- Email: [email protected]
Dietary administration of laminarin improves the growth performance and immune responses in Epinephelus coioides
Fish & Shellfish Immunology 41 (2014) 402e406
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Dietary administration of laminarin improves the growth performance and immune responses in Epinephelus coioides Guangwen Yin a, 1, Wenwu Li a, 1, Qian Lin a, Xi Lin a, Jianbin Lin b, Qingguo Zhu b, Heji Jiang a, Zhijian Huang a, * a Engineering Laboratory of Animal Pharmaceuticals, College of Animal Science, Fujian Agriculture and Forestry University, Fuzhou, Fujian Province 350002, PR China b Fujian Provincial Institute of Freshwater Fisheries, Fuzhou, Fujian Province 350002, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 June 2014 Received in revised form 9 September 2014 Accepted 20 September 2014 Available online 28 September 2014
This study was conducted to evaluate the effects of laminarin on the growth performance, immunological and biochemical parameters, as well as immune related genes expression in the grouper, Epinephelus coioides. One hundred and eight fish were randomly divided into four groups (45 groupers/ group). Blank control group was fed with the basal diet, while low, medium and high doses of laminarin groups were fed with the basal diet supplemented with 0.5%, 1.0%, and 1.5% laminarin, respectively, for 48 days. The immunological and biochemical parameters in blood were investigated. The mRNA levels of IL-1b, IL-8, and TLR2 in midgut were also evaluated by quantitative real-time PCR. Dietary laminarin supplementation significantly improved the specific growth rate and the feed efficiency ratio of the fish. The level of TP and the activity of LZM, CAT and SOD were higher than that of the control. The levels of UREA and CREA as well as the activity of ALP were lower than of the control. There was no significant difference in the levels of ALT and AST between control groups and treated groups. In addition, dietary laminarin supplementation decreased the levels of C3 and C4. The expression of immune response genes IL-1b, IL-8, and TLR2 showed significant increases (P < 0.05) in groupers fed low dose (0.5%) and medium dose (1.0%) of laminarin compared with the blank control. These results suggest that laminarin modulates the immune response and stimulates growth of the fish. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Laminarin Growth performance Immunological and biochemical parameters Groupers
1. Introduction Groupers, Epinephelus spp. (Epinephelus coioides), are important mariculture fish in China and Southeast Asian countries for their fast growth, popular taste, and high nutritional and economic value [1e3]. Recently, the consumers' demand for farmed fish has increasingly emphasized on quality and safety, and the absence of concomitant pollutants and antibiotics [4]. Therefore, rearing strategies need to focus on feed hygiene, in addition to growth performance [5,6]. This has hastened the search for the identification and development of safe dietary supplements and additives that can enhance the physiological activity, health, and immune function of the farmed fish [3,7]. Recently, seaweeds extracts (SWE) have been studied as an alternative to in-feed antibiotics in pig diets [8e10]. Seaweeds are
* Corresponding author. Tel./fax: þ86 591 83845697. E-mail addresses: [email protected], [email protected] (Z. Huang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2014.09.027 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
known for their richness in polysaccharides, minerals and certain vitamins. The most abundant polysaccharides in brown seaweeds are laminarin, fucoidan and alginic acid [11]. Laminarin is found mainly in the fronds of Laminaria. The content of laminarin varies with season and habitat, and can reach up to 32% of dry weight. Recently, Lynch et al. (2010) have shown that laminarin has antimicrobial properties [12]. Laminarin can also influence the adherence and the translocation of bacteria across the epithelial wall, and seems to be a modulator of the intestinal metabolism by its effects on mucus composition, intestinal pH and short-chain fatty acid production, especially butyrate [13]. Laminarin can boost the immune system, reduce cholesterol levels in serum, and lower systolic blood pressure [14]. Laminarin can also inhibit heparanase activity and tumor metastasis [15]. These findings suggest that seaweed extracts have great potential as a supplement in functional food. To our knowledge, no study using laminarin as a supplement in diet in groupers has been reported. Here, we studied the effect of laminarin on growth performance, immunological and biochemical parameters, and immune related genes expression in the grouper, E. coioides.
