Development of a novel candidate subunit vaccine against Grass carp reovirus Guangdong strain (GCRV-GD108)

Fish & Shellfish Immunology 35 (2013) 351e356

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Development of a novel candidate subunit vaccine against Grass carp reovirus Guangdong strain (GCRV-GD108) Yuanyuan Tian, Xing Ye*, Lili Zhang, Guocheng Deng, Yueqiang Bai Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Lab of Aquatic Animal Genetic Engineering and Molecular Breeding, CAFS, Ministry of Agriculture Key Lab of Tropic & Subtropic Fisheries Resource Utilization and Aquaculture, Guangzhou 510380, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 6 November 2012 Received in revised form 23 April 2013 Accepted 23 April 2013 Available online 9 May 2013

Grass carp reovirus Guangdong 108 strain (GCRV-GD108) was recently isolated in Guangdong province, China. M6 gene of GCRV-GD108 was speculated encoding virus major outer capsid protein VP4. Blast analysis showed that the amino acid sequence of GCRV-GD108 VP4 was homologous to the structural protein VP4 of known Aquareoviruses (27.3e32.9%). Immunogenicity prediction by DNAStar software revealed there were multiple B cell epitopes on GCRV-GD108 VP4. Prokaryotic expression vector pET32a was used to express VP4 recombinant protein (rVP4) in E. coli BL21(DE3) strain. As expected, the molecular weight of recombinant VP4 was about 87 kDa showed by SDS-PAGE result. Neutralization assay demonstrated that the rabbit polyclonal antibody of rVP4 could prevent virus infection efficiently. After 14 days immunization with the rVP4, grass carps were challenged with GCRV-GD108, the results showed that different doses of rVP4 (1 mg/g, 3 mg/g and 5 mg/g) all provided protection against virus infection (47e82%). The relative percent survival reached 82% in the group immunized with 3 mg/g of rVP4. ELISA revealed rVP4 induced high antibody titer in immunized fish. IgM expression levels in head kidney of grass carp were detected by RT-PCR, and the results showed that IgM expressed at a significantly higher level in immunization groups than in blank control, indicating the rVP4 can induce strong immune response. In conclusion, rVP4 is a candidate vaccine against GCRV-GD108. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: VP4 Outer capsid protein B cell epitopes Neutralization assay Relative percent survival

1. Introduction Aquareovirus (AQRV) is a genus of the family Reoviridae that infect aquatic animals. AQRV genome is composed of 11 dsRNA segments. Seven genetic groups (A to G) were established in AQRV according to the different electrophoretype of genome. In 1983, Grass carp hemorrhage virus was first reported in China [1], and was named as Grass carp reovirus (GCRV) in 1991 by the International Committee on Taxonomy of Viruses (ICTV) [2]. GCRV belongs to Group C of AQRV and is the most virulent strain in AQRVs [3]. The 11 dsRNA segments of GCRV genome encode 12 proteins including 7 capsid proteins and 5 non-structural proteins. The segmented viral genome results in high complexity and variability between different strains of GCRV, and more than 10 strains have been reported so far. A highly virulent strain was isolated recently from cultured grass carp with hemorrhage disease in Guangdong province, named ‘Grass carp reovirus Guangdong strain’ (GCRVGD108). The genome of GCRV-GD108 is composed of 11 dsRNA

* Corresponding author. E-mail address: [email protected] (X. Ye). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.04.022

segments as GCRV, but only encodes 11 proteins. In addition, its genome shows very different molecular properties comparing to other reported GCRV strains. Phylogenetic analysis showed that GCRV-GD108 may be a new species of genus Aquareovirus and is closer to Orthoreoviruse than any known species of Aquareovirus [4]. RT-PCR was used to detect hemorrhagic tissue of grass carps cultured in Guangdong, Fujian, Hunan and other provinces in China and the results indicated that GCRV-GD108 was a representative strain in southern China [5]. Grass carp (Ctenopharyngodon idellus) is an important freshwater aquaculture species widely cultured in Asian countries, such as China. But grass carp is vulnerable to GCRV infection especially during the fingerling stage (4 to 5 month old), resulting in more than 80% mortality rate [6]. Because of the importance of grass carp in Chinese aquaculture, GCRV vaccine development has been a hot research area. Inactivated tissue vaccine is effective in preventing viral hemorrhagic disease in grass carps, but it has limitations such as finite sources and regional variability. With the development of fish cell culture technique, grass carp kidney cell line was established successfully and subsequently inactivated virus vaccine and attenuated virus vaccine were prepared. Compared with inactivated and attenuated virus vaccine, genetically engineered vaccine

