in 75.7% (28/37) patients. A past history of TB was present in 10 (25%) cases in intestinal TB group and 6 (16.2%) in the peritoneal TB group. Mantoux test was positive in 27 (67.5%) and 18 (48.6%) patients in the intestinal and peritoneal TB groups, respectively. A clinical diagnosis of abdominal TB was attained in 27 (including 11 cases which were negative by investigations but responded to ATT) of the 40 cases in the intestinal TB group and 15 (including 3 cases which were negative by investigations but responded to ATT) of the 37 cases in the peritoneal TB group. The commonest radiological finding in cases amongst intestinal TB group was asymmetric bowel wall thickening in 28 patients, followed by loco-regional lymphadenopathy with necrotic lymph nodes in 6, and omental thickening in 5 patients on computed tomographic scan and ultrasonography (USG), while in the peritoneal TB group, ascites with septations was the commonest finding present in 11 patients on USG. Auramine O staining identified 11 (27.5%), and ZN staining identified 8 (20%) of the 40 cases in the intestinal TB group. Both the staining techniques identified only 2 (5.4%) cases in the peritoneal TB group. LJ medium was able to detect 8 (20%) and 3 (8.1%) cases, while culture on BACTEC MGIT 960 detected 24 (60%) and 6 (16.21%) cases in intestinal and peritoneal TB groups, respectively. Histopathology was positive in 24 (60%) of the cases in intestinal TB group, 2
Table 2 Clinical and demographic features of the study groups. Age
Intestinal TB Cases (%)
Control (%)
Cases (%)
Control (%)
n = 40
n = 56
n = 37
n = 50
7 (12.5) 24 (42.9) 19 (33.9) 6 (10.7)
9 13 11 4
(24.3) (35.1) (29.7) (10.8)
7 (14.0) 26 (52.0) 12 (24.0) 5 (10.0)
31 (55.4) 25 (44.6)
19 (51.4) 18 (48.6)
29 (58.0) 21 (42.0)
40 (71.4) 19 (33.9) 24 (42.9) 24 (42.9) 24 (42.9) 39 (69.6) 5 (8.9) 15 (26.8) 8 (14.3) 4 (7.1) 2 (3.6) 15 (26.8) 1 (1.7) 23 (41.8) 18 (32.1) 16 (28.6)
26 (70.3) 35 (94.6) 28 (75.7) 20 (54.1) 2 (5.4) 5 (13.5) 8 (21.6) 7 (18.9) 2 (5.4) 36 (97.3) 0 (0) 7 (18.9) 6 (16.2) 2 (5.4) 15 (40.5) 18 (48.6)
24 (48.0) 34 (68.0) 16 (32.0) 22 (44.0) 4 (8.0) 9 (18.0) 19 (38.0) 23 (46.0) 50 (100) 12 (24.0) 1 (2.0) 12 (24.0) 0 (0) 2 (4.0) 22 (59.5) 9 (18.0)
Age distribution of study groups 0-20 7 (17.5) 21-40 17 (42.5) 41-60 12 (30.0) N60 4 (10.0) Sex distribution of patients in different study groups Male 22 (55.0) Female 18 (45.0) Symptoms/signs/lab parameters in cases in each group Abdominal pain 27 (67.5) Fever 23 (57.5) Loss of weight 28 (70.0) Loss of appetite 22 (55.0) Diarrhea 13 (32.5) Constipation 30 (75.0) Nausea and Vomiting 12 (30.0) Hepatomegaly 6 (15.0) Splenomegaly 2 (5.0) Abdominal distension 12 (30.0) Abdominal mass 7 (17.5) Lymphadenopathy 9 (22.5) Past history of TB 10 (25.0) Blood in stools 11 (27.5) Moderate anemia 28 (70.0) Mantoux test# 27 (67.5) # Induration N15 mm was considered as positive.
Peritoneal TB
78.1% 67.6% 79.4% 84.7% 93.7% (82.2–100) (71.7–100) (82.8–100) (85–100) (69.5–93.7) 100% 100% 100% 100% 85% (91.1–100) (91.1–100) (91.1–100) (91.1–100) (75–95) 100% 100% 100% 100% 88% (44.8–77.1) (20.7–52.6) (47.4–79.3) (58.4–87.6) (77–97.9) 62.2% 35.1% 64.9% 75.7% 91.9%
Abbreviations: N = number of positives, NA = not applicable, CI = Confidence interval, PPV = Positive predictive value, NPV = Negative predictive value.
Total no of positives
23 13 24 28 34
Peritoneal TB
NPV (95% CI) PPV (95% CI) Specificity (95% CI) Sensitivity (95% CI) Method
Table 4 Results of PCR assays and ADA for diagnosis of abdominal TB.
In this study, we evaluated patients with abdominal TB by multiplex PCR targeting three genes, two of which, i.e., IS6110 and devR are specific for M. tuberculosis and 16SrRNA, which identifies members of the Mycobacterium genus, and compared the assay with simple PCR targeting each of these genes individually, and other conventional tests used for the diagnosis of abdominal TB. We found young adults between 21–40 years to be most commonly affected age group, followed by 41–60 years, which is in agreement with the previous studies(Muneef et al., 2001). No sex predilection was observed in any of the groups of abdominal TB in our study. Overall a high sensitivity of Mantoux test was found in our study, and it was more so in the intestinal TB group as compared to the peritoneal TB group. This is in agreement with the previous studies which showed a sensitivity ranging between 58–100% (Kapoor, 1998; Manohar et al., 1990). The utility of Mantoux test in the diagnosis of abdominal tuberculosis is questionable as it does not differentiate between active disease and previous sensitization by contact or vaccination (Kapoor, 1998). Loss of weight and constipation were the commonest presenting complaints in patients with intestinal TB, while fever and abdominal distension were the commonest presenting complaints in patients with peritoneal TB. Similar findings have been reported previously, and one third of the patients with abdominal TB are known to present with systemic manifestations which are more frequent in patients with ulcerative intestinal lesions and ascitic peritoneal tuberculosis (V. Singh et al., 1995; Szmigielski et al., 1998). Overall, the PCR assays showed a good sensitivity and specificity in our evaluation. Multiplex PCR performed better than the simple PCR assays and other conventional tests and was able to detect 87.5% (35/ 40) cases in intestinal TB and 75.7% (28/37) cases in the peritoneal TB group. Two of the 5 cases in the intestinal TB group who were negative by multiplex PCR had no conclusive evidence of TB but responded to ATT. Of the remaining 3, one was positive only by 16SrRNA PCR assay and the other 2 were positive by both IS6110 and devR PCR assays. It is difficult to explain this finding but it could be a result of competitive binding of primers in multiplexing, as there is a low bacillary load in specimens from extrapulmonary TB patients and hence low concen-
Intestinal TB
4. Discussion
Total no of positives
Sensitivity (95% CI)
Specificity (95% CI)
of which were not detected by multiplex PCR (Table 3). ADA was positive in 34 (91.9%) of the 37 cases in the peritoneal TB group, 6 of which were negative by multiplex PCR. Falsely elevated levels of ADA were seen in 6 of the controls. In the intestinal TB group, 32 (80%), 31 (77.5%), and 24 (60%) cases were positive by devR, IS6110, and 16SrRNA PCR, while 35 (87.5%) cases were positive by multiplex PCR assay. Similarly, in the peritoneal TB group 24 (64.9%), 23 (62.2%), and 13 (35.1%) cases were positive by devR, IS6110, and 16SrRNA PCR while 28 (75.7%) were positive by multiplex PCR. Therefore, multiplex PCR exhibited the highest sensitivity followed by devR and IS6110 PCR in both the groups. Multiplex PCR was positive in all smear positive cases in both the groups, and detected all the cases that were positive on culture in peritoneal TB group. However, it did not detect 2 cases in the intestinal TB group which were identified by BACTEC MGIT 960. The results of various PCR assays are summarized in Table 4.
