- Email: [email protected]
Optimized polypeptide for a subunit vaccine against avian reovirus
G Model
ARTICLE IN PRESS
JVAC-17576; No. of Pages 6
Vaccine xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Optimized polypeptide for a subunit vaccine against avian reovirus Dana Goldenberg a,b , Avishai Lublin c , Ezra Rosenbluth c , E. Dan Heller a , Jacob Pitcovski b,d,∗ a
Department of Animal Sciences, The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot, Israel Migal – Galilee Technology Center, Kiryat Shmona, Israel Division of Avian and Fish Diseases, Kimron Veterinary Institute, Bet Dagan, Israel d Department of Biotechnology, Tel-Hai Academic College, Israel b c
a r t i c l e
i n f o
Article history: Received 10 January 2016 Received in revised form 10 April 2016 Accepted 12 April 2016 Available online xxx Keywords: ARV Subunit vaccine Sigma C
a b s t r a c t Avian reovirus (ARV) is a disease-causing agent. The disease is prevented by vaccination with a genotypespecific vaccine while many variants of ARV exist in the field worldwide. Production of new attenuated vaccines is a long-term process and in the case of fast-mutating viruses, an impractical one. In the era of molecular biology, vaccines may be produced by using only the relevant protein for induction of neutralizing antibodies, enabling fast adjustment to the emergence of new genetic strains. Sigma C (SC) protein of ARV is a homotrimer that facilitates host-cell attachment and induce the production and secretion of neutralizing antibodies. The aim of this study was to identify the region of SC that will elicit a protective immune response. Full-length (residues 1–326) and two partial fragments of SC (residues 122–326 and 192–326) were produced in Escherichia coli. The SC fragment of residues 122–326 include the globular head, shaft and hinge domains, while eliminating intra-capsular region. This fragment induces significantly higher levels of anti-ARV antibodies than the shorter fragment or full length SC, which neutralized embryos infection by the virulent strain to a higher extent compared with the antibodies produced in response to the whole virus vaccine. Residues 122–326 fragment is assumed to be folded correctly, exposing linear as well as conformational epitopes that are identical to those of the native protein, while possibly excluding suppressor sequences. The results of this study may serve for the development of a recombinant subunit vaccine for ARV. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Avian reovirus (ARV) is a member of the Orthoreovirus genus in the family Reoviridae [1,2]. It is associated with a number of diseases [3], the most prominent being viral arthritis syndrome (tenosynovitis) which is characterized by swelling of the hock joints and lesions in the gastrocnemius tendons [4], and causes considerable economic loss to the poultry industry [5]. Susceptibility to ARV occurs mostly in young (1–2 weeks of age) chickens [6–8]. The control of viral tenosynovitis in broiler chicks is conferred by antibodies that are transferred to the progeny following vaccination of maternal flocks [9]. The available live-attenuated and inactivated vaccines for ARV are based on the s1133 strain [10], as well as isolated strains belonging to a single serotype [11]. However, those vaccines are not effective against the diverse ARVs found in the
∗ Corresponding author at: Migal – Galilee Technology Center, Kiryat Shmona, Israel. Tel.: +972 4 6953509; fax: +972 4 6944980. E-mail address: [email protected] (J. Pitcovski).
field [11–13]. Sequencing of the sigma C (SC) protein of ARV isolates for genetic characterization enabled their division into genotypes [11,13–15]. Vaccination based on a mixture of the four representatives of ARV genotypes conferred protection against all tested viruses from the four genotypes [13]. The outer capsid cell attachment protein, SC of ARV, encoded by the S1 gene, is a relatively small protein of 326 amino acids [16], a homotrimer with a tertiary structure consisting of two domains: the “head”, which is located at the C-terminal end of the protein, and the “shaft”, at the N terminus. The crystal structure of the C-terminal domain and of residues 117–326 has been resolved [17,18]. SC elicits reovirus-specific neutralizing antibodies [19,20], making it a suitable candidate for a recombinant subunit vaccine. Indeed, efficient recombinant vaccines have been developed in the past for a number of viruses, including vaccines for hepatitis B [21] and for papillomavirus [22] for humans, as well as infectious bursal disease (IBD) [23] and egg drop syndrome [24] for chickens and hemorrhagic enteritis virus for turkeys [25]. SC has been expressed in various expression systems, including bacteria [17,18,26–28], baculovirus [29,30], yeast [31], plants [32] and
http://dx.doi.org/10.1016/j.vaccine.2016.04.036 0264-410X/© 2016 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model
ARTICLE IN PRESS
JVAC-17576; No. of Pages 6
D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
2
Table 1 Designed oligonucleotides for amplification of sigma C (SC) fragments. Labela
Direction
Primer sequences (5 → 3 )
Expected size (bp)
SC122–326 SC122–326
Forward Reverse
GGGGGATCCGACGGAAACTCCACTGCC GGGCGGCCGTTAGGTGTCGATGCCGG
669
SC192–326 SC192–326
Forward Reverse
GGGGGATCCTCGGCGGAGGCTCAACTAATGC GGGCGGCCGTTAGGTGTCGATGCCGG
459
a Oligonucleotides were designed to amplify the gene encoding SC122–326 and SC192–326 partial proteins; the 5 ends of the oligonucleotides were designed to create restriction enzyme sites BamHI–EagI, BamHI–EagI, and EcoRI–EcoRI (underlined), respectively, after PCR amplification.
mammalian cells [33]. Recombinant SC proteins have been used for diagnostics to distinguish between strains [26–28,30,34]. AntiSC antibodies have been shown to neutralize the virus in cell lines [28,31]. In a previous study, SC expressed in bacteria showed only weak immunogenicity [26,27]. The objective of the current study was to determine the fragment of the SC protein that will induce a high level of neutralizing antibodies toward the production of an efficient recombinant subunit vaccine against ARV.
2. Materials and methods 2.1. Expression of the SC protein Three cDNA fragments of SC from the vaccine strain s1133 encoding SC residues 1–326, 122–326 and 192–326 were produced by polymerase chain reaction (PCR) with specifically designed oligonucleotides (Table 1). Fragments 122–326 and 192–326 were cleaved with restriction enzymes BamHI and EagI introduced into the primers during synthesis, and were cloned into the expression vector pET28a (Novagen, Darmstadt, Germany), which included a purification tag containing six consecutive histidine residues at the N terminus. The sequence of the insert was confirmed by DNA-sequence analysis (Hy-Labs, Rehovot, Israel). For expression, Escherichia coli strain BL21 (DE3) was freshly transformed with the plasmid. Cultures were grown aerobically at 37 ◦ C to an optical density (OD) at 600 nm of 0.6–0.8. The cultures were cooled to below 25 ◦ C, and expression was induced by adding 1 mM isopropyl -d-1-thiogalactopyranoside (IPTG) and incubating for 3 h at 25 ◦ C. Harvested cells were resuspended in 40 ml cold resuspension buffer (4.29 mM Na2 HPO4 , 1.47 mM KH2 PO4 , 2.7 mM KCl, 137 mM NaCl, 0.1% v/v Tween-20) and frozen at −20 ◦ C [18]. Bacteria were lysed by sonicating three times for 10 min each time (Sonics, Taunton, MA, USA), centrifuged (10,000 × g for 15 min at 4 ◦ C) and the pellet was discarded. SC residue 1–326 was expressed as described previously [27]. The expressed SC122–326 protein fragment was purified in a Ni-NTA agarose column according to the manufacturer’s instructions (Qiagen, Hilden, Germany). The purified protein was dialyzed overnight against phosphate buffered saline (PBS) at 4 ◦ C. The expressed SC proteins were detected by 12% SDS–polyacrylamide gel electrophoresis (PAGE). The amount of SC protein was estimated by comparison with a standard curve of known amounts of bovine serum albumin run on the same gel. 2.2. Birds and vaccination Specific pathogen-free (SPF) birds (Charles River/SPAFAS) were hatched and raised in a sterile hatchery. At 1 week of age, the birds were randomly separated into six groups of 10 birds each. Each bird was vaccinated with 100 g SC protein mixed 1:1 (v/v) with Freund’s adjuvant to a final volume of 1 ml. Birds were vaccinated intramuscularly and subcutaneously at 14 and 28 days of age as described in Table 2. Blood was withdrawn 2 weeks after each of the vaccinations and serum was separated and kept at −20 ◦ C.