352

Y. Tian et al. / Fish & Shellfish Immunology 35 (2013) 351e356

has advantages of low cost, no pathogenicity, being able to be formed multivalent vaccine, etc. To prepare a genetically engineered vaccine, selection of the appropriate antigen or virulence genes is the first key step. Among the 7 capsid proteins of AQRVs, VP1, VP2, VP3, VP5 and VP6, corresponding to l2, l3, l1, m2 and s2 of mammalian orthoreovirus (MRV) respectively, compose the viral core and inner capsid. They play critical roles in viral transcription and replication. The outer layer of AQRVs capsid is composed of VP4 and VP7, corresponding to MRV m1 and s3. They play roles in viral entry into host cells [7]. As a component of the outer layer of viral capsid, VP4 is encoded by segment 6 of AQRVs, including GCRV, AGCRV, GSRV, CSRV and TRV, as well as GCRV-GD108, and VP4 is m1 homolog of ORV [4]. (Note: As pointed out by Kim et al. [8], the numbers for VP4 and VP5 of GCRV have been swapped in recent papers, i.e., m1 homolog VP4 was previously named VP5 and m2 homolog VP5 was previously named VP4 in GCRV [9,10]). In this paper, when segment 6 encoded protein of GCRV was mentioned, the previously named VP5 was used to represent m1 homolog, while segment 5 encoded protein of GCRV named VP4 represent m2 homolog in order to keep accordance with the references. Zhang et al. expressed recombinant VP5 of GCRV in E. coli and demonstrated its high immunogenicity by ELISA [11]. He et al. demonstrated that rabbit polyclonal antibody against GCRV rVP5 could provide protection against virus infection by neutralization experiments [12]. Shao et al. prepared recombinant GCRV VP5 and VP7 protein and antibodies against them. Neutralization experiments results showed both antibodies were able to neutralize GCRV, and the neutralizing activity of VP7 antibody was 3 times higher than VP5 antibody, and the mixture of VP5 and VP7 antibodies could enhance their neutralizing capacity [13]. In the current study, recombinant VP4 protein of GCRV-GD108 was expressed in prokaryotic expression system and its immunogenicity and protective effect were studied.

clustered together in the bootstrap test (1000 replicates) was shown next to the branches [16]. Online services, http://blast.ncbi. nlm.nih.gov, http://pfam.janelia.org/, http://expasy.org/tools/# proteome and conserved domain database (CDD) were used for alignment, conserved domain and structure analysis. DNAstar software (DNASTAR, USA) was used to analyze amino acid sequence of VP4. Protein hydrophilicity, surface probability and antigenic index were predicted according to KyteeDoolittle, Emini and JamesoneWolf, respectively [17e19]. The most possible B cell epitopes were determined by high index value (Hydrophilicity >0, Antigenic index >0, Surface probability >1).

2. Materials and methods

The inclusion bodies were resuspended in denaturing buffer (0.1 M TriseCl (pH 8.0), 10 mM DTT, 8 M urea) and dialyzed twice against for 24 h binding buffer before purification. Proteins were purified with His$bind kits (Novagen, USA) pre-charged with Ni2þ. The purification was performed according to the manufacturer’s protocol. To remove imidazole, the purified proteins were dialyzed twice against PBS for 24 h and then kept at 4
C. The protein concentration was detected by measuring the absorption at 280 nm using BSA as a standard, and the purity was monitored by SDSPAGE.