(74.1–92.9) (66.1–86.4) (76.3–94.1) (80.6–96.8)
Abbreviations: N = number of positives, NA = not applicable.
85.7% 77.8% 87.1% 91.5% NA
2 (5.4) 2 (5.4) 3 (8.8) 6 (16.2) NA
93.9% (78.4–98.9) 100% (82.8–100) 94.1% (78.9–99) 94.6% (80.5–99.1) NA
11 (27.5) 8 (20.0) 8 (20.0) 24 (60.0) 24 (60.0)
96.4% (86.6–99.4) 100% (92–100) 96.4% (97.9–99) 96.4% (86.6–99.4) NA
Auramine staining Ziehl Neelsen staining Culture on LJ medium Culture on BACTEC MGIT 960 Histopathology
77.5% (61.1–88.6) 60% (43.4–74.8) 80% (63.9–90.4) 87.5% (72.4–95.3) NA
Peritoneal TB (n = 37); n (%)
31 24 32 35 NA
Intestinal TB (n = 40); n (%)
PPV (95% CI)
Method
NPV (95% CI)
Table 3 Results of conventional tests for diagnosis of abdominal TB.
(65.7–87.1) (55.6–77.7) (67.0–88.1) (72.5–92.4) (81.4–98.3)
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
PCR IS 6110 PCR 16sRNA PCR devR Multiplex PCR ADA
54
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
tration of DNA available for amplification. The lowest sensitivity was observed with the 16SrRNA simple PCR with a sensitivity of 60% and 35.1% for intestinal and peritoneal TB, respectively. Poor sensitivity of this primer has also been reported in skin biopsies of patients with cutaneous TB by Ogusuku et al. and was attributed to the fact that it was single copy gene (Ogusuku et al., 2003). However, a study by Richter et al. reported that the sensitivity of this primer was N90% in formalinfixed paraffin embedded tissues (Richter et al., 1995). There was only one sample which was positive for single band of 16SrRNA on multiplex PCR in a culture positive sample and was confirmed to be M. tuberculosis by biochemical tests. It was observed that devR PCR was able to detect an extra case in both the groups (intestinal and peritoneal TB) than IS6110, resulting in a marginal increase in sensitivity. We observed that the sensitivity of single PCR as well as multiplex PCR assay was lower for peritoneal TB in comparison to ADA (Table 4). These findings in peritoneal fluid are in contrast to the findings of Bandyopadhyay et al. who found that multiplex PCR was more sensitive than ADA in extrapulmonary TB (Bandyopadhyay et al., 2008). In our study, we found that 12 (30%) cases in the intestinal TB group and 3 (8%) in the peritoneal TB group, who did not have any laboratory features suggestive of abdominal TB but responded to ATT, were positive by PCR. This indicates that absence of conventional laboratory features (smear, histopathology, ADA, and culture) does not rule out abdominal TB. When combined with histopathology, multiplex PCR could detect 97.5% (39/40) of all the cases in the intestinal TB group. Hence, multiplex PCR could be effectively used in combination with histopathology for rapid and accurate diagnosis of intestinal TB. Similarly, in peritoneal TB, multiplex PCR could detect 75.7% (28/37) cases. ADA level estimation helped to detect 6 additional cases, though the specificity of ADA was found to be lower (88%) as compared to multiplex PCR (100%). Falsely elevated ADA levels are known in conditions like lymphoma, and in such cases multiplex PCR can be helpful to establish the diagnosis. It is notable to observe that there were two specimens in the intestinal TB group which were positive by IS6110, devR PCR as well as multiplex PCR, but were negative by other laboratory investigations, and the patients did not respond to ATT over 6-month follow-up period. These 2 patients were hence grouped in controls as per the preset criteria for positivity, and the samples were considered to be false positive, consequently affecting the specificity of these assays (96.4%). We ruled out laboratory contamination, as negative and positive controls were included in all DNA extraction, amplification, and detection procedures. However, both these patients had CMV colitis and treatment with both ganciclovir and ATT did not improve the clinical status over a period of 6 months. The immunosuppressed state induced by CMV could be a possible reason for non-response to ATT. Also, no response to ATT has been observed in small percentage of TB patients and cannot be totally ruled out (Bolukbas et al., 2005). In conclusion, we developed a multiplex PCR assay that can be a valuable rapid diagnostic modality for patients suspected of abdominal TB, especially in cases where other conventional laboratory investigations are negative or inconclusive. Multiplex PCR exhibited the highest sensitivity and specificity among all the tests in both the intestinal TB and peritoneal TB group, except for ADA level estimation in peritoneal TB group which had a higher sensitivity than multiplex PCR. If combined with histopathology in suspected intestinal TB cases and ADA testing in suspected peritoneal TB cases, multiplex PCR can prove to be a very useful diagnostic tool by virtue of its high sensitivity, specificity, rapidity, and the ability to supplement the limitations of other diagnostic modalities.