2.3. Enzyme-linked immunosorbent assay (ELISA) To determine the anti-SC antibody titer, SC was used as the antigen in an ELISA. The antigen was diluted in coating buffer (0.397 g Na2 CO3 , 0.732 g NaHCO3 , 250 ml double-distilled water pH 9.6) and incubated in an ELISA plate (Nunc, Rochester, NY, USA) for 24 h at 4 ◦ C. Each subsequent step was followed by three washes with 0.05% Tween-20 in PBS. Serum from birds vaccinated with the tested proteins or controls were serially double-diluted (1:100–1:800,000) in a blocking buffer (5% w/v skim milk, 0.05% Tween-20 in PBS) and incubated for 1 h. The secondary antibody, peroxidase-conjugated rabbit anti-chicken IgG (Sigma, Rehovot, Israel), diluted 1:7000, was added and the mixture was incubated for 1 h. The substrate o-phenylenediamine dihydrochloride (Sigma) was then added. OD was measured by ELISA reader (Thermo Scientific Multiskan RC, Vantaa, Finland) at 450 nm. The endpoint titer was determined as the last dilution for which the OD was still positive (relative to the negative control in the ELISA). The level of anti-ARV antibodies in the sera of vaccinated birds was determined by a commercial ELISA (IDEXX® Laboratories, USA) according to the manufacturer’s instructions. OD values were measured at 650 nm. Sample-to-positive (S/P) ratios greater than 0.2 were considered to be positive for ARV (S/P ratio = (sample mean OD − negative control mean OD)/(positive control mean OD − negative control mean OD)). 2.4. Cell-proliferation assay Spleens were collected from birds 42 days post-vaccination and macerated with a syringe plunger through a screen sieve to obtain a single-cell suspension in PBS. Splenocytes were suspended in RPMI 1640 supplemented with 2% fetal bovine serum, 2 mM l-glutamine, penicillin (100 U/ml) and streptomycin (10 ng/ml) (Biotech Industry, Bet Haemek, Israel). Cells (1 × 106 /well) were seeded in 96-well culture plates. Concanavalin A (ConA; 5 g/ml), lipopolysaccharide (LPS; 5 g/ml) or ARV (5 l/well, at a titer of 106.6 ) (Sigma–Aldrich) were added as stimulators in triplicate and incubated for 48 h. Cell titer blue (CTB) assay was performed by adding 20 l CTB reagent (Promega, Madison, WI, USA) to each well. The cells were then incubated for 6 h at 37 ◦ C under 5% CO2 . Color intensity of the CTB reagent was quantified by fluorometer at excitation/emission wavelengths of 560 and 590 nm,
Table 2 Vaccination program. Group
b
1 2 3 4 5 6 a b c
Vaccine at 14 da ARV s1133 PBS + adjuvantc SC1–326 SC122–326 SC192–326 SC122–326
Vaccine at 28 da ARV s1133 PBS + adjuvant SC1–326 SC122–326 SC192–326 ARV s1133
Days of age. Positive control. Negative control.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
3
respectively. The measured absorbance was proportional to the number of viable cells. Results were calculated and presented as stimulation index (SI), representing the ratio between stimulated cells and non-stimulated cells. 2.5. Neutralization test of virulent ARV strain s1133 The ability of the sera to neutralize virulent reovirus was tested by monitoring inhibition of embryonic mortality 3–7 days postinoculation. The tested sera were filtered and heated for 30 min at 56 ◦ C to inactivate complement activity. The virus was diluted with PBS in a series of 10-fold dilutions. Mixtures of equal volumes of diluted virus and sera (or PBS as a negative control) were incubated for 40 min at room temperature. Each of the mixtures was inoculated into five fertile 7-day-old SPF embryonated eggs. To confirm the virulence potential of the indicator virus, 10 eggs were inoculated with the undiluted virus that was mixed 1:1 with PBS. In addition, in several of the experiments, virus-free sera were inoculated into embryonated eggs to confirm the absence of nonspecific mortality due to serum constituents. All eggs were illuminated daily in a dark room to determine embryo viability, and the number of live and dead embryos was recorded. The neutralization index (NI) was determined as the ratio between the highest virus dilution that killed at least 95% (cumulative) of the embryos and the virus dilution that killed the same percentage of embryos in the presence of antibodies. NI value was expressed as the ratio between the log of the dilutions. A NI of 2 or greater in the antiserum was considered as having neutralized the virus. 2.6. Statistics ELISA, neutralization and cell-proliferation results were analyzed by one-way analysis of variance (ANOVA) with Tukey test. All of the analyses were performed with GraphPadPrism5 software. 3. Results 3.1. SC protein expression
Fig. 1. Antibody titers following vaccination with recombinant proteins SC1–326, SC122–326 and SC192–326. Controls: N.C. – negative control (birds vaccinated with PBS in adjuvant), P.C. – positive control (injected with ARV s1133). ***Significantly different at P < 0.001.
S/P in SC122–326 group was significantly higher than in the other groups. 3.3. Cell proliferation Splenocytes from the vaccinated chickens were examined for antigen-specific cell proliferation. Cells were treated with ConA as a control for proliferation of T cells, LPS as a control for proliferation of B cells (positive controls), PBS (negative control) and ARV (specific antigen). In the CTB assay, the measured absorbance was
Following analysis of the SC protein structure, cDNA fragments encoding three polypeptides residues: 1–326, 122–326, 192–326, were produced, cloned, and expressed in E. coli. A polyhistidine tag was added at the 5 end to allow for detection and purification of the expressed proteins. The resultant proteins were partially purified. The expressed SC fragments were at expected sizes of 36 kD, 23 kD and 15 kD, respectively as determined on a 12% SDS–polyacrylamide gel. 3.2. Antibody response to vaccination Following vaccination, the immunogenicity of the SC proteins and the ability of the produced antibodies to detect the virus were tested by ELISA. Using SC122–326 as the antigen, antibodies derived following vaccination with proteins SC122–326 and SC192–326 detected the antigen at high titers of 1:800,000. The mean of the titers of birds in this group were significantly higher (P < 0.001) than those in the negative control, whereas the mean of the antibody titer derived following vaccination with SC1–326 protein were similar to those of the negative control (Fig. 1). Antibody level against whole virus following vaccination with SC192–326 or the negative control reached a value of 0.2 or lower, whereas antibodies derived following vaccination with SC1–326 or SC122–326 were positive (0.25 and 0.5, respectively) (Fig. 2). The
Fig. 2. Virus detection by antibodies raised following protein injection. The relative level of anti-ARV antibody following injection with SC1–326, SC122–326 and SC192–326 is presented as the ratio between the ODs of the tested sample (S) and anti-ARV 1133 antibodies, provided in the KIT, that serve as positive control (P) (S/P). A value greater than 0.2 is considered positive (recognizing the virus). N.C. – negative control (birds vaccinated with PBS in adjuvant). ***Significantly different at P < 0.001.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
4
Fig. 3. Proliferation of lymphocytes derived from spleens of birds vaccinated with PBS in adjuvant as negative control (N.C.), ARV vaccine strain s1133 as positive control (P.C.), SC1–326 or SC122–326, following stimulation with ARV. Cells were treated with concanavalin A (ConA) or lipopolysaccharide (LPS) as controls for nonspecific antigen (Ag) cell proliferation, ARV for specific Ag proliferation, or the medium itself as a negative control (N.C.). The measured absorbance is proportional to the number of viable cells. Results are presented as stimulation index (SI) representing the ratio between stimulated and non-stimulated cells. ***, **Significantly different at P < 0.001 and 0.01, respectively.
proportional to the number of viable cells. Results are presented as SI (mitogen- or antigen-stimulated/nonstimulated cells). The positive control treatments exhibited proliferation following the stimulus. Cells stimulated with ARV showed significant differences among treatment groups. Cells from the group immunized with the virus or SC122–326 showed significant proliferation as compared to the negative control (P < 0.01), whereas proliferation in group that were injected with SC1–326 was significantly lower than SC122–326 or the positive control groups (P < 0.05) (Fig. 3). 3.4. Effect of SC122–326 in priming the response against ARV The effect of vaccination with SC122–326 as compared to vaccination with the whole-virus vaccine as an inducer of a primary response against ARV was tested. One group of chickens was injected with the ARV strain s1133 vaccine and the other with SC122–326. Two weeks later, ARV s1133 was injected into both groups. Primary vaccination with ARV or SC122–326, induces a similar significant elevation following secondary vaccination with whole ARV (Fig. 4). 3.5. Virus neutralization Sera from vaccinated birds were tested for neutralization ability against the virulent virus in SPF embryonated eggs. No protection was conferred by sera produced by the negative control birds or from the group injected with the SC1–326 (NI = 0). In contrast, serum produced by birds injected with the protein SC122–326 conferred protection (neutralization capacity) similar to that achieved with antibodies that developed following vaccination with whole virus (NI < 4) (Table 3). 4. Discussion The effectiveness of subunit vaccines to viruses has been proven in the past, including in chickens, examples being the antigenic protein VP2 of IBDV [23] and two avian adenovirus vaccines [24,25]. The adenovirus subunit vaccines showed a phenomenon similar to that observed with the SC protein in this study, where the recombinant protein was immunogenic and induced protective
Fig. 4. The effect of primary vaccination with SC122–326 on the secondary response to ARV. Results are expressed as dilution end-points, tested by ELISA. Negative control-vaccinated with PBS and adjuvant. ***Significantly different at P < 0.001.