2.1. Virus and bacteria GCRV-GD108 was isolated and propagated in grass carp snout fibroblast cell line using an established method as described previously [4]. E. coli DH5a and BL21 (DE3) strains (Takara, Dalian, China) were cultured in LuriaeBertani (LB) broth at 37
C. 2.2. Fish Grass carp weighing 25e30 g were obtained from Seedling Production Base of Pearl River Fisheries Institute (Guangzhou, China) and acclimatized in the laboratory for two weeks before experimental manipulation. Fish were fed daily. Water temperature was maintained at 28
C. Before experiments, fish were randomly sampled for the examination of virus from liver, kidney, and spleen. No virus was detected from any examined tissues of the sampled fish by RT-PCR according to methods described previously [5]. 2.3. Cloning of M6 and structure analysis M6 gene was cloned from the genome of the GCRV-GD108 and inserted into a pMD-18T vector (Takara, Dalian, China) and then transformed into E. coil DH5a for sequence and storage. Detailed methods were described previously [4]. Sequence analysis was performed using the Clustal W software program [14] and MEGA 5.0 [15]. Phylogenetic analysis was carried out using the Maximum likelihood method of the mega program. Percentage of the replicate trees in which the associated taxa

2.4. Plasmid construction and expression According to the sequence of ORF of GCRV-GD108 M6 gene (GenBank accession number: ADT79743) and vector pET32a, a pair of primers with BamHI and NotI cleavage site were designed to amplify the ORF of VP4. Sequences of the primers were: Forward: 50 -CCCGGATCCGGAAACGTCCAGACGAACA -30 underlined nucleotides were BamHI site, reverse: 50 - CCCGCGGCCGCAGACGGAGGAGGCCAGTATC -30 underlined nucleotides, were NotI site. PCR products were digested with BamHI and NotI and inserted into plasmid pET32a (Novagen, USA), then transformed into E. coli BL21 (DE3). The recombinant strain was grown in LB medium containing 50 mg/ml ampicillin, and shaking cultured at 37
C overnight. After induction with 0.5 mM final concentration isopropyl-b-D-Thiogalactopyranoside (IPTG) (Weijia, Guangzhou, China) for 4 h, bacterial cells were collected by centrifugation followed by resuspension with PBS containing 0.2% TritonX-100. Cells were lysed by sonication and then centrifuged at 10, 000 rpm for 30 min at 4
C. Supernatant and pellet were both collected and analyzed by 10% SDS-PAGE stained by coomassie-blue [20]. 2.5. Purification of the recombinant protein

2.6. Preparation of polyclonal antibody and enzyme-linked immunosorbent assay (ELISA) Before immunization, 3e4 ml blood of New Zealand white rabbit was collected as negative serum control. Each rabbit was injected at multiple points subcutaneously with 0.2 mg of rVP4 emulsified in Freund’s complete adjuvant (FCA), and boosted immunization was performed with 0.2 mg rVP4 at day 14, 28, 35 and 42. The blood was collected at day 49 to prepare antiserum. Titer of antiserum was determined by ELISA. Briefly, 100 ml stock solutions containing 1 mg rVP4 were added to each well of 96-well plate. After incubation overnight at 4
C, plates were washed and blocked with 5% skimmed milk powder blocking buffer. Plates were washed and 4-fold dilutions of test sera were added to the plates. After incubation at 37
C for 1 h, plates were washed and incubated with peroxidase-conjugated sheep anti-rabbit antibodies (Weijia, China) at 37
C for 1 h. Plates were washed again, 0.1 ml TMB (Weijia, China) was added and color developed for 30 min at room temperature. The reaction was stopped by adding 100 ml 2 M sulfuric