55
References Agarwal SP, Chauhan LS, India. Directorate General of Health Services. Tuberculosis control in India. New Delhi: Directorate General of Health Services, Ministry of Health and Family Welfare; 2005. Bandyopadhyay D, Gupta S, Banerjee S, Ray D, Bhattacharya S, Bhattacharya B. Adenosine deaminase estimation and multiplex polymerase chain reaction in diagnosis of extra-pulmonary tuberculosis. Int J Tuberc Lung Dis 2008;12:1203–8. Bolukbas C, Bolukbas FF, Kendir T, Dalay RA, Akbayir N, Sokmen MH, et al. Clinical presentation of abdominal tuberculosis in HIV seronegative adults. BMC Gastroenterol 2005;5:21. Das S, Paramasivan CN, Lowrie DB, Prabhakar R, Narayanan PR. IS6110 restriction fragment length polymorphism typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras, south India. Tuber Lung Dis 1995;76:550–4. Drossman DA, Grimm IS, Shaheen NJ. Handbook of gastroenterologic procedures. 4th ed. Philadelphia: Lippincott Williams & Wilkins; 2005. Gan H, Ouyang Q, Bu H, Li S, Chen D, Li G, et al. Value of polymerase chain reaction assay in diagnosis of intestinal tuberculosis and differentiation from Crohn's disease. Chin Med J (Engl) 1995;108:215–20. Haldar S, Sharma N, Gupta VK, Tyagi JS. Efficient diagnosis of tuberculous meningitis by detection of Mycobacterium tuberculosis DNA in cerebrospinal fluid filtrates using PCR. J Med Microbiol 2009;58:616–24. Isenberg HD, American Society for Microbiology. Clinical microbiology procedures handbook. 2nd ed. Washington, DC: ASM Press; 2004. Kapoor VK. Abdominal tuberculosis. Postgrad Med J 1998;74:459–67. Kinger AK, Tyagi JS. Identification and cloning of genes differentially expressed in the virulent strain of Mycobacterium tuberculosis. Gene 1993;131:113–7. Manohar A, Simjee AE, Haffejee AA, Pettengell KE. Symptoms and investigative findings in 145 patients with tuberculous peritonitis diagnosed by peritoneoscopy and biopsy over a five year period. Gut 1990;31:1130–2. Muneef MA, Memish Z, Mahmoud SA, Sadoon SA, Bannatyne R, Khan Y. Tuberculosis in the belly: a review of forty-six cases involving the gastrointestinal tract and peritoneum. Scand J Gastroenterol 2001;36:528–32. Narayanan S. Molecular epidemiology of tuberculosis. Indian J Med Res 2004;120: 233–47. Ogusuku MM, Sadahiro A, Hirata MH, Hirata RD, Zaitz C, Salem JI. PCR in the diagnosis of cutaneous tuberculosis. Braz J Microbiol 2003;34:165–70. Richter E, Schluter C, Duchrow M, Hahn M, Rusch-Gerdes S, Galle J, et al. An improved method for the species-specific assessment of mycobacteria in routinely formalinfixed and paraffin-embedded tissues. J Pathol 1995;175:85–92. Safarpor F, Aghajanzade M, Kohsari MR, Hoda S, Sarshad A, Safarpor D. Role of laparoscopy in the diagnosis of abdominal tuberculosis. Saudi J Gastroenterol 2007;13:133–5. Shah SR, Shenai S, Desai DC, Joshi A, Abraham P, Rodrigues C. Comparison of Mycobacterium tuberculosis culture using liquid culture medium and Lowenstein Jensen medium in abdominal tuberculosis. Indian J Gastroenterol 2010;29:237–9. Sharma MP, Bhatia V. Abdominal tuberculosis. Indian J Med Res 2004;120:305–15. Sharma M, Sethi S, Mishra AK, Chatterjee SS, Wanchu A, Nijhawan R. Efficacy of an inhouse polymerase chain reaction assay for rapid diagnosis of Mycobacterium tuberculosis in patients with tubercular lymphadenitis: comparison with fine needle aspiration cytology and conventional techniques. Indian J Pathol Microbiol 2010;53:714–7. Singh V, Jain AK, Agrawal AK, Gupta S, Khanna S, Khanna AK, et al. Clinicopathological profile of abdominal tuberculosis. Br J Clin Pract 1995;49:22–4. Singh V, Kumar P, Kamal J, Prakash V, Vaiphei K, Singh K. Clinicocolonoscopic profile of colonic tuberculosis. Am J Gastroenterol 1996;91:565–8. Singh KK, Muralidhar M, Kumar A, Chattopadhyaya TK, Kapila K, Singh MK, et al. Comparison of in house polymerase chain reaction with conventional techniques for the detection of Mycobacterium tuberculosis DNA in granulomatous lymphadenopathy. J Clin Pathol 2000;53:355–61. Szmigielski W, Venkatraman B, Ejeckam GC, Jarikre LN. Abdominal tuberculosis in Qatar: a clinico-radiological study. Int J Tuberc Lung Dis 1998;2:563–8. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol 1993;31:406–9. Vestal AL, United States, National Communicable Disease Center, Laboratory Consultation and Development Section. Procedures for the isolation and identification of mycobacteria. Atlanta: National Communicable Disease Center, Laboratory Consultation and Development Section; 1969 [for sale by the Supt. of Docs., U.S. Govt. Print. Off., Washington]. Yamada T, Alpers DH. Textbook of gastroenterology. 4th ed. Philadelphia: Lippincott Williams & Wilkins; 2003. Yamazaki R, Mori T, Nakazato T, Aisa Y, Imaeda H, Hisamatsu T, et al. Non-tuberculous mycobacterial infection localized in small intestine developing after allogeneic bone marrow transplantation. Intern Med 2010;49:1191–3. Yonal O, Hamzaoglu HO. What is the most accurate method for the diagnosis of intestinal tuberculosis? Turk J Gastroenterol 2010;21:91–6.