neutralizing antibodies only when a fragment was expressed that included the knob and an adjacent short fragment of the shaft from the fiber protein while eliminating part of the protein [24,25]. ARV mutates relatively fast and many variants exist in the field worldwide. Vaccines that protect against one genotype are inefficient against others [11,26,35,36]. Production of attenuated vaccine is a long process, and in the case of highly mutated viruses inefficient. Adaptation of vaccines to alterations in the field virus is by the use of inactivated vaccines that are produced by propagation of the virulent isolates in cell cultures or embryonated eggs and its subsequent inactivation. In the era of molecular biology, subunit vaccines may be produced by genetic engineering. In this method, only the relevant updated protein for induction of neutralizing antibodies is produced in an expression system. This method of using recombinant subunit proteins has some advantages over conventional vaccines: (a) the recombinant subunit vaccine is produced in cells and there is no risk of disease caused by incomplete inactivation or reversal to virulence of inactivated or attenuated virus, respectively; (b) there is no need to infect live embryos (as in the production of some viral vaccines), impacting animal welfare; (c) the procedure is controlled and repeatable; (d) the vaccinated human or animal is exposed mainly to the relevant epitopes, eliminating induction of an immune response to a whole virus, of which most epitopes are irrelevant for the induction of a protective response; (e) in some cases, suppressive elements are produced by viruses and the immune response against the vaccine, as well as the general immune response, are reduced. This is eliminated by the use of subunit vaccines; (f) adjustment of the subunit vaccine to emergence of new genetic strains is relatively rapid. To develop a subunit vaccine, recombinant proteins must be expressed in an expression system which outcome protein will mimic the native one. In this study, as SC protein is not glycosylated, E. coli was chosen as the expression system, providing an efficient [37–40] and relatively inexpensive way of producing Table 3 Virus neutralization by antibodies against ARV or SC fragments. Vaccination
Neutralization indexa
Adjuvant only (negative control) ARV s1133 SC1–326 SC122–326
0 4 0 >4
a Neutralization index (NI) value of 2 or higher is considered as neutralizing against that virus.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
Fig. 5. Partial structure (amino acids 117–326) of sigma C (SC) protein of avian reovirus strain s1133. Numbers represent amino acid positions in the protein structure. Adapted from Guardado-Calvo et al. [18].
proteins. Trimerization plays an important role in receptor binding and in many cases is crucial to obtain anti-conformational antibodies that will neutralize the virus [41]. As shown previously [26,27], SC in its full 326-amino-acid form induces only a low titer of antibodies, although antibodies against s1133 strain of ARV, do identify the recombinant SC. Following analysis of the published SC protein structure [17,18], a cDNA fragment encoding three different lengths of the protein – residues 1–326, 122–326, and 192–326 (Fig. 5) – were tested as candidates for subunit vaccine that will elicit the highest levels of anti-ARV neutralizing antibodies. In the region of amino acids 117–326, the shaft domain has a mixed alpha helix as well as a triple beta spiral that are separated by a flexible linker. This structure might comprise a functionally important hinge in the context of protein structure [18]. The shorter fragment that was produced and tested in this study, SC amino acids 192–326, contains the globular head and additional four amino acids from the shaft, potentially designed to maintain correct trimerization and folding of the native protein, while focusing on the globular region of the protein. Both fragments were expressed as soluble polypeptides. While SC1–326 induce low titer of antibodies, the other two fragments induced an immune response with high antibody titers, the most prominent one being SC122–326. In this light, SC1–326 may serve as an excellent background and an additional negative control. The low level of antibodies induced by SC1–326 may be because this fragment contains a region that is naturally anchored in the protein capsid [16] and expressing the protein as a subunit results in misfolding of the whole structure. Eliminating this region in the other two fragments thus enabled correct folding and enhanced immunogenicity. The extremely high level of antibodies induced by SC122–326 fragment may be explained by its correct folding, which might be of importance to the elucidation of a strong immune response. SC structure shows that the presence of hinge regions around residues 110 and 158 may be important for receptor binding or subsequent penetration of the infectious viral particle into the cell. These residues may also be important for SC trimerization in the viral particle [18]. Another explanation for the different immunogenicity of the SC fragments might be that the section that was eliminated in SC122–326 and SC192–326, namely amino acids 1–121, contains an immunosuppressive element [42]. Vaccination with SC122–326 yielded antibodies that identified the virus with the highest titer in the commercial ELISA kit, at which a whole virus is used as antigen. Moreover, as SC was found to be the cell-attachment protein of ARV, carrying the main neutralizing epitopes, high proportion of the antibodies raised against this fragment are targeted to neutralizing epitopes, whereas antibodies induced following vaccination with the whole virus detect many capsid epitopes, most of which are irrelevant for VN. It seems that this fragment is folded correctly, exposing linear as well as conformational epitopes to the
5
immune system that are identical to those of the native protein. This was further supported by the cell-proliferation tests in which, following the stimulation of the cells of the different experimental groups with ARV, only cells from birds that were immunized with SC122–326 polypeptide proliferated to the same extent as the positive control, which was vaccinated with the whole virus. Cells produced following injection of the other fragments resulted in weaker proliferation. In the cell-viability test with CTB, fewer live cells were detected in the negative control group, possibly due to virus-induced lysis [43]. As SC122–326 yielded the highest levels of antibodies, it was further analyzed. The ability to get a secondary immune response against ARV following priming with SC122–326 indicated that the same populations of B and T lymphocytes are induced by SC122–326 and the whole virus toward this fragment. This might indicate that vaccinating with SC122–326 may be sufficient for eliciting a full protected antibody response. The efficacy of SC122–326 as a vaccine against ARV was further tested by viral neutralization test. Antibodies produced against the SC protein showed successful neutralization in cell systems [28,44]. However, neutralization tests in bird embryos are more accurate at predicting viral neutralization in adult birds. In this study, antibodies produced following injection of SC122–326 protein were found to be protective, eliminating infection of bird embryos by the virulent strain to the same extent as antibodies produced in response to the whole virus. In a recent study, ARV SC protein was found to elicit a strong mucosal immunity [45]. In this aspect, in addition to anti-ARV response, SC may be used as an immune-enhancer for other vaccines. Results of this study may serve in the development of a recombinant vaccine with SC122–326 fragment. Its potential for protection should be evaluated through challenge tests is SPF and broiler chickens. It would be advisable to examine its crossprotection potential to emerging variants. SC122–326 fragment can be used as part of a multivalent vaccine of strains representing various serotypes. The approach described in this study may facilitate rapid adjustment of a vaccine to new virulent strains of ARV. References [1] Attoui H, Billoir F, Biagini P, de Micco P, de Lamballerie X. Complete sequence determination and genetic analysis of Banna virus and Kadipiro virus: proposal for assignment to a new genus (Seadornavirus) within the family Reoviridae. J Gen Virol 2000;81:1507–15, http://dx.doi.org/10.1099/0022-1317-81-6-1507. [2] Mertens P. The dsRNA