Y. Tian et al. / Fish & Shellfish Immunology 35 (2013) 351e356

acid. After calibration with blank control, OD450nm of samples was read by automated microtiter plate reader. Readout greater than 2.1 fold of negative control was defined as positive. 2.7. Neutralization assay Infectivity of virus treated by rabbit polyclonal antibody was detected. Based on pre-experiment, virus (GCRV-GD108) samples were subjected to serial 1:10 dilutions in phosphate-buffered saline (PBS), diluted to gradient: 102, 103, 104, 105. Fish were divided randomly into 8 groups (10 fish/group, 4 test groups, 4 control groups). Diluted virus was mixed with equivalent volume of immunized rabbit serum and incubated at room temperature for 30 min, non-immunization rabbit serum mixed with diluted virus was used as control, and then injected intramuscularly, 0.1 ml/ fish. Death numbers were recorded for two weeks. LD50 (the median lethal dose) was calculated according to the formula: lgLD50 ¼ Lþd (S-0.5), L is the logarithm of lowest dilution of virus; d is the dilution factor; S is the sum of death ratio of all groups. Neutralization index ¼ LD50 of virus reacted with negative serum/ LD50 of virus reacted with test serum. The neutralization assay was performed twice and data were means of the duplicate experiments.

353

2.10. Detection of IgM mRNA level by real-time qPCR Primers GCI-F and GCI-R were designed to amplify grass carp IgM gene. GCI-F: 50 -CGATGCTTTTGACTACTGGGGA-30 , GCI-R: 50 AGAAGAACACTGAGACAGGGC G-30 (amplification product size: 100 bp). EF1a was used as internal reference gene [21]. EF1a-F:50 AAAATTGGCGGTATTGGAAC-30 , EF1a-R: 50 -TGATGACCTGGGCAGTGA A-30 (274 bp). Total RNA in head kidney of immunized and control grass carp was extracted with Trizol reagents (Invitrogen, USA), and was reverse transcribed into the first strand of cDNA followed by PCR amplification using the following procedure: 55
C, 2 min, 95
C, 10 min; 40 cycles of 95
C, 15 s, 55
C, 30 s, 72
C, 30 s. qRT-PCR procedure was performed as described by Ye et al. [21]. 2DDCt method was used to compare Ct values and calculate relative expression level of IgM mRNA in immunized grass carp head kidney compared to blank control [22]. 2.11. Statistical analysis All statistical analyses were performed using SPSS 15.0 software (SPSS, USA). Differences in mortality, antibody titers, and qRT-PCR were analyzed with Chi-square test, Student t-test and One-way ANOVA. In all cases, the significance level was defined as P < 0.05.

2.8. Immune protection experiments

3. Results

Experimental fish were divided into 5 groups randomly: groups injected with 1, 3 or 5 mg/g (protein/fish weight) respectively, blank group (no injected) and negative control group (injected with PBS) (30 fish/group). Recombinant protein was diluted with PBS and then mixed with equal volume of Freund’s incomplete adjuvant (FIA) and 0.1 ml of the mixture was intraperitoneally injected into each fish. 2 weeks after immunization, immunized fish was challenged with virus at LD50. Numbers of diseased and death fish were monitored over a period of 20 days post-challenge. Repeat experiment was performed as described above. Relative percent survival (RPS) was calculated as: RPS ¼ 1-(death number in immunized group/death number in control group). The accumulated mortalities and RPS given in the results were means of duplicate experiments.

3.1. Sequence and structure analysis of M6 gene

2.9. Determine antibody titer of immunized grass carp by ELISA

The full length of GCRV M6 gene is 2028 bp and it contains a 1953 bp ORF encoding a 650 amino acid peptide. Predicated molecular weight and isoelectric point of VP4 are 68.3 kDa and 5.89. BLAST analysis shows homology between it and VP4 of other Aquareoviruses (27.3e32.9%). It is also homologous to m1 of mammalian orthoreovirus (MRV) and mB of avian orthoreovirus (ARV) (21.6e22.5%). BLAST analysis indicated that it has a major domain of Reovirus M2 superfamily. Phylogenetic analysis based on VP4 amino acid sequence showed that GCRV-GD108 VP4 grouped with species of A-G subgroups of AQRVs but in a separated branch (Fig. 1). B cell epitopes of VP4 predicted by DNAstar software showed that there were 6 possible epitopes in VP4, mostly near the C terminus (Amino acid positions: 4-9, 253-258, 500-505, 532-538, 554-562, 622-626).