Contents lists available at SciVerse ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Mycobacteriology
Development and evaluation of multiplex PCR in rapid diagnosis of abdominal tuberculosis Vinaykumar Hallur a, Meera Sharma a, Sunil Sethi a,⁎, Kusum Sharma a, Abhishek Mewara a, Sunil Dhatwalia a, Rakesh Yadav a, Deepak Bhasin b, Saroj Kant Sinha b, Satyawati Rana b, Kusum Joshi c a b c
Department of Medical Microbiology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Department of Gastroenterology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Department of Histopathology, Postgraduate Institute of Medical Education and Research, Chandigarh, India
a r t i c l e
i n f o
Article history: Received 16 January 2013 Received in revised form 19 February 2013 Accepted 21 February 2013 Keywords: Rapid diagnosis Abdominal tuberculosis Diagnostic accuracy
a b s t r a c t The clinical features of abdominal tuberculosis (TB) are non-specific and establishing a diagnosis remains a challenge. A delay in diagnosis is likely to increase the morbidity in these patients. We developed a multiplex polymerase chain reaction (PCR) using 16SrRNA, IS6110, and devR, and evaluated it in comparison with other conventional tests in clinical suspects of abdominal TB. A total of 183 patients with clinical suspicion of abdominal TB (96 patients with intestinal TB and 87 with peritoneal TB) were enrolled for the study. Endoscopic or intraoperative biopsies were collected from patients suspected of intestinal TB and ascitic fluid was collected from patients with a suspicion of peritoneal TB. Of the intestinal tuberculosis group, there were 40 confirmed cases and 56 controls, while of the peritoneal tuberculosis group there were 37 confirmed cases and 50 controls. Multiplex PCR showed a high sensitivity and specificity in both the intestinal TB and peritoneal TB groups. When combined with histopathology, multiplex PCR could detect 97.5% of all the cases in the intestinal tuberculosis group, while in combination adenosine deaminase levels (ADA) in cases of peritoneal tuberculosis it increased the specificity of diagnosis of peritoneal tuberculosis to 95%. In combination with histopathology in suspected intestinal TB cases, and ADA testing in suspected peritoneal TB cases, it can be used as a highly sensitive, specific, and rapid diagnostic tool with the ability to supplement the limitations of other diagnostic modalities. © 2013 Elsevier Inc. All rights reserved.
1. Introduction Abdominal tuberculosis (TB) remains a challenging diagnosis for physicians. The entity, though uncommon in developed countries has been reported in up to 5% of TB patients and the incidence is expected to increase following the HIV pandemic in both the developing and developed countries (Gan et al., 1995; Safarpor et al., 2007). In India, gastrointestinal tract is the fourth most frequently involved site in extrapulmonary TB after pleura, lymph nodes and bones (Agarwal, Chauhan, and India. Directorate General of Health Services., 2005). Abdominal TB is mainly caused by Mycobacterium tuberculosis and Mycobacterium bovis, though gastrointestinal disease in HIV-positive or immunosuppressed individuals can also be caused by nontubercular mycobacteria (NTM), mainly Mycobacterium intercellulare complex, Mycobacterium genavense, and Mycobacterium chelonae (Yamazaki et al., 2010). The clinical features of abdominal TB are nonspecific and in the absence of pulmonary TB it may be difficult to establish the diagnosis(Shah et al., 2010; Yamada and Alpers, 2003).
⁎ Corresponding author. Tel.: +91-1722755161; fax: +91-172-2744401. E-mail address: [email protected] (S. Sethi). 0732-8893/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2013.02.022
The conventional methods for diagnosis of abdominal TB like histopathology and culture on solid media suffer with low sensitivity (ranging from 0–40%) and high turnaround time (V. Singh et al., 1996). Other tests like BACTEC MGIT 960, adenosine deaminase levels (ADA) and molecular tests like polymerase chain reaction (PCR) have been used for the diagnosis of abdominal TB, and have the advantage of being more rapid and sensitive. The use of PCR has been proposed in a few studies to increase the sensitivity (30–82.6%) and specificity (95–100%) of the diagnosis of abdominal TB (Yonal and Hamzaoglu, 2010). Majority of the PCR assays evaluated for diagnosis of abdominal TB have targeted IS6110 gene, as there are multiple copies of IS6110 in the M. tuberculosis genome (1–25 copies/genome), which was thought to confer higher sensitivity to PCR assays (Narayanan, 2004). However, it has been shown that some Indian strains of M. tuberculosis do not contain IS6110 or have low copy numbers of this gene, thus missing these cases (Das et al., 1995). Such cases can be detected using multiplex PCR approach, including other well characterized genes in the assay like devR for M. tuberculosis and16SrRNAwhich recognizes Mycobacterium species. DevR is a component of devR-devS, a 2-component regulatory system which is differentially expressed in virulent strains of M. tuberculosis, and is well conserved (Kinger and Tyagi, 1993; K. K. Singh et al., 2000). A multiplex
52
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
PCR targeting these genes would increase the sensitivity of detection as well as allow identification of other pathogenic NTM causing gastrointestinal disease. In the present study we developed a multiplex PCR for the diagnosis of abdominal TB (intestinal TB and peritoneal TB), targeting 3 genes viz.16SrRNA for Mycobacteria spp., M. tuberculosis complex specific IS6110 and devR, and compared it with simple PCR targeting each of these genes individually in both the groups, and also with ADA levels in peritoneal TB group. 2. Material and methods 2.1. Subjects A total of 183 samples (80 endoscopic biopsies, 16 intraoperative biopsies and 87 ascitic fluid samples) were obtained from 183 patients with clinical suspicion of abdominal TB (96 patients with intestinal TB and 87 with peritoneal TB) attending the outpatient department or admitted to the Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India, from February 2010 to July 2011. The study was approved by the Institute Ethics Committee of PGIMER, Chandigarh, and written informed consent was obtained from all the subjects enrolled in the study. The following inclusion criteria were used for patients in the two groups: Intestinal TB group included patients with presence of constitutional features (fever, night sweats, fatigue, and loss of appetite), abdominal pain, alteration in bowel habit (diarrhea, constipation, or both), acute abdomen, and abdominal mass; Peritoneal TB group included patients with the above constitutional features, abdominal pain, ascites and palpable abdominal masses formed by mesenteric lymph nodes. Patients with disseminated and miliary TB were excluded from the study. A detailed history was recorded and thorough clinical examination was done for each patient. All patients were subjected to routine radiological and laboratory investigations. Patients in whom the diagnosis of intestinal