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
2. Materials and methods 2.1. Experimental diets Laminarin was provided by Addison Biological Technology (Beijing, China). Four diets containing different doses of laminarin were prepared. The proximate analysis of the basal diet was 49.26% crude protein, 7.63% crude lipid, 15.93% ash, and 6.58% moisture. Diets were formulated to contain different levels of laminarin (the basal diet supplemented with 0.5%, 1.0%, and 1.5% laminarin). All diets were individually blended in a mixer and then homogenized after mixed oil was added. Distilled water was included to achieve a proper pelleting consistency, and the mixture was further homogenized. The mixed ingredients were made into pellets using an extruder with a 4 mm diameter and a rotation cutter. The moist pellets were dried in a forced air oven at room temperature for about 12 h, and then stored at 20 C until used for the feeding trial. 2.2. Experimental procedure Grouper (E. coioides) obtained from a local commercial farm were acclimatized to the experimental conditions for 2 weeks before the start of the experiment. Fish of similar sizes (mean weight 90 ± 2.6 g and mean length 15 ± 2.25 cm) were distributed into 12 tanks (each group consisted of three tanks) with 15 groupers per tank. Each tank was then randomly assigned to one of three replicates of the four dietary treatments (blank control, laminarin high, laminarin medium and laminarin low). The fed rate was 3% biomass per day provided in equal rations at 09:00 and 17:00 h for 48 days. The amount of diet consumed was determined by daily recovery of excess feed, which was then dried and weighed. Daily feed was adjusted every 2 weeks by batch weighing after a 24 h of starvation. All rearing tanks were provided with continuous aeration. Water was recirculated through a biological and mechanical filtration system containing vertical quartz sand filter and activated carbon purifier to remove solid and nitrogenous wastes. Water temperature and pH were constant (24e30 C; pH 8.0) during the experimental period, dissolved oxygen was maintained at 6e7 mg/L, and the NH3-N was <0.3 mg/L. 2.3. Growth performance At the beginning and at the end of the feeding trial, the fish were starved for 24 h and anesthetized. Body weight and length were measured for the fish in each tank. Weight gain (WG), feed efficiency (FE) were calculated as follows:
WG ¼ final body weight initial body weight FEð%Þ ¼ WG=feed intake 100 At the end of the feeding trial, 5 fish were removed randomly from each diet group replicate tank for analysis of the hepatosomatic index (HSI), viscerasomatic index (VSI) and condition factor (CF). Liver and viscera were weighed to calculate the HSI and VSI as follows:
HSIð%Þ ¼ ðhepatic weight=body weightÞ 100 VSIð%Þ ¼ ðviscera weight=body weightÞ 100 CF ¼ fish weight 100=fish length
403
Survivalð100%Þ ¼ ðnumber of final fish=number of initial fishÞ 100 2.4. Sample collection Five fish per tank were sampled for analyses of biochemical parameters. Blood was collected from the caudal vein with a heparinized syringe and transferred into a heparinized tube. Plasma was recovered after centrifugation (6000 g, 10 min) and immediately stored at 80 C until analysis. For the tissue sampling, 5 fish per tank were dissected under sterile conditions, and the midgut was pulled out and washed with phosphate buffered saline (PBS) (pH 7.2) to remove the intestinal contents. The tissue fragments were immediately stored at 80 C in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) for RNA extraction. 2.5. Immunological and biochemical parameters 2.5.1. Lysozyme assay Serum lysozyme activity was determined with lysozyme kit (Jiancheng Bioengineering Institute, Nanjing, China) using the method that measures the decrease in turbidity after lysis of Micrococcus peptidoglycan of the cell wall [16]. Results are presented as U (units/ml). 2.5.2. Complement activity The serum complement C3 and C4 levels were assayed using a C3 kit and C4 kit, (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively. Analysis of the complement level included measurement of the increase in turbidity after immunity response of complement and its increased antibody [2,17]. Results of C3 are presented as C3 g/L, while results of C4 are presented as C4 mg/L. 2.5.3. Antioxidant-related parameters assay Superoxide dismutase (SOD), catalase (CAT), alkaline phosphatase (ALP) activities in serum were determined with a UV-2100 spectrophotometer (Unico, USA) at 550, 405 and 520 nm, respectively [16]. Antioxidant-related