7 and 14 days post immunized, five fish were randomly selected to collect blood for ELISA assay from the immunized groups and control groups, respectively. Detailed ELISA protocol was as described above. Fish sera from immunized group and blank group were used as the primary antibody at dilution of 1:200, 1:500 and then serially two-fold dilution to 1:128,000. Horseradish peroxidase (HRP) conjugated rabbit antiserum against grass carp were used as secondary antibody. The secondary antibody was prepared as following: Immunoglobulin IgM was purified from grass carp serum using Protein A affinity chromatography and was analyzed by SDS-PAGE. Molecular weights of the light chain and heavy chain of the purified grass carp IgM were about 25 kDa and 75 kDa, respectively. The purified grass carp IgM was then used to immune New Zealand white rabbit to obtain polyclonal antibodies. Each rabbit was immunized with 200 mg of the purified grass carp IgM mixed with equal volume of FCA for the initial subcutaneous immunization. 3 times of booster injections were performed in 2, 5 and 8 weeks after the initial immunization with the mixture of the purified grass carp IgM and FIA. Blood was collected in 10 weeks. Antibody titer assay by ELISA was similar as described above. The rabbit anti-grass carp IgM antibody was then labeled by HRP using conventional periodate method.

Fig. 1. Phylogenetic tree based on amino acid sequences of VP4 of members of Aquareovirus and Orthoreovirus, using Maximum likelihood method by the mega 5.0 program [15]. The tree with the highest log likelihood (9013.1325) is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches [16]. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 11 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 618 positions in the final dataset. Accession numbers of proteins used in this analysis were showed in Supplemental file.

354

Y. Tian et al. / Fish & Shellfish Immunology 35 (2013) 351e356 Table 2 Survival rates of grass carp immunized with rVP4 followed by GCRV-GD108 challenged. Immunogen/body weight

No. of challenged

No. of survived

Survival rate (%)

RPS (%)

1 mg/g 3 mg/g 5 mg/g Control group

30 30 30 30

21 27 24 13

70% 90% 80% 43%

47% 82% 65%

to 82%. Compared with group immunized with low and high dose of rVP4 (1 mg/g and 5 mg/g), 3 mg/g of rVP4 provided the strongest protection (Table 2). Fig. 2. 10% SDS-PAGE stained by coomassie-blue was used to analyze induced and purified rVP4. The molecular weight of purified rVP4 (arrow pointing) was about 87 kDa as expected. Lane M, protein marker; lane 1, total cell extract of uninduced bacterial; lane 2, total cell extract of IPTG-induced bacterial; lane 3, supernatant after sonicating and centrifuging; lane 4, precipitate after sonicating and centrifuging; lane 5, purified rVP4.

3.2. Expression and purification of recombinant protein and preparation of polyclonal antibody pET32a and M6 PCR product were digested with BamH I and NotI followed by ligation. Recombinant plasmid was transformed into E. coli BL21(DE3) and expressed rVP4 with IPTG induction. As expected, the molecular weight of the expressed protein was about 87 kDa determined by SDS-PAGE. After ultrasonic disruption, the specific protein could only be detected in inclusion bodies, but not in the supernatant, suggesting that the rVP4 expressed mainly in inclusion bodies inside bacterial cells (Fig. 2). rVP4 was purified through Ni2þ affinity column and then used to prepare rabbit polyclonal antibody. Rabbit antibody titer against rVP4 was higher than 1:64,000 as determined by ELISA. No crossreaction was detected for the negative control indicating that rVP4 antibody was successful prepared. 3.3. Neutralization assay ELISA result indicated that anti-VP4 polyclonal antibody was able to combine rVP4. Neutralization assay was then carried out to verify if anti-VP4 serums could block the virus infection. The serial diluted virus samples were incubated with the serum at room temperature for 30 min and then injected into fish. The LD50 of virus reacted with negative serum was 10e3.8, and the LD50 of virus reacted with anti-VP4 serum was 10e1.9. The neutralization index was 79.43, which means that the neutralization activity of anti-VP4 serums was 79.43 folds of the negative serum (Table 1).