TB or peritoneal TB, was confirmed by laboratory investigations, viz. presence of acid fast bacilli (AFB) on smear examination, and/or culture positivity for M. tuberculosis, and/or caseating granulomas on histopathology, or a clinical response to anti-tubercular treatment (ATT) were included in the test groups, and patients in whom an alternate diagnosis was established following complete clinical, radiological, and laboratory investigations were included in the control groups. The patients in the control group for intestinal TB comprised of 22 patients with idiopathic ulcerative colitis; 14 with Crohn’s disease; 12 with intestinal malignancy; and 8 others with conditions like typhoid perforation, cytomegalovirus colitis, and peptic ulcer disease. The control group for peritoneal TB consisted of 23 patients with chronic liver disease; 7 with congestive heart failure; 7 with peritoneal malignancy; and 13 others with conditions like pancreatitis, bacterial sepsis with multiorgan dysfunction, peptic ulcer disease with perforation peritonitis, and chronic kidney disease. All the 183 subjects were followed over a period of 6 months and clinical response to ATT in confirmed TB cases was recorded by regression of lesions and absence of any systemic symptoms (fever, cough, and weight loss). 2.2. Sample collection and processing All the samples (endoscopic biopsies, intraoperative biopsies and ascitic fluid) were collected, transported to the laboratory, and
processed as per standard protocols (Drossman et al., 2005; Isenberg and American Society for Microbiology, 2004; Vestal and United States. National Communicable Disease Center. Laboratory Consultation and Development Section., 1969). Briefly, tissue samples were homogenized using tissue homogenizer and subjected to digestion and decontamination using the NALC-NaOH method as per standard protocol described elsewhere (Vestal and United States. National Communicable Disease Center. Laboratory Consultation and Development Section., 1969). About 100 mL of ascitic fluid sample was centrifuged at 3000 rpm for 20 minutes to obtain a cell pellet which was reconstituted in 1 mL of sterile phosphate-buffered saline (pH 7.2). The sediment obtained from tissue and fluid was divided into different volumes and subjected to Ziehl Neelsen staining (100 μL), Auramine O staining (100 μL), culture on LJ media (100 μL), and BACTEC MGIT 960 (500 μL) as per standard protocols (Department of Medical Microbiology). In addition, the tissue samples were also subjected to histological examination by hematoxylin eosin and Ziehl Neelsen staining (Department of Histopathology), and ADA level (Department of Gastroenterology) were estimated for ascitic fluids using modified Giusti method as per the standard protocol described elsewhere(Bandyopadhyay et al., 2008). An ADA level of more than 36 IU was taken as positive(M. P. Sharma and Bhatia, 2004). All the readings were taken by two independent observers for each of the tests, who were blinded to the patient's clinical and demographic data and the results of other investigations. 2.3. DNA extraction DNA was extracted from the sediments using the standard protocol of Van Embden et al. with minor modifications (van Embden et al., 1993). Briefly, 200 μL of the sediment was suspended in 400 μL of Tris-EDTA buffer and heated at 100 °C for 5 minutes. After cooling to room temperature, 40 μL of lysozyme was added and the suspension was incubated at 37 °C for 2 hours, after which 80 μL of 10% SDS and 5 μL proteinase K were added and the mixture was vortexed and incubated at 65 °C for 30 minutes. This was followed by addition of 30 μL of 5M NaCl and 64 μL of cetyl-N,N,N-trimethyl ammonium bromide (CTAB/NaCl) solution and incubation of 30 minutes at 65 °C. The DNA contaminants were removed by phenol: chloroform: isoamyl alcohol (25:24:1) treatment and subsequently DNA was precipitated by addition of 0.6 volumes of isopropanol. The precipitate was washed with 70% ethanol, dried, dissolved in 30 μL of Tris EDTA buffer, and stored at −70 °C till used. All tests were performed within 72 hours of collecting the samples. 2.4. Simple PCR assays Simple PCR assays were standardized with different temperatures and concentrations of reagents. All the reagents used for the PCR were obtained from Sigma Genosys (Sigma-Aldrich Chemicals Pvt. Ltd., Bangalore, India). The oligonucleotide primers listed in Table 1 were used for the PCR assays. The master mix (50 μL) was prepared by adding PCR buffer 10X, dNTP mix (10 mmol/L), all primers used in equimolar concentrations (10 pmol/L), Taq polymerase (5U/μL), DNA(3 μL) template and PCR grade water. DNA amplification was done in a thermocycler (Master cycler, Eppendorf, USA) for 35 cycles following an initial denaturation for 5 minutes as follows: denaturation at 95 °C for 1 minutes, annealing at 55 °C, 62 °C, and 62 °C for
Table 1 List of primers. Gene
Forward
Reverse
16SrRNA (590bp genus specific) (Richter et al., 1995) IS6110 (123bp Complex specific) (M. Sharma et al., 2010) devR (162 bp complex specific) (Haldar et al., 2009)
5′AGAGTTTGATCCTGGCTCAG3′ 5′CCTGCGAGCGTAGGTCGG3′ 5′ATCTGTTGTCCCGCATGCC 3′
5′TTTCACGAACAACGCGACAA3′ 5′CTCGTCCAGCGCCGCTTCGG3′ 5′GTCCAGCGCCCACATCTTT3′
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
16SrRNA, IS6110, and devR for 1 min, respectively, and extension at 72 °C for 1 minutes, followed by final extension at 72 °C for 1 minute. Each batch of the PCR assays included a positive control viz. DNA from H37Rv and PCR grade water was used as negative control. The amplified products were run in 1.5% agarose gel containing ethidium bromide, and visualized in ultra-violet light in a gel documentation system in the Department of Medical Microbiology (AlphaImager 3400, AlphaInnotech, USA). 2.5. Multiplex PCR The above three primer sets were combined in an equimolar ratio in a single tube and standardized with different temperatures for multiplex PCR in the Department of Medical Microbiology. The optimum annealing temperature used was 57 °C for the multiplex PCR, while the rest of the protocol was similar to the single PCR assays. The results of the multiplex PCR were interpreted as M. tuberculosis infection when bands for all three genes were present and/or band against IS6110 (123bp) and/or devR (162bp) was present, while the presence of only 16SrRNA (590bp) band was interpreted as NTM infection. 2.6. Statistical analysis Because culture is negative in many cases of extrapulmonary TB and none of the tests employed for the diagnosis of abdominal TB are 100% sensitive, we considered the following criteria for defining a case of abdominal TB: (A) positive culture for M. tuberculosis (B) presence of AFB on smear examination and/or caseating granulomas on histopathology with AFB (if culture negative) (C) clinical response to ATT (if all above were negative). Sensitivity, specificity, positive predictive values, and negative predictive values with confidence intervals were calculated for each test using standard formulae. The statistical analysis was carried out using the software SPSS, v. 17.0 (SPSS South Asia Pvt. Ltd., Bangalore, India).