viruses. Virus Res 2004;101:3–13, http://dx.doi.org/10.1016/j.virusres.2003.12.002. [3] Robertson M, Wilcox G. Avian reovirus. Vet Bull 1986;56:759–66. [4] Wilcox GE, Robertson MD, Lines AD. Adaptation and characteristics of replication of a strain of avian reovirus in Vero cells. Avian Pathol 1985;14:321–8, http://dx.doi.org/10.1080/03079458508436234. [5] Rosenberger JK, Sterner FJ, Botts S, Lee KP, Margolin A. In vitro and in vivo characterization of avian reoviruses. I. Pathogenicity and antigenic relatedness of several avian reovirus isolates. Avian Dis 1989;33:535–44. [6] Montgomery RD, Villegas P, Dawe DL, Brown J. Effect of avian reoviruses on lymphoid organ weights and antibody response in chickens. Avian Dis 1985;29:552–60. [7] Bains BS, MacKenzie M, Spradbrow PB. Reovirus-associated mortality in broiler chickens. Avian Dis 1974;18:472–6. [8] Fahey JE, Crawley JF. Studies on chronic respiratory disease of chickens. II. Isolation of a virus. Can J Comp Med Vet Sci 1954;18:13–21. [9] Gharaibeh S, Mahmoud K, Al-Natour M. Field evaluation of maternal antibody transfer to a group of pathogens in meat-type chickens. Poult Sci 2008;87:1550–5, http://dx.doi.org/10.3382/ps.2008-00119. [10] van der Heide L, Kalbac M, Brustolon M. Development of an attenuated apathogenic reovirus vaccine against viral arthritis/tenosynovitis. Avian Dis 1983;27:698–706. [11] Goldenberg D, Pasmanik-Chor M, Pirak M, Kass N, Lublin A, Yeheskel A, et al. Genetic and antigenic characterization of sigma C protein from avian reovirus. Avian Pathol 2010;39:189–99, http://dx.doi.org/10.1080/03079457.2010.480969.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
[12] Jones RC. Avian reovirus infections. Rev Sci Tech 2000;19:614–25. [13] Lublin A, Goldenberg D, Rosenbluth E, Heller ED, Pitcovski J. Widerange protection against avian reovirus conferred by vaccination with representatives of four defined genotypes. Vaccine 2011;29:8683–8, http://dx.doi.org/10.1016/j.vaccine.2011.08.114. [14] Kant A, Balk F, Born L, van Roozelaar D, Heijmans J, Gielkens A, et al. Classification of Dutch and German avian reoviruses by sequencing the sigma C protein. Vet Res 2003;34:203–12, http://dx.doi.org/10.1051/vetres:2002067. [15] Troxler S, Rigomier P, Bilic I, Liebhart D, Prokofieva I, Robineau B, et al. Identification of a new reovirus causing substantial losses in broiler production in France, despite routine vaccination of breeders. Vet Rec 2013;172:556, http://dx.doi.org/10.1136/vr.101262. [16] Benavente J, Martínez-Costas J. Avian reovirus: structure and biology. Virus Res 2007;123:105–19, http://dx.doi.org/10.1016/j.virusres.2006.09.005. [17] Guardado Calvo P, Fox GC, Hermo Parrado XL, Llamas-Saiz AL, Costas C, Martínez-Costas J, et al. Structure of the carboxy-terminal receptorbinding domain of avian reovirus fibre sigmaC. J Mol Biol 2005;354:137–49, http://dx.doi.org/10.1016/j.jmb.2005.09.034. [18] Guardado-Calvo P, Fox GC, Llamas-Saiz AL, van Raaij MJ. Crystallographic structure of the ␣-helical triple coiled-coil domain of avian reovirus S1133 fibre. J Gen Virol 2009;90:672–7, http://dx.doi.org/10.1099/vir.0.008276-0. [19] Shapouri MRS, Frenette D, Larochelle R, Arella M, Silim A. Characterization of monoclonal antibodies against avian reovirus strain S1133. Avian Pathol 1996;25:57–67, http://dx.doi.org/10.1080/03079459608419120. [20] Grande ANA, Varela N, Garci N, Benavente J. Protein architecture of avian reovirus S1133 and identification of the cell attachment protein. J Virol 1997;71:59–64. [21] McAleer WJ, Buynak EB, Maigetter RZ, Wampler DE, Miller WJ, Hilleman MR. Human hepatitis B vaccine from recombinant yeast. Nature 1984;307:178–80. [22] Valentino K, Poronsky CB. Human papillomavirus infection and vaccination. J Pediatr Nurs 2015, http://dx.doi.org/10.1016/j.pedn.2015.10.005. [23] Pitcovski J, Gutter B, Gallili G, Goldway M, Perelman B, Gross G, et al. Development and large-scale use of recombinant VP2 vaccine for the prevention of infectious bursal disease of chickens. Vaccine 2003;21:4736–43, http://dx.doi.org/10.1016/S0264-410X(03)00525-5. [24] Fingerut E, Gutter B, Gallili G, Michael A, Pitcovski J. A subunit vaccine against the adenovirus egg-drop syndrome using part of its fiber protein. Vaccine 2003;21:2761–6, http://dx.doi.org/10.1016/S0264-410X(03)00117-8. [25] Pitcovski J, Fingerut E, Gallili G, Eliahu D, Finger A, Gutter B. A subunit vaccine against hemorrhagic enteritis adenovirus. Vaccine 2005;23:4697–702, http://dx.doi.org/10.1016/j.vaccine.2005.03.049. [26] Vasserman Y, Eliahoo D, Hemsani E, Kass N, Ayali G, Pokamunski S, et al. The influence of reovirus sigma C protein diversity on vaccination efficiency. Avian Dis 2004;48:271–8, http://dx.doi.org/10.1637/7091. [27] Goldenberg D, Lublin A, Rosenbluth E, Heller ED, Pitcovski J. Differentiating infected from vaccinated animals, and among virulent prototypes of reovirus. J Virol Methods 2011;177:80–6, http://dx.doi.org/10.1016/j.jviromet.2011.06.023. [28] Jung KM, Bae EH, Jung YT, Kim JW. Use of IgY antibody to recombinant avian reovirus C protein in the virus diagnostics. Acta Virol 2014;58: 108–13.
[29] Lin YH, Lee LH, Shih WL, Hu YC, Liu HJ. Baculovirus surface display of sigma C and sigma B proteins of avian reovirus and immunogenicity of the displayed proteins in a mouse model. Vaccine 2008;26:6361–7, http://dx.doi.org/10.1016/j.vaccine.2008.09.008. [30] Hsu CJ, Wang CY, Lee LH, Shih WL, Chang CI, Hsueh L, et al. Development and characterization of monoclonal antibodies against avian reovirus C protein and their application in detection of avian reovirus isolates. Avian Pathol 2007;9457:320–6, http://dx.doi.org/10.1080/03079450600823386. [31] Wu H, Williams Y, Gunn KS, Singh NK, Locy RD, Giambrone JJ. Yeastderived sigma C protein-induced immunity against avian reovirus. Avian Dis 2005;49:281–4, http://dx.doi.org/10.1637/7284-092904R1. [32] Huang L, Liao S, Chang C, Liu H. Expression of avian reovirus sigma C protein in transgenic plants. J Virol Methods 2006;134:217–22, http://dx.doi.org/10.1016/j.jviromet.2006.01.013. [33] Theophilos MB, Huang JA, Holmes IH. Avian reovirus sigma C protein contains a putative fusion sequence and induces fusion when expressed in mammalian cells. Virology 1995;208:678–84, http://dx.doi.org/10.1006/viro.1995.1199. [34] Liu HJ, Kuo LC, Hu YC, Liao MH, Lien YY. Development of an ELISA for detection of antibodies to avian reovirus in chickens. J Virol Methods 2002;102: 129–38. [35] Lu H, Tang Y, Dunn PA, Wallner-Pendleton EA, Lin L, Knoll EA. Isolation molecular characterization of newly emerging avian reovirus variants novel strains in Pennsylvania, USA, 2011–2014. Sci Rep 2015;5:14727, http://dx.doi.org/10.1038/srep14727. [36] Shapouri MR, Kane M, Letarte M, Bergeron J, Arella M, Silim A. Cloning, sequencing and expression of the S1 gene of avian reovirus. J Gen Virol 1995;76(Pt 6):1515–20, http://dx.doi.org/10.1099/0022-1317-76-6-1515. [37] Pope B, Kent HM. High efficiency 5 min transformation of Escherichia coli. Nucleic Acids Res 1996;24:536–7. [38] Sezonov G, Joseleau-Petit D, D’Ari R. Escherichia coli physiology in Luria-Bertani broth. J Bacteriol 2007;189:8746–9, http://dx.doi.org/10.1128/JB.01368-07. [39] Lee SY. High cell-density culture of Escherichia coli. Trends Biotechnol 1996;14:98–105, http://dx.doi.org/10.1016/0167-7799(96)80930-9. [40] Shiloach J, Fass R. Growing E. coli to high cell density – a historical perspective on method development. Biotechnol Adv 2005;23:345–57, http://dx.doi.org/10.1016/j.biotechadv.2005.04.004. [41] Grande A, Rodriguez E, Costas C, Everitt E, Benavente J. Oligomerization and cell-binding properties of the avian reovirus cell-attachment protein sigma C. Virology 2000;274:367–77, http://dx.doi.org/10.1006/viro.2000.0473. [42] Schellekens H. Immunogenicity of therapeutic proteins: clinical implications and future prospects. Clin Ther 2002;24:1720–40, discussion 1719. [43] Shih WL, Hsu HW, Liao MH, Lee LH, Liu HJ. Avian reovirus C protein induces apoptosis in cultured cells. Virology 2004;321:65–74, http://dx.doi.org/10.1016/j.virol.2003.12.004. [44] Lin YH, Lee LH, Shih WL, Hu YC, Liu HJ. Baculovirus surface display of sigmaC and sigmaB proteins of avian reovirus and immunogenicity of the displayed proteins in a mouse model. Vaccine 2008;26:6361–7, http://dx.doi.org/10.1016/j.vaccine.2008.09.008. [45] Lin KH, Hsu AP, Shien JH, Chang TJ, Liao JW, Chen JR, et al. Avian reovirus sigma C enhances the mucosal and systemic immune responses elicited by antigenconjugated lactic acid bacteria. Vaccine 2012;30:5019–29.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