3.5. Antiserum titer of immunized grass carp determined by ELISA Serum of grass carp at day 7 and 14 after rVP4 vaccinated were analyzed by ELISA. 3 mg/g of rVP4 induced the highest antibody titer (dilution of 1:64,000) 7 days after immunization. Antibody titers in all immunization groups increased dramatically (1:128,000) 14 days after immunization. The highest antibody titer was found in the group immunized with 3 mg/g rVP4 (Fig. 3). 3.6. Relative quantification of IgM mRNA level in grass carp IgM transcripts in immunized and control grass carp head kidney were detected by real-time quantified PCR. The results showed that IgM mRNA levels were obviously higher in the immunized group than in control group 2 weeks after vaccination. Relative IgM mRNA expression levels (immunization group/control group) for groups immunized with 1, 3 and 5 mg/g of rVP4 were 3.2, 5.7 and 4.0 respectively (Fig. 4), consistent with the ELISA results. SPSS software analysis showed that significant difference exists between the immunized group and the control group (p < 0.05). 4. Discussion In this study, BLASTP and phylogenetic analysis revealed high homology among VP4 of GCRV-GD108 and other AQRVs’ VP4 protein as well as the m1 of MRV (21.6e32.9%). VP4 contains conserved domains of Reovirus M2 super family and belongs to Reovirus

3.4. rVP4 provided immune protection to grass carp Grass carp was immunized with 1 mg/g, 3 mg/g and 5 mg/g (recombinant protein/fish) of rVP4. After 14 days vaccination, the immunized fish was challenged with GCRV-GD108 of LD50. The results showed that all immunization groups were protected from GCRV-GD108 with relative percent survival (RPS) ranging from 47% Table 1 Neutralization index determination with fixed serum and diluted virus. Virus dilution

102

103

104

105

LD50

Neutralization index

Death ratio of negative serum Death ratio of test serum

10/10

7/10

6/10

0/10

103.8

101.9 ¼ 79.43

3/10

1/10

0/10

0/10

101.9

Fig. 3. Presence of anti-GCRV-GD108-VP4 specific antibodies in sera from grass carp immunized with rVP4. Grass carp were injected with 1, 3, 5 mg/g rVP4. After 7 and 14 days, fish sera were collected and the levels of antiserum were analyzed by ELISA using rVP4 antigen. Absorbance readings were measured at 450 nm. Bars represent the average values and standard deviations of sera from 5 fish per group, two different parallel experiments were performed. p < 0.05 compared to blank controls, Student’s t-test.

Y. Tian et al. / Fish & Shellfish Immunology 35 (2013) 351e356

Fig. 4. The relative express level (immunization group/control group) of IgM of the immunized grass carp for groups immunized with 1, 3 and 5 mg/g of rVP4 respectively, calculated by 2-DDCt method. *p < 0.05 compared to saline controls.

major virion structural protein Mu-1/Mu-1C (M2) superfamily, and is predicated to play important structural and functional roles in virus life cycle [23]. Using cryo-electron microscopy technique, Zhu et al. found VP5, VP7 and VP1 form the outer layer of GCRV capsid in 2010 [24]. Similar to MRV m1 protein, GCRV VP5 protein accounts for large proportion of viral particles [25]. Studies on MRV entry host cells found that the conversion from virion to infectious subvirion particle (ISVP) is necessary for virus to penetrate host cell membrane at the early infection stage [26]. This conversion process starts from the proteolysis of outer-capsid protein s3 to expose viral membrane-penetration protein m1. Then the proteolysis and conformational change of m1 induce rupture of endosome membrane to deliver nascent virus particles into cytoplasm [27]. Homologous to MRV m1, AQRV VP4 is believed to play similar functions in virus particle assembly and infection process [8]. In this study, we found that GCRV-GD108 VP4 had an Asn42-Pro43 proteolytic site, similar to the Asn42-Pro43 proteolytic site of MRV m1. But as same as other AQRVs, GCRV-GD108 VP4 lacks trypsin cleavage site (Arg584-Ile585) and chymotrypsin cleavage site (Tyr581-Gly582) of MRV m1, suggesting that GCRV-GD108 and other AQRVs may have different mechanism for penetration of host cell. In recent years, there were reports on genetically engineered subunit vaccine based on GCRV VP4. Immunogenicity of GCRV rVP5 had been detected. The rVP5 was able to bind immunologically to rabbit anti GCRV particle serum by ELISA analysis [11], and the polyclonal antibody against the rVP5 protein displayed neutralizing ability against GCRV infection in cell culture [12]. Specific antibody response in the sera of vaccinated carp through oral administration of VP5-VP7 mixture had been determined. VP5-VP7 immunization showed good protective efficiency with a cumulative mortality rate of 10% in immunization group compared with 90% in control group [28]. In the present study, multiple antigenic epitopes regions were predicted present along the GCRV-GD108 VP4 amino acid sequence, and neutralization experiments demonstrated that the polyclonal antibody of rVP4 could prevent virus infection efficiently. Immunization of 3 mg/g of rVP4 could provide a protection rate as high as 82%. VP5 of GCRV-GD108 is encoded by segment 5 and presumed to be an inner capsid protein that possesses NTPase activity. We have also prepared recombinant VP5 (rVP5) of GCRVGD108 and performed protection experiments and neutralization assay at totally same conditions as rVP4. However GCRV-GD108 rVP5 couldn’t provide any efficiently protection and had no neutralization functions [29]. Lv et al. isolated two GCRV stains, JX01 and JX02, from diseased grass carp in Jiangxi Province of China. Phylogenetic tree analysis showed that JX01 clustered with