53
3. Results A total of 183 clinical suspects of abdominal TB were enrolled in the study (96 patients with intestinal TB and 87 with peritoneal TB). No adverse events were observed while obtaining samples from the patients for the study. The demographic and clinical details of the patients in the two study groups (intestinal and peritoneal TB) are given in the Table 2. In the intestinal TB group, constipation was the most common feature present in 75% (30/40) of the patients, followed by loss of weight in 70% (28/40), moderate anemia in 70% (28/40) and abdominal pain in 67.3% (27/40) cases. In the peritoneal TB group, the most common feature was abdominal distension in 97.3% (36/37) patients, followed by fever in 94.6% (35/37) and loss of weight in 75.7% (28/37) patients. A past history of TB was present in 10 (25%) cases in intestinal TB group and 6 (16.2%) in the peritoneal TB group. Mantoux test was positive in 27 (67.5%) and 18 (48.6%) patients in the intestinal and peritoneal TB groups, respectively. A clinical diagnosis of abdominal TB was attained in 27 (including 11 cases which were negative by investigations but responded to ATT) of the 40 cases in the intestinal TB group and 15 (including 3 cases which were negative by investigations but responded to ATT) of the 37 cases in the peritoneal TB group. The commonest radiological finding in cases amongst intestinal TB group was asymmetric bowel wall thickening in 28 patients, followed by loco-regional lymphadenopathy with necrotic lymph nodes in 6, and omental thickening in 5 patients on computed tomographic scan and ultrasonography (USG), while in the peritoneal TB group, ascites with septations was the commonest finding present in 11 patients on USG. Auramine O staining identified 11 (27.5%), and ZN staining identified 8 (20%) of the 40 cases in the intestinal TB group. Both the staining techniques identified only 2 (5.4%) cases in the peritoneal TB group. LJ medium was able to detect 8 (20%) and 3 (8.1%) cases, while culture on BACTEC MGIT 960 detected 24 (60%) and 6 (16.21%) cases in intestinal and peritoneal TB groups, respectively. Histopathology was positive in 24 (60%) of the cases in intestinal TB group, 2
Table 2 Clinical and demographic features of the study groups. Age
Intestinal TB Cases (%)
Control (%)
Cases (%)
Control (%)
n = 40
n = 56
n = 37
n = 50
7 (12.5) 24 (42.9) 19 (33.9) 6 (10.7)
9 13 11 4
(24.3) (35.1) (29.7) (10.8)
7 (14.0) 26 (52.0) 12 (24.0) 5 (10.0)
31 (55.4) 25 (44.6)
19 (51.4) 18 (48.6)
29 (58.0) 21 (42.0)
40 (71.4) 19 (33.9) 24 (42.9) 24 (42.9) 24 (42.9) 39 (69.6) 5 (8.9) 15 (26.8) 8 (14.3) 4 (7.1) 2 (3.6) 15 (26.8) 1 (1.7) 23 (41.8) 18 (32.1) 16 (28.6)
26 (70.3) 35 (94.6) 28 (75.7) 20 (54.1) 2 (5.4) 5 (13.5) 8 (21.6) 7 (18.9) 2 (5.4) 36 (97.3) 0 (0) 7 (18.9) 6 (16.2) 2 (5.4) 15 (40.5) 18 (48.6)
24 (48.0) 34 (68.0) 16 (32.0) 22 (44.0) 4 (8.0) 9 (18.0) 19 (38.0) 23 (46.0) 50 (100) 12 (24.0) 1 (2.0) 12 (24.0) 0 (0) 2 (4.0) 22 (59.5) 9 (18.0)
Age distribution of study groups 0-20 7 (17.5) 21-40 17 (42.5) 41-60 12 (30.0) N60 4 (10.0) Sex distribution of patients in different study groups Male 22 (55.0) Female 18 (45.0) Symptoms/signs/lab parameters in cases in each group Abdominal pain 27 (67.5) Fever 23 (57.5) Loss of weight 28 (70.0) Loss of appetite 22 (55.0) Diarrhea 13 (32.5) Constipation 30 (75.0) Nausea and Vomiting 12 (30.0) Hepatomegaly 6 (15.0) Splenomegaly 2 (5.0) Abdominal distension 12 (30.0) Abdominal mass 7 (17.5) Lymphadenopathy 9 (22.5) Past history of TB 10 (25.0) Blood in stools 11 (27.5) Moderate anemia 28 (70.0) Mantoux test# 27 (67.5) # Induration N15 mm was considered as positive.
Peritoneal TB
78.1% 67.6% 79.4% 84.7% 93.7% (82.2–100) (71.7–100) (82.8–100) (85–100) (69.5–93.7) 100% 100% 100% 100% 85% (91.1–100) (91.1–100) (91.1–100) (91.1–100) (75–95) 100% 100% 100% 100% 88% (44.8–77.1) (20.7–52.6) (47.4–79.3) (58.4–87.6) (77–97.9) 62.2% 35.1% 64.9% 75.7% 91.9%
Abbreviations: N = number of positives, NA = not applicable, CI = Confidence interval, PPV = Positive predictive value, NPV = Negative predictive value.
Total no of positives
23 13 24 28 34
Peritoneal TB
NPV (95% CI) PPV (95% CI) Specificity (95% CI) Sensitivity (95% CI) Method
Table 4 Results of PCR assays and ADA for diagnosis of abdominal TB.