ARTICLE IN PRESS
JVAC-17576; No. of Pages 6
Vaccine xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Optimized polypeptide for a subunit vaccine against avian reovirus Dana Goldenberg a,b , Avishai Lublin c , Ezra Rosenbluth c , E. Dan Heller a , Jacob Pitcovski b,d,∗ a
Department of Animal Sciences, The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot, Israel Migal – Galilee Technology Center, Kiryat Shmona, Israel Division of Avian and Fish Diseases, Kimron Veterinary Institute, Bet Dagan, Israel d Department of Biotechnology, Tel-Hai Academic College, Israel b c
a r t i c l e
i n f o
Article history: Received 10 January 2016 Received in revised form 10 April 2016 Accepted 12 April 2016 Available online xxx Keywords: ARV Subunit vaccine Sigma C
a b s t r a c t Avian reovirus (ARV) is a disease-causing agent. The disease is prevented by vaccination with a genotypespecific vaccine while many variants of ARV exist in the field worldwide. Production of new attenuated vaccines is a long-term process and in the case of fast-mutating viruses, an impractical one. In the era of molecular biology, vaccines may be produced by using only the relevant protein for induction of neutralizing antibodies, enabling fast adjustment to the emergence of new genetic strains. Sigma C (SC) protein of ARV is a homotrimer that facilitates host-cell attachment and induce the production and secretion of neutralizing antibodies. The aim of this study was to identify the region of SC that will elicit a protective immune response. Full-length (residues 1–326) and two partial fragments of SC (residues 122–326 and 192–326) were produced in Escherichia coli. The SC fragment of residues 122–326 include the globular head, shaft and hinge domains, while eliminating intra-capsular region. This fragment induces significantly higher levels of anti-ARV antibodies than the shorter fragment or full length SC, which neutralized embryos infection by the virulent strain to a higher extent compared with the antibodies produced in response to the whole virus vaccine. Residues 122–326 fragment is assumed to be folded correctly, exposing linear as well as conformational epitopes that are identical to those of the native protein, while possibly excluding suppressor sequences. The results of this study may serve for the development of a recombinant subunit vaccine for ARV. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Avian reovirus (ARV) is a member of the Orthoreovirus genus in the family Reoviridae [1,2]. It is associated with a number of diseases [3], the most prominent being viral arthritis syndrome (tenosynovitis) which is characterized by swelling of the hock joints and lesions in the gastrocnemius tendons [4], and causes considerable economic loss to the poultry industry [5]. Susceptibility to ARV occurs mostly in young (1–2 weeks of age) chickens [6–8]. The control of viral tenosynovitis in broiler chicks is conferred by antibodies that are transferred to the progeny following vaccination of maternal flocks [9]. The available live-attenuated and inactivated vaccines for ARV are based on the s1133 strain [10], as well as isolated strains belonging to a single serotype [11]. However, those vaccines are not effective against the diverse ARVs found in the
∗ Corresponding author at: Migal – Galilee Technology Center, Kiryat Shmona, Israel. Tel.: +972 4 6953509; fax: +972 4 6944980. E-mail address: [email protected] (J. Pitcovski).
field [11–13]. Sequencing of the sigma C (SC) protein of ARV isolates for genetic characterization enabled their division into genotypes [11,13–15]. Vaccination based on a mixture of the four representatives of ARV genotypes conferred protection against all tested viruses from the four genotypes [13]. The outer capsid cell attachment protein, SC of ARV, encoded by the S1 gene, is a relatively small protein of 326 amino acids [16], a homotrimer with a tertiary structure consisting of two domains: the “head”, which is located at the C-terminal end of the protein, and the “shaft”, at the N terminus. The crystal structure of the C-terminal domain and of residues 117–326 has been resolved [17,18]. SC elicits reovirus-specific neutralizing antibodies [19,20], making it a suitable candidate for a recombinant subunit vaccine. Indeed, efficient recombinant vaccines have been developed in the past for a number of viruses, including vaccines for hepatitis B [21] and for papillomavirus [22] for humans, as well as infectious bursal disease (IBD) [23] and egg drop syndrome [24] for chickens and hemorrhagic enteritis virus for turkeys [25]. SC has been expressed in various expression systems, including bacteria [17,18,26–28], baculovirus [29,30], yeast [31], plants [32] and
http://dx.doi.org/10.1016/j.vaccine.2016.04.036 0264-410X/© 2016 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model
ARTICLE IN PRESS
JVAC-17576; No. of Pages 6
D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
2
Table 1 Designed oligonucleotides for amplification of sigma C (SC) fragments. Labela
Direction
Primer sequences (5 → 3 )
Expected size (bp)
SC122–326 SC122–326
Forward Reverse
GGGGGATCCGACGGAAACTCCACTGCC GGGCGGCCGTTAGGTGTCGATGCCGG
669
SC192–326 SC192–326
Forward Reverse
GGGGGATCCTCGGCGGAGGCTCAACTAATGC GGGCGGCCGTTAGGTGTCGATGCCGG
459
a Oligonucleotides were designed to amplify the gene encoding SC122–326 and SC192–326 partial proteins; the 5 ends of the oligonucleotides were designed to create restriction enzyme sites BamHI–EagI, BamHI–EagI, and EcoRI–EcoRI (underlined), respectively, after PCR amplification.
mammalian cells [33]. Recombinant SC proteins have been used for diagnostics to distinguish between strains [26–28,30,34]. AntiSC antibodies have been shown to neutralize the virus in cell lines [28,31]. In a previous study, SC expressed in bacteria showed only weak immunogenicity [26,27]. The objective of the current study was to determine the fragment of the SC protein that will induce a high level of neutralizing antibodies toward the production of an efficient recombinant subunit vaccine against ARV.
2. Materials and methods 2.1. Expression of the SC protein Three cDNA fragments of SC from the vaccine strain s1133 encoding SC residues 1–326, 122–326 and 192–326 were produced by polymerase chain reaction (PCR) with specifically designed oligonucleotides (Table 1). Fragments 122–326 and 192–326 were cleaved with restriction enzymes BamHI and EagI introduced into the primers during synthesis, and were cloned into the expression vector pET28a (Novagen, Darmstadt, Germany), which included a purification tag containing six consecutive histidine residues at the N terminus. The sequence of the insert was confirmed by DNA-sequence analysis (Hy-Labs, Rehovot, Israel). For expression, Escherichia coli strain BL21 (DE3) was freshly transformed with the plasmid. Cultures were grown aerobically at 37 ◦ C to an optical density (OD) at 600 nm of 0.6–0.8. The cultures were cooled to below 25 ◦ C, and expression was induced by adding 1 mM isopropyl -d-1-thiogalactopyranoside (IPTG) and incubating for 3 h at 25 ◦ C. Harvested cells were resuspended in 40 ml cold resuspension buffer (4.29 mM Na2 HPO4 , 1.47 mM KH2 PO4 , 2.7 mM KCl, 137 mM NaCl, 0.1% v/v Tween-20) and frozen at −20 ◦ C [18]. Bacteria were lysed by sonicating three times for 10 min each time (Sonics, Taunton, MA, USA), centrifuged (10,000 × g for 15 min at 4 ◦ C) and the pellet was discarded. SC residue 1–326 was expressed as described previously [27]. The expressed SC122–326 protein fragment was purified in a Ni-NTA agarose column according to the manufacturer’s instructions (Qiagen, Hilden, Germany). The purified protein was dialyzed overnight against phosphate buffered saline (PBS) at 4 ◦ C. The expressed SC proteins were detected by 12% SDS–polyacrylamide gel electrophoresis (PAGE). The amount of SC protein was estimated by comparison with a standard curve of known amounts of bovine serum albumin run on the same gel. 2.2. Birds and vaccination Specific pathogen-free (SPF) birds (Charles River/SPAFAS) were hatched and raised in a sterile hatchery. At 1 week of age, the birds were randomly separated into six groups of 10 birds each. Each bird was vaccinated with 100 g SC protein mixed 1:1 (v/v) with Freund’s adjuvant to a final volume of 1 ml. Birds were vaccinated intramuscularly and subcutaneously at 14 and 28 days of age as described in Table 2. Blood was withdrawn 2 weeks after each of the vaccinations and serum was separated and kept at −20 ◦ C.