355

GCRV-873 while JX02 clustered with GCRV-GD108 (with segments identities 99%). Anti-JX01 serum collected from grass carp vaccinated with inactivated JX01 couldn’t bind JX02, and vice versa [30]. Therefore, it is supposed that antiserum of GCRV and GCRV-GD108 couldn’t neutralize each other. GCRV-GD108 is a representative strain in southern China presently which shows significant molecular difference from those of other GCRV strains. So development of vaccines specifically against GCRV-GD108 is important for prevention of the frequent outbreaks of grass carp hemorrhage disease in southern China. In conclusion, rVP4 of GCRV-GD108 could induce high level antibody response in grass carp and provide efficient protection against infection of GCRV-GD108, demonstrating that VP4 is a protective antigen of GCRV-GD108 and can be used as a candidate vaccine against GCRV-GD108. This present work will facilitate future studies on functions of VP4 in pathogenicity and infectivity of GCRV-108. We are currently analyzing the antigenicity of S7 encoding protein of GCRV-108, and evaluating the protection roles against GCRV-GD108 infection of the S7 encoding protein alone and combined with GCRV-108 VP4. Acknowledgments This work was supported by grants from the Science and Technology Key Project in Agricultural Areas of Guangdong Province, China (No. 2008A020100016), Science and Technology Project of Ocean and Fisheries of Guangdong Province (No. A200899F01, A201101G01), Science and Technology Project of Guangzhou (No. 20084411115, N0. 2009J1-C021). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2013.04.022. References [1] Chen BS, Jiang Y. Morphological and physico-chemical characterization of the hemorrhagic virus of grass carp. Ke Xue Tong Bao 1983;28:1138e40. [2] Fancki RIB, Fauquet CM, Knudson DL, Brown F. Classification and nomenclature of viruses, fifth report of the international committee on taxonomy of viruses. Arch Virol 1991;2:186e92. [3] Rangel AA, Rockemann DD, Hetrick FM, Samal SK. Identification of grass carp haemorrhage virus as a new genogroup of aquareovirus. J Gen Virol 1999;80: 2399e402. [4] Ye X, Tian YY, Deng GC, Chi YY, Jiang XY. Complete genomic sequence of a reovirus isolated from grass carp in China. Virus Res 2012;163:275e83. [5] Chi YY, Tian YY, Ye X, Deng GC, Li J, Wang HJ. Molecular properties of grass carp reovirus in southern China and establishment of a duplex PCR detection method. Bing Du Xue Bao 2011;27:358e65. [6] Fang Q, Ke LH, Cai YQ. Growth characterization and high titre culture of GCHV. Virol Sin 1989;3:315e9. [7] Attoui H, Fang Q, Mohd Jaafar F, Cantaloube JF, Biagini P, de Micco P, et al. Common evolutionary origin of aquareoviruses and orthoreoviruses revealed by genome characterization of Golden shiner reovirus, Grass carp reovirus, Striped bass reovirus and golden ide reovirus (genus Aquareovirus, family Reoviridae). J Gen Virol 2002;83:1941e51. [8] Kim J, Tao Y, Reinisch KM, Harrison SC, Nibert ML. Orthoreovirus and Aquareovirus core proteins: conserved enzymatic surfaces, but not protein-protein interfaces. Virus Res 2004;101:15e28. [9] Fang Q, Seng EK, Ding QQ, Zhang LL. Characterization of infectious particles of grass carp reovirus by treatment with proteases. Arch Virol 2008;153:675e82. [10] Yan L, Guo H, Sun X, Shao L, Fang Q. Characterization of grass carp reovirus minor core protein VP4. Virol J 2012;9:89. [11] Zhang LL, Lei CF, Fan C, Fang Q. Expression of outer capsid protein VP5 of Grass carp reovirus and analysis of its immunogenicity. Virol Sin 2009;24: 545e51. [12] He Y, Xu H, Yang Q, Xu D, Lu L. The use of an in vitro microneutralization assay to evaluate the potential of recombinant VP5 protein as an antigen for vaccinating against Grass carp reovirus. Virol J 2011;8:132. [13] Shao L, Sun X, Fang Q. Antibodies against outer-capsid proteins of grass carp reovirus expressed in E. coli are capable of neutralizing viral infectivity. Virol J 2011;8:347.