In this study, we evaluated patients with abdominal TB by multiplex PCR targeting three genes, two of which, i.e., IS6110 and devR are specific for M. tuberculosis and 16SrRNA, which identifies members of the Mycobacterium genus, and compared the assay with simple PCR targeting each of these genes individually, and other conventional tests used for the diagnosis of abdominal TB. We found young adults between 21–40 years to be most commonly affected age group, followed by 41–60 years, which is in agreement with the previous studies(Muneef et al., 2001). No sex predilection was observed in any of the groups of abdominal TB in our study. Overall a high sensitivity of Mantoux test was found in our study, and it was more so in the intestinal TB group as compared to the peritoneal TB group. This is in agreement with the previous studies which showed a sensitivity ranging between 58–100% (Kapoor, 1998; Manohar et al., 1990). The utility of Mantoux test in the diagnosis of abdominal tuberculosis is questionable as it does not differentiate between active disease and previous sensitization by contact or vaccination (Kapoor, 1998). Loss of weight and constipation were the commonest presenting complaints in patients with intestinal TB, while fever and abdominal distension were the commonest presenting complaints in patients with peritoneal TB. Similar findings have been reported previously, and one third of the patients with abdominal TB are known to present with systemic manifestations which are more frequent in patients with ulcerative intestinal lesions and ascitic peritoneal tuberculosis (V. Singh et al., 1995; Szmigielski et al., 1998). Overall, the PCR assays showed a good sensitivity and specificity in our evaluation. Multiplex PCR performed better than the simple PCR assays and other conventional tests and was able to detect 87.5% (35/ 40) cases in intestinal TB and 75.7% (28/37) cases in the peritoneal TB group. Two of the 5 cases in the intestinal TB group who were negative by multiplex PCR had no conclusive evidence of TB but responded to ATT. Of the remaining 3, one was positive only by 16SrRNA PCR assay and the other 2 were positive by both IS6110 and devR PCR assays. It is difficult to explain this finding but it could be a result of competitive binding of primers in multiplexing, as there is a low bacillary load in specimens from extrapulmonary TB patients and hence low concen-
Intestinal TB
4. Discussion
Total no of positives
Sensitivity (95% CI)
Specificity (95% CI)
of which were not detected by multiplex PCR (Table 3). ADA was positive in 34 (91.9%) of the 37 cases in the peritoneal TB group, 6 of which were negative by multiplex PCR. Falsely elevated levels of ADA were seen in 6 of the controls. In the intestinal TB group, 32 (80%), 31 (77.5%), and 24 (60%) cases were positive by devR, IS6110, and 16SrRNA PCR, while 35 (87.5%) cases were positive by multiplex PCR assay. Similarly, in the peritoneal TB group 24 (64.9%), 23 (62.2%), and 13 (35.1%) cases were positive by devR, IS6110, and 16SrRNA PCR while 28 (75.7%) were positive by multiplex PCR. Therefore, multiplex PCR exhibited the highest sensitivity followed by devR and IS6110 PCR in both the groups. Multiplex PCR was positive in all smear positive cases in both the groups, and detected all the cases that were positive on culture in peritoneal TB group. However, it did not detect 2 cases in the intestinal TB group which were identified by BACTEC MGIT 960. The results of various PCR assays are summarized in Table 4.
(74.1–92.9) (66.1–86.4) (76.3–94.1) (80.6–96.8)
Abbreviations: N = number of positives, NA = not applicable.
85.7% 77.8% 87.1% 91.5% NA
2 (5.4) 2 (5.4) 3 (8.8) 6 (16.2) NA
93.9% (78.4–98.9) 100% (82.8–100) 94.1% (78.9–99) 94.6% (80.5–99.1) NA
11 (27.5) 8 (20.0) 8 (20.0) 24 (60.0) 24 (60.0)
96.4% (86.6–99.4) 100% (92–100) 96.4% (97.9–99) 96.4% (86.6–99.4) NA
Auramine staining Ziehl Neelsen staining Culture on LJ medium Culture on BACTEC MGIT 960 Histopathology
77.5% (61.1–88.6) 60% (43.4–74.8) 80% (63.9–90.4) 87.5% (72.4–95.3) NA
Peritoneal TB (n = 37); n (%)
31 24 32 35 NA
Intestinal TB (n = 40); n (%)
PPV (95% CI)
Method
NPV (95% CI)
Table 3 Results of conventional tests for diagnosis of abdominal TB.
(65.7–87.1) (55.6–77.7) (67.0–88.1) (72.5–92.4) (81.4–98.3)
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
PCR IS 6110 PCR 16sRNA PCR devR Multiplex PCR ADA
54
V. Hallur et al. / Diagnostic Microbiology and Infectious Disease 76 (2013) 51–55
tration of DNA available for amplification. The lowest sensitivity was observed with the 16SrRNA simple PCR with a sensitivity of 60% and 35.1% for intestinal and peritoneal TB, respectively. Poor sensitivity of this primer has also been reported in skin biopsies of patients with cutaneous TB by Ogusuku et al. and was attributed to the fact that it was single copy gene (Ogusuku et al., 2003). However, a study by Richter et al. reported that the sensitivity of this primer was N90% in formalinfixed paraffin embedded tissues (Richter et al., 1995). There was only one sample which was positive for single band of 16SrRNA on multiplex PCR in a culture positive sample and was confirmed to be M. tuberculosis by biochemical tests. It was observed that devR PCR was able to detect an extra case in both the groups (intestinal and peritoneal TB) than IS6110, resulting in a marginal increase in sensitivity. We observed that the sensitivity of single PCR as well as multiplex PCR assay was lower for peritoneal TB in comparison to ADA (Table 4). These findings in peritoneal fluid are in contrast to the findings of Bandyopadhyay et al. who found that multiplex PCR was more sensitive than ADA in extrapulmonary TB (Bandyopadhyay et al., 2008). In our study, we found that 12 (30%) cases in the intestinal TB group and 3 (8%) in the peritoneal TB group, who did not have any laboratory features suggestive of abdominal TB but responded to ATT, were positive by PCR. This indicates that absence of conventional laboratory features (smear, histopathology, ADA, and culture) does not rule out abdominal TB. When combined with histopathology, multiplex PCR could detect 97.5% (39/40) of all the cases in the intestinal TB group. Hence, multiplex PCR could be effectively used in combination with histopathology for rapid and accurate diagnosis of intestinal TB. Similarly, in peritoneal TB, multiplex PCR could detect 75.7% (28/37) cases. ADA level estimation helped to detect 6 additional cases, though the specificity of ADA was found to be lower (88%) as compared to multiplex PCR (100%). Falsely elevated ADA levels are known in conditions like lymphoma, and in such cases multiplex PCR can be helpful to establish the diagnosis. It is notable to observe that there were two specimens in the intestinal TB group which were positive by IS6110, devR PCR as well as multiplex PCR, but were negative by other laboratory investigations, and the patients did not respond to ATT over 6-month follow-up period. These 2 patients were hence grouped in controls as per the preset criteria for positivity, and the samples were considered to be false positive, consequently affecting the specificity of these assays (96.4%). We ruled out laboratory contamination, as negative and positive controls were included in all DNA extraction, amplification, and detection procedures. However, both these patients had CMV colitis and treatment with both ganciclovir and ATT did not improve the clinical status over a period of 6 months. The immunosuppressed state induced by CMV could be a possible reason for non-response to ATT. Also, no response to ATT has been observed in small percentage of TB patients and cannot be totally ruled out (Bolukbas et al., 2005). In conclusion, we developed a multiplex PCR assay that can be a valuable rapid diagnostic modality for patients suspected of abdominal TB, especially in cases where other conventional laboratory investigations are negative or inconclusive. Multiplex PCR exhibited the highest sensitivity and specificity among all the tests in both the intestinal TB and peritoneal TB group, except for ADA level estimation in peritoneal TB group which had a higher sensitivity than multiplex PCR. If combined with histopathology in suspected intestinal TB cases and ADA testing in suspected peritoneal TB cases, multiplex PCR can prove to be a very useful diagnostic tool by virtue of its high sensitivity, specificity, rapidity, and the ability to supplement the limitations of other diagnostic modalities.