2.3. Enzyme-linked immunosorbent assay (ELISA) To determine the anti-SC antibody titer, SC was used as the antigen in an ELISA. The antigen was diluted in coating buffer (0.397 g Na2 CO3 , 0.732 g NaHCO3 , 250 ml double-distilled water pH 9.6) and incubated in an ELISA plate (Nunc, Rochester, NY, USA) for 24 h at 4 ◦ C. Each subsequent step was followed by three washes with 0.05% Tween-20 in PBS. Serum from birds vaccinated with the tested proteins or controls were serially double-diluted (1:100–1:800,000) in a blocking buffer (5% w/v skim milk, 0.05% Tween-20 in PBS) and incubated for 1 h. The secondary antibody, peroxidase-conjugated rabbit anti-chicken IgG (Sigma, Rehovot, Israel), diluted 1:7000, was added and the mixture was incubated for 1 h. The substrate o-phenylenediamine dihydrochloride (Sigma) was then added. OD was measured by ELISA reader (Thermo Scientific Multiskan RC, Vantaa, Finland) at 450 nm. The endpoint titer was determined as the last dilution for which the OD was still positive (relative to the negative control in the ELISA). The level of anti-ARV antibodies in the sera of vaccinated birds was determined by a commercial ELISA (IDEXX® Laboratories, USA) according to the manufacturer’s instructions. OD values were measured at 650 nm. Sample-to-positive (S/P) ratios greater than 0.2 were considered to be positive for ARV (S/P ratio = (sample mean OD − negative control mean OD)/(positive control mean OD − negative control mean OD)). 2.4. Cell-proliferation assay Spleens were collected from birds 42 days post-vaccination and macerated with a syringe plunger through a screen sieve to obtain a single-cell suspension in PBS. Splenocytes were suspended in RPMI 1640 supplemented with 2% fetal bovine serum, 2 mM l-glutamine, penicillin (100 U/ml) and streptomycin (10 ng/ml) (Biotech Industry, Bet Haemek, Israel). Cells (1 × 106 /well) were seeded in 96-well culture plates. Concanavalin A (ConA; 5 g/ml), lipopolysaccharide (LPS; 5 g/ml) or ARV (5 l/well, at a titer of 106.6 ) (Sigma–Aldrich) were added as stimulators in triplicate and incubated for 48 h. Cell titer blue (CTB) assay was performed by adding 20 l CTB reagent (Promega, Madison, WI, USA) to each well. The cells were then incubated for 6 h at 37 ◦ C under 5% CO2 . Color intensity of the CTB reagent was quantified by fluorometer at excitation/emission wavelengths of 560 and 590 nm,
Table 2 Vaccination program. Group
b
1 2 3 4 5 6 a b c
Vaccine at 14 da ARV s1133 PBS + adjuvantc SC1–326 SC122–326 SC192–326 SC122–326
Vaccine at 28 da ARV s1133 PBS + adjuvant SC1–326 SC122–326 SC192–326 ARV s1133
Days of age. Positive control. Negative control.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
3
respectively. The measured absorbance was proportional to the number of viable cells. Results were calculated and presented as stimulation index (SI), representing the ratio between stimulated cells and non-stimulated cells. 2.5. Neutralization test of virulent ARV strain s1133 The ability of the sera to neutralize virulent reovirus was tested by monitoring inhibition of embryonic mortality 3–7 days postinoculation. The tested sera were filtered and heated for 30 min at 56 ◦ C to inactivate complement activity. The virus was diluted with PBS in a series of 10-fold dilutions. Mixtures of equal volumes of diluted virus and sera (or PBS as a negative control) were incubated for 40 min at room temperature. Each of the mixtures was inoculated into five fertile 7-day-old SPF embryonated eggs. To confirm the virulence potential of the indicator virus, 10 eggs were inoculated with the undiluted virus that was mixed 1:1 with PBS. In addition, in several of the experiments, virus-free sera were inoculated into embryonated eggs to confirm the absence of nonspecific mortality due to serum constituents. All eggs were illuminated daily in a dark room to determine embryo viability, and the number of live and dead embryos was recorded. The neutralization index (NI) was determined as the ratio between the highest virus dilution that killed at least 95% (cumulative) of the embryos and the virus dilution that killed the same percentage of embryos in the presence of antibodies. NI value was expressed as the ratio between the log of the dilutions. A NI of 2 or greater in the antiserum was considered as having neutralized the virus. 2.6. Statistics ELISA, neutralization and cell-proliferation results were analyzed by one-way analysis of variance (ANOVA) with Tukey test. All of the analyses were performed with GraphPadPrism5 software. 3. Results 3.1. SC protein expression
Fig. 1. Antibody titers following vaccination with recombinant proteins SC1–326, SC122–326 and SC192–326. Controls: N.C. – negative control (birds vaccinated with PBS in adjuvant), P.C. – positive control (injected with ARV s1133). ***Significantly different at P < 0.001.
S/P in SC122–326 group was significantly higher than in the other groups. 3.3. Cell proliferation Splenocytes from the vaccinated chickens were examined for antigen-specific cell proliferation. Cells were treated with ConA as a control for proliferation of T cells, LPS as a control for proliferation of B cells (positive controls), PBS (negative control) and ARV (specific antigen). In the CTB assay, the measured absorbance was
Following analysis of the SC protein structure, cDNA fragments encoding three polypeptides residues: 1–326, 122–326, 192–326, were produced, cloned, and expressed in E. coli. A polyhistidine tag was added at the 5 end to allow for detection and purification of the expressed proteins. The resultant proteins were partially purified. The expressed SC fragments were at expected sizes of 36 kD, 23 kD and 15 kD, respectively as determined on a 12% SDS–polyacrylamide gel. 3.2. Antibody response to vaccination Following vaccination, the immunogenicity of the SC proteins and the ability of the produced antibodies to detect the virus were tested by ELISA. Using SC122–326 as the antigen, antibodies derived following vaccination with proteins SC122–326 and SC192–326 detected the antigen at high titers of 1:800,000. The mean of the titers of birds in this group were significantly higher (P < 0.001) than those in the negative control, whereas the mean of the antibody titer derived following vaccination with SC1–326 protein were similar to those of the negative control (Fig. 1). Antibody level against whole virus following vaccination with SC192–326 or the negative control reached a value of 0.2 or lower, whereas antibodies derived following vaccination with SC1–326 or SC122–326 were positive (0.25 and 0.5, respectively) (Fig. 2). The
Fig. 2. Virus detection by antibodies raised following protein injection. The relative level of anti-ARV antibody following injection with SC1–326, SC122–326 and SC192–326 is presented as the ratio between the ODs of the tested sample (S) and anti-ARV 1133 antibodies, provided in the KIT, that serve as positive control (P) (S/P). A value greater than 0.2 is considered positive (recognizing the virus). N.C. – negative control (birds vaccinated with PBS in adjuvant). ***Significantly different at P < 0.001.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
4
Fig. 3. Proliferation of lymphocytes derived from spleens of birds vaccinated with PBS in adjuvant as negative control (N.C.), ARV vaccine strain s1133 as positive control (P.C.), SC1–326 or SC122–326, following stimulation with ARV. Cells were treated with concanavalin A (ConA) or lipopolysaccharide (LPS) as controls for nonspecific antigen (Ag) cell proliferation, ARV for specific Ag proliferation, or the medium itself as a negative control (N.C.). The measured absorbance is proportional to the number of viable cells. Results are presented as stimulation index (SI) representing the ratio between stimulated and non-stimulated cells. ***, **Significantly different at P < 0.001 and 0.01, respectively.
proportional to the number of viable cells. Results are presented as SI (mitogen- or antigen-stimulated/nonstimulated cells). The positive control treatments exhibited proliferation following the stimulus. Cells stimulated with ARV showed significant differences among treatment groups. Cells from the group immunized with the virus or SC122–326 showed significant proliferation as compared to the negative control (P < 0.01), whereas proliferation in group that were injected with SC1–326 was significantly lower than SC122–326 or the positive control groups (P < 0.05) (Fig. 3). 3.4. Effect of SC122–326 in priming the response against ARV The effect of vaccination with SC122–326 as compared to vaccination with the whole-virus vaccine as an inducer of a primary response against ARV was tested. One group of chickens was injected with the ARV strain s1133 vaccine and the other with SC122–326. Two weeks later, ARV s1133 was injected into both groups. Primary vaccination with ARV or SC122–326, induces a similar significant elevation following secondary vaccination with whole ARV (Fig. 4). 3.5. Virus neutralization Sera from vaccinated birds were tested for neutralization ability against the virulent virus in SPF embryonated eggs. No protection was conferred by sera produced by the negative control birds or from the group injected with the SC1–326 (NI = 0). In contrast, serum produced by birds injected with the protein SC122–326 conferred protection (neutralization capacity) similar to that achieved with antibodies that developed following vaccination with whole virus (NI < 4) (Table 3). 4. Discussion The effectiveness of subunit vaccines to viruses has been proven in the past, including in chickens, examples being the antigenic protein VP2 of IBDV [23] and two avian adenovirus vaccines [24,25]. The adenovirus subunit vaccines showed a phenomenon similar to that observed with the SC protein in this study, where the recombinant protein was immunogenic and induced protective
Fig. 4. The effect of primary vaccination with SC122–326 on the secondary response to ARV. Results are expressed as dilution end-points, tested by ELISA. Negative control-vaccinated with PBS and adjuvant. ***Significantly different at P < 0.001.