356

Y. Tian et al. / Fish & Shellfish Immunology 35 (2013) 351e356

[14] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673e80. [15] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731e9. [16] Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985;39:783e91. [17] Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157:105e32. [18] Emini EA, Hughes JV, Perlow DS, Boger J. Induction of hepatitis A virus-neutralizing antibody by a virus-specific synthetic peptide. J Virol 1985;55:836e9. [19] Jamson BA, Wolf H. The antigenic index: a novel algorithm for predicing antigenic determinants. Comput Appl Biosci 1988;4:181e6. [20] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680e5. [21] Ye X, Zhang L, Dong H, Tian Y, Lao H, Bai J, et al. Validation of reference genes of grass carp Ctenopharyngodon idellus for the normalization of quantitative real-time PCR. Biotechnol Lett 2010;32:1031e8. [22] Livak KJ, Schmittgen TD. Analysis of relative gene ex-pression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25: 402e8.

[23] Guglielmi KM, Johnson EM, Stehle T, Dermody TS. Attachment and cell entry of mammalian orthoreovirus. Curr Top Microbiol Immunol 2006;309: 1e38. [24] Zhu J, Cheng L, Fang Q, Zhou ZH, Honig B. Building and refining protein models within cryo-electron microscopy density maps based on homology modeling and multiscale structure refinement. J Mol Biol 2010;397:835e51. [25] Nibert ML, Schiff LA. Reoviruses and their replication. In: Knipe DM, Howley PM, editors. Fields virology. Philadelphia: Lippincott Williams and Wilkins; 2001. p. 1679e728. [26] Nibert ML, Fields BN. A carboxy-terminal fragment of protein mu 1/mu 1C is present in infectious subvirion particles of mammalian reoviruses and is proposed to have a role in penetration. J Virol 1992;66:6408e18. [27] Danthi P, Guglielmi KM, Kirchner E, Mainou B, Stehle T, Dermody TS. From touchdown to transcription: the reovirus cell entry pathway. Curr Top Microbiol Immunol 2010;343:91e119. [28] Lu L, Xu H, He Y, Li J. Protection of grass carp, Ctenopharyngon idellus (Valenciennes), through oral administration of a subunit vaccine against reovirus. J Fish Dis 2011;34:939e42. [29] Wang HJ, Ye X, Tian YY, Zhang LL, Deng GC. Analysis of function and immunogenicity of GCRV-GD108 VP5. J Fish China 2013;37(1):109e16. [30] Wang T, Xu D, Lv LQ. Detection of the co-infection of different grass carp reovirus strains using dsRNA sequencing technology. J Shanghai Fish Univ 2012;21(5):756e62.