55
References Agarwal SP, Chauhan LS, India. Directorate General of Health Services. Tuberculosis control in India. New Delhi: Directorate General of Health Services, Ministry of Health and Family Welfare; 2005. Bandyopadhyay D, Gupta S, Banerjee S, Ray D, Bhattacharya S, Bhattacharya B. Adenosine deaminase estimation and multiplex polymerase chain reaction in diagnosis of extra-pulmonary tuberculosis. Int J Tuberc Lung Dis 2008;12:1203–8. Bolukbas C, Bolukbas FF, Kendir T, Dalay RA, Akbayir N, Sokmen MH, et al. Clinical presentation of abdominal tuberculosis in HIV seronegative adults. BMC Gastroenterol 2005;5:21. Das S, Paramasivan CN, Lowrie DB, Prabhakar R, Narayanan PR. IS6110 restriction fragment length polymorphism typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras, south India. Tuber Lung Dis 1995;76:550–4. Drossman DA, Grimm IS, Shaheen NJ. Handbook of gastroenterologic procedures. 4th ed. Philadelphia: Lippincott Williams & Wilkins; 2005. Gan H, Ouyang Q, Bu H, Li S, Chen D, Li G, et al. Value of polymerase chain reaction assay in diagnosis of intestinal tuberculosis and differentiation from Crohn's disease. Chin Med J (Engl) 1995;108:215–20. Haldar S, Sharma N, Gupta VK, Tyagi JS. Efficient diagnosis of tuberculous meningitis by detection of Mycobacterium tuberculosis DNA in cerebrospinal fluid filtrates using PCR. J Med Microbiol 2009;58:616–24. Isenberg HD, American Society for Microbiology. Clinical microbiology procedures handbook. 2nd ed. Washington, DC: ASM Press; 2004. Kapoor VK. Abdominal tuberculosis. Postgrad Med J 1998;74:459–67. Kinger AK, Tyagi JS. Identification and cloning of genes differentially expressed in the virulent strain of Mycobacterium tuberculosis. Gene 1993;131:113–7. Manohar A, Simjee AE, Haffejee AA, Pettengell KE. Symptoms and investigative findings in 145 patients with tuberculous peritonitis diagnosed by peritoneoscopy and biopsy over a five year period. Gut 1990;31:1130–2. Muneef MA, Memish Z, Mahmoud SA, Sadoon SA, Bannatyne R, Khan Y. Tuberculosis in the belly: a review of forty-six cases involving the gastrointestinal tract and peritoneum. Scand J Gastroenterol 2001;36:528–32. Narayanan S. Molecular epidemiology of tuberculosis. Indian J Med Res 2004;120: 233–47. Ogusuku MM, Sadahiro A, Hirata MH, Hirata RD, Zaitz C, Salem JI. PCR in the diagnosis of cutaneous tuberculosis. Braz J Microbiol 2003;34:165–70. Richter E, Schluter C, Duchrow M, Hahn M, Rusch-Gerdes S, Galle J, et al. An improved method for the species-specific assessment of mycobacteria in routinely formalinfixed and paraffin-embedded tissues. J Pathol 1995;175:85–92. Safarpor F, Aghajanzade M, Kohsari MR, Hoda S, Sarshad A, Safarpor D. Role of laparoscopy in the diagnosis of abdominal tuberculosis. Saudi J Gastroenterol 2007;13:133–5. Shah SR, Shenai S, Desai DC, Joshi A, Abraham P, Rodrigues C. Comparison of Mycobacterium tuberculosis culture using liquid culture medium and Lowenstein Jensen medium in abdominal tuberculosis. Indian J Gastroenterol 2010;29:237–9. Sharma MP, Bhatia V. Abdominal tuberculosis. Indian J Med Res 2004;120:305–15. Sharma M, Sethi S, Mishra AK, Chatterjee SS, Wanchu A, Nijhawan R. Efficacy of an inhouse polymerase chain reaction assay for rapid diagnosis of Mycobacterium tuberculosis in patients with tubercular lymphadenitis: comparison with fine needle aspiration cytology and conventional techniques. Indian J Pathol Microbiol 2010;53:714–7. Singh V, Jain AK, Agrawal AK, Gupta S, Khanna S, Khanna AK, et al. Clinicopathological profile of abdominal tuberculosis. Br J Clin Pract 1995;49:22–4. Singh V, Kumar P, Kamal J, Prakash V, Vaiphei K, Singh K. Clinicocolonoscopic profile of colonic tuberculosis. Am J Gastroenterol 1996;91:565–8. Singh KK, Muralidhar M, Kumar A, Chattopadhyaya TK, Kapila K, Singh MK, et al. Comparison of in house polymerase chain reaction with conventional techniques for the detection of Mycobacterium tuberculosis DNA in granulomatous lymphadenopathy. J Clin Pathol 2000;53:355–61. Szmigielski W, Venkatraman B, Ejeckam GC, Jarikre LN. Abdominal tuberculosis in Qatar: a clinico-radiological study. Int J Tuberc Lung Dis 1998;2:563–8. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol 1993;31:406–9. Vestal AL, United States, National Communicable Disease Center, Laboratory Consultation and Development Section. Procedures for the isolation and identification of mycobacteria. Atlanta: National Communicable Disease Center, Laboratory Consultation and Development Section; 1969 [for sale by the Supt. of Docs., U.S. Govt. Print. Off., Washington]. Yamada T, Alpers DH. Textbook of gastroenterology. 4th ed. Philadelphia: Lippincott Williams & Wilkins; 2003. Yamazaki R, Mori T, Nakazato T, Aisa Y, Imaeda H, Hisamatsu T, et al. Non-tuberculous mycobacterial infection localized in small intestine developing after allogeneic bone marrow transplantation. Intern Med 2010;49:1191–3. Yonal O, Hamzaoglu HO. What is the most accurate method for the diagnosis of intestinal tuberculosis? Turk J Gastroenterol 2010;21:91–6.