neutralizing antibodies only when a fragment was expressed that included the knob and an adjacent short fragment of the shaft from the fiber protein while eliminating part of the protein [24,25]. ARV mutates relatively fast and many variants exist in the field worldwide. Vaccines that protect against one genotype are inefficient against others [11,26,35,36]. Production of attenuated vaccine is a long process, and in the case of highly mutated viruses inefficient. Adaptation of vaccines to alterations in the field virus is by the use of inactivated vaccines that are produced by propagation of the virulent isolates in cell cultures or embryonated eggs and its subsequent inactivation. In the era of molecular biology, subunit vaccines may be produced by genetic engineering. In this method, only the relevant updated protein for induction of neutralizing antibodies is produced in an expression system. This method of using recombinant subunit proteins has some advantages over conventional vaccines: (a) the recombinant subunit vaccine is produced in cells and there is no risk of disease caused by incomplete inactivation or reversal to virulence of inactivated or attenuated virus, respectively; (b) there is no need to infect live embryos (as in the production of some viral vaccines), impacting animal welfare; (c) the procedure is controlled and repeatable; (d) the vaccinated human or animal is exposed mainly to the relevant epitopes, eliminating induction of an immune response to a whole virus, of which most epitopes are irrelevant for the induction of a protective response; (e) in some cases, suppressive elements are produced by viruses and the immune response against the vaccine, as well as the general immune response, are reduced. This is eliminated by the use of subunit vaccines; (f) adjustment of the subunit vaccine to emergence of new genetic strains is relatively rapid. To develop a subunit vaccine, recombinant proteins must be expressed in an expression system which outcome protein will mimic the native one. In this study, as SC protein is not glycosylated, E. coli was chosen as the expression system, providing an efficient [37–40] and relatively inexpensive way of producing Table 3 Virus neutralization by antibodies against ARV or SC fragments. Vaccination
Neutralization indexa
Adjuvant only (negative control) ARV s1133 SC1–326 SC122–326
0 4 0 >4
a Neutralization index (NI) value of 2 or higher is considered as neutralizing against that virus.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
Fig. 5. Partial structure (amino acids 117–326) of sigma C (SC) protein of avian reovirus strain s1133. Numbers represent amino acid positions in the protein structure. Adapted from Guardado-Calvo et al. [18].
proteins. Trimerization plays an important role in receptor binding and in many cases is crucial to obtain anti-conformational antibodies that will neutralize the virus [41]. As shown previously [26,27], SC in its full 326-amino-acid form induces only a low titer of antibodies, although antibodies against s1133 strain of ARV, do identify the recombinant SC. Following analysis of the published SC protein structure [17,18], a cDNA fragment encoding three different lengths of the protein – residues 1–326, 122–326, and 192–326 (Fig. 5) – were tested as candidates for subunit vaccine that will elicit the highest levels of anti-ARV neutralizing antibodies. In the region of amino acids 117–326, the shaft domain has a mixed alpha helix as well as a triple beta spiral that are separated by a flexible linker. This structure might comprise a functionally important hinge in the context of protein structure [18]. The shorter fragment that was produced and tested in this study, SC amino acids 192–326, contains the globular head and additional four amino acids from the shaft, potentially designed to maintain correct trimerization and folding of the native protein, while focusing on the globular region of the protein. Both fragments were expressed as soluble polypeptides. While SC1–326 induce low titer of antibodies, the other two fragments induced an immune response with high antibody titers, the most prominent one being SC122–326. In this light, SC1–326 may serve as an excellent background and an additional negative control. The low level of antibodies induced by SC1–326 may be because this fragment contains a region that is naturally anchored in the protein capsid [16] and expressing the protein as a subunit results in misfolding of the whole structure. Eliminating this region in the other two fragments thus enabled correct folding and enhanced immunogenicity. The extremely high level of antibodies induced by SC122–326 fragment may be explained by its correct folding, which might be of importance to the elucidation of a strong immune response. SC structure shows that the presence of hinge regions around residues 110 and 158 may be important for receptor binding or subsequent penetration of the infectious viral particle into the cell. These residues may also be important for SC trimerization in the viral particle [18]. Another explanation for the different immunogenicity of the SC fragments might be that the section that was eliminated in SC122–326 and SC192–326, namely amino acids 1–121, contains an immunosuppressive element [42]. Vaccination with SC122–326 yielded antibodies that identified the virus with the highest titer in the commercial ELISA kit, at which a whole virus is used as antigen. Moreover, as SC was found to be the cell-attachment protein of ARV, carrying the main neutralizing epitopes, high proportion of the antibodies raised against this fragment are targeted to neutralizing epitopes, whereas antibodies induced following vaccination with the whole virus detect many capsid epitopes, most of which are irrelevant for VN. It seems that this fragment is folded correctly, exposing linear as well as conformational epitopes to the
5
immune system that are identical to those of the native protein. This was further supported by the cell-proliferation tests in which, following the stimulation of the cells of the different experimental groups with ARV, only cells from birds that were immunized with SC122–326 polypeptide proliferated to the same extent as the positive control, which was vaccinated with the whole virus. Cells produced following injection of the other fragments resulted in weaker proliferation. In the cell-viability test with CTB, fewer live cells were detected in the negative control group, possibly due to virus-induced lysis [43]. As SC122–326 yielded the highest levels of antibodies, it was further analyzed. The ability to get a secondary immune response against ARV following priming with SC122–326 indicated that the same populations of B and T lymphocytes are induced by SC122–326 and the whole virus toward this fragment. This might indicate that vaccinating with SC122–326 may be sufficient for eliciting a full protected antibody response. The efficacy of SC122–326 as a vaccine against ARV was further tested by viral neutralization test. Antibodies produced against the SC protein showed successful neutralization in cell systems [28,44]. However, neutralization tests in bird embryos are more accurate at predicting viral neutralization in adult birds. In this study, antibodies produced following injection of SC122–326 protein were found to be protective, eliminating infection of bird embryos by the virulent strain to the same extent as antibodies produced in response to the whole virus. In a recent study, ARV SC protein was found to elicit a strong mucosal immunity [45]. In this aspect, in addition to anti-ARV response, SC may be used as an immune-enhancer for other vaccines. Results of this study may serve in the development of a recombinant vaccine with SC122–326 fragment. Its potential for protection should be evaluated through challenge tests is SPF and broiler chickens. It would be advisable to examine its crossprotection potential to emerging variants. SC122–326 fragment can be used as part of a multivalent vaccine of strains representing various serotypes. The approach described in this study may facilitate rapid adjustment of a vaccine to new virulent strains of ARV. References [1] Attoui H, Billoir F, Biagini P, de Micco P, de Lamballerie X. Complete sequence determination and genetic analysis of Banna virus and Kadipiro virus: proposal for assignment to a new genus (Seadornavirus) within the family Reoviridae. J Gen Virol 2000;81:1507–15, http://dx.doi.org/10.1099/0022-1317-81-6-1507. [2] Mertens P. The dsRNA viruses. Virus Res 2004;101:3–13, http://dx.doi.org/10.1016/j.virusres.2003.12.002. [3] Robertson M, Wilcox G. Avian reovirus. Vet Bull 1986;56:759–66. [4] Wilcox GE, Robertson MD, Lines AD. Adaptation and characteristics of replication of a strain of avian reovirus in Vero cells. Avian Pathol 1985;14:321–8, http://dx.doi.org/10.1080/03079458508436234. [5] Rosenberger JK, Sterner FJ, Botts S, Lee KP, Margolin A. In vitro and in vivo characterization of avian reoviruses. I. Pathogenicity and antigenic relatedness of several avian reovirus isolates. Avian Dis 1989;33:535–44. [6] Montgomery RD, Villegas P, Dawe DL, Brown J. Effect of avian reoviruses on lymphoid organ weights and antibody response in chickens. Avian Dis 1985;29:552–60. [7] Bains BS, MacKenzie M, Spradbrow PB. Reovirus-associated mortality in broiler chickens. Avian Dis 1974;18:472–6. [8] Fahey JE, Crawley JF. Studies on chronic respiratory disease of chickens. II. Isolation of a virus. Can J Comp Med Vet Sci 1954;18:13–21. [9] Gharaibeh S, Mahmoud K, Al-Natour M. Field evaluation of maternal antibody transfer to a group of pathogens in meat-type chickens. Poult Sci 2008;87:1550–5, http://dx.doi.org/10.3382/ps.2008-00119. [10] van der Heide L, Kalbac M, Brustolon M. Development of an attenuated apathogenic reovirus vaccine against viral arthritis/tenosynovitis. Avian Dis 1983;27:698–706. [11] Goldenberg D, Pasmanik-Chor M, Pirak M, Kass N, Lublin A, Yeheskel A, et al. Genetic and antigenic characterization of sigma C protein from avian reovirus. Avian Pathol 2010;39:189–99, http://dx.doi.org/10.1080/03079457.2010.480969.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036
G Model JVAC-17576; No. of Pages 6 6
ARTICLE IN PRESS D. Goldenberg et al. / Vaccine xxx (2016) xxx–xxx
[12] Jones RC. Avian reovirus infections. Rev Sci Tech 2000;19:614–25. [13] Lublin A, Goldenberg D, Rosenbluth E, Heller ED, Pitcovski J. Widerange protection against avian reovirus conferred by vaccination with representatives of four defined genotypes. Vaccine 2011;29:8683–8, http://dx.doi.org/10.1016/j.vaccine.2011.08.114. [14] Kant A, Balk F, Born L, van Roozelaar D, Heijmans J, Gielkens A, et al. Classification of Dutch and German avian reoviruses by sequencing the sigma C protein. Vet Res 2003;34:203–12, http://dx.doi.org/10.1051/vetres:2002067. [15] Troxler S, Rigomier P, Bilic I, Liebhart D, Prokofieva I, Robineau B, et al. Identification of a new reovirus causing substantial losses in broiler production in France, despite routine vaccination of breeders. Vet Rec 2013;172:556, http://dx.doi.org/10.1136/vr.101262. [16] Benavente J, Martínez-Costas J. Avian reovirus: structure and biology. Virus Res 2007;123:105–19, http://dx.doi.org/10.1016/j.virusres.2006.09.005. [17] Guardado Calvo P, Fox GC, Hermo Parrado XL, Llamas-Saiz AL, Costas C, Martínez-Costas J, et al. Structure of the carboxy-terminal receptorbinding domain of avian reovirus fibre sigmaC. J Mol Biol 2005;354:137–49, http://dx.doi.org/10.1016/j.jmb.2005.09.034. [18] Guardado-Calvo P, Fox GC, Llamas-Saiz AL, van Raaij MJ. Crystallographic structure of the ␣-helical triple coiled-coil domain of avian reovirus S1133 fibre. J Gen Virol 2009;90:672–7, http://dx.doi.org/10.1099/vir.0.008276-0. [19] Shapouri MRS, Frenette D, Larochelle R, Arella M, Silim A. Characterization of monoclonal antibodies against avian reovirus strain S1133. Avian Pathol 1996;25:57–67, http://dx.doi.org/10.1080/03079459608419120. [20] Grande ANA, Varela N, Garci N, Benavente J. Protein architecture of avian reovirus S1133 and identification of the cell attachment protein. J Virol 1997;71:59–64. [21] McAleer WJ, Buynak EB, Maigetter RZ, Wampler DE, Miller WJ, Hilleman MR. Human hepatitis B vaccine from recombinant yeast. Nature 1984;307:178–80. [22] Valentino K, Poronsky CB. Human papillomavirus infection and vaccination. J Pediatr Nurs 2015, http://dx.doi.org/10.1016/j.pedn.2015.10.005. [23] Pitcovski J, Gutter B, Gallili G, Goldway M, Perelman B, Gross G, et al. Development and large-scale use of recombinant VP2 vaccine for the prevention of infectious bursal disease of chickens. Vaccine 2003;21:4736–43, http://dx.doi.org/10.1016/S0264-410X(03)00525-5. [24] Fingerut E, Gutter B, Gallili G, Michael A, Pitcovski J. A subunit vaccine against the adenovirus egg-drop syndrome using part of its fiber protein. Vaccine 2003;21:2761–6, http://dx.doi.org/10.1016/S0264-410X(03)00117-8. [25] Pitcovski J, Fingerut E, Gallili G, Eliahu D, Finger A, Gutter B. A subunit vaccine against hemorrhagic enteritis adenovirus. Vaccine 2005;23:4697–702, http://dx.doi.org/10.1016/j.vaccine.2005.03.049. [26] Vasserman Y, Eliahoo D, Hemsani E, Kass N, Ayali G, Pokamunski S, et al. The influence of reovirus sigma C protein diversity on vaccination efficiency. Avian Dis 2004;48:271–8, http://dx.doi.org/10.1637/7091. [27] Goldenberg D, Lublin A, Rosenbluth E, Heller ED, Pitcovski J. Differentiating infected from vaccinated animals, and among virulent prototypes of reovirus. J Virol Methods 2011;177:80–6, http://dx.doi.org/10.1016/j.jviromet.2011.06.023. [28] Jung KM, Bae EH, Jung YT, Kim JW. Use of IgY antibody to recombinant avian reovirus C protein in the virus diagnostics. Acta Virol 2014;58: 108–13.
[29] Lin YH, Lee LH, Shih WL, Hu YC, Liu HJ. Baculovirus surface display of sigma C and sigma B proteins of avian reovirus and immunogenicity of the displayed proteins in a mouse model. Vaccine 2008;26:6361–7, http://dx.doi.org/10.1016/j.vaccine.2008.09.008. [30] Hsu CJ, Wang CY, Lee LH, Shih WL, Chang CI, Hsueh L, et al. Development and characterization of monoclonal antibodies against avian reovirus C protein and their application in detection of avian reovirus isolates. Avian Pathol 2007;9457:320–6, http://dx.doi.org/10.1080/03079450600823386. [31] Wu H, Williams Y, Gunn KS, Singh NK, Locy RD, Giambrone JJ. Yeastderived sigma C protein-induced immunity against avian reovirus. Avian Dis 2005;49:281–4, http://dx.doi.org/10.1637/7284-092904R1. [32] Huang L, Liao S, Chang C, Liu H. Expression of avian reovirus sigma C protein in transgenic plants. J Virol Methods 2006;134:217–22, http://dx.doi.org/10.1016/j.jviromet.2006.01.013. [33] Theophilos MB, Huang JA, Holmes IH. Avian reovirus sigma C protein contains a putative fusion sequence and induces fusion when expressed in mammalian cells. Virology 1995;208:678–84, http://dx.doi.org/10.1006/viro.1995.1199. [34] Liu HJ, Kuo LC, Hu YC, Liao MH, Lien YY. Development of an ELISA for detection of antibodies to avian reovirus in chickens. J Virol Methods 2002;102: 129–38. [35] Lu H, Tang Y, Dunn PA, Wallner-Pendleton EA, Lin L, Knoll EA. Isolation molecular characterization of newly emerging avian reovirus variants novel strains in Pennsylvania, USA, 2011–2014. Sci Rep 2015;5:14727, http://dx.doi.org/10.1038/srep14727. [36] Shapouri MR, Kane M, Letarte M, Bergeron J, Arella M, Silim A. Cloning, sequencing and expression of the S1 gene of avian reovirus. J Gen Virol 1995;76(Pt 6):1515–20, http://dx.doi.org/10.1099/0022-1317-76-6-1515. [37] Pope B, Kent HM. High efficiency 5 min transformation of Escherichia coli. Nucleic Acids Res 1996;24:536–7. [38] Sezonov G, Joseleau-Petit D, D’Ari R. Escherichia coli physiology in Luria-Bertani broth. J Bacteriol 2007;189:8746–9, http://dx.doi.org/10.1128/JB.01368-07. [39] Lee SY. High cell-density culture of Escherichia coli. Trends Biotechnol 1996;14:98–105, http://dx.doi.org/10.1016/0167-7799(96)80930-9. [40] Shiloach J, Fass R. Growing E. coli to high cell density – a historical perspective on method development. Biotechnol Adv 2005;23:345–57, http://dx.doi.org/10.1016/j.biotechadv.2005.04.004. [41] Grande A, Rodriguez E, Costas C, Everitt E, Benavente J. Oligomerization and cell-binding properties of the avian reovirus cell-attachment protein sigma C. Virology 2000;274:367–77, http://dx.doi.org/10.1006/viro.2000.0473. [42] Schellekens H. Immunogenicity of therapeutic proteins: clinical implications and future prospects. Clin Ther 2002;24:1720–40, discussion 1719. [43] Shih WL, Hsu HW, Liao MH, Lee LH, Liu HJ. Avian reovirus C protein induces apoptosis in cultured cells. Virology 2004;321:65–74, http://dx.doi.org/10.1016/j.virol.2003.12.004. [44] Lin YH, Lee LH, Shih WL, Hu YC, Liu HJ. Baculovirus surface display of sigmaC and sigmaB proteins of avian reovirus and immunogenicity of the displayed proteins in a mouse model. Vaccine 2008;26:6361–7, http://dx.doi.org/10.1016/j.vaccine.2008.09.008. [45] Lin KH, Hsu AP, Shien JH, Chang TJ, Liao JW, Chen JR, et al. Avian reovirus sigma C enhances the mucosal and systemic immune responses elicited by antigenconjugated lactic acid bacteria. Vaccine 2012;30:5019–29.
Please cite this article in press as: Goldenberg D, et al. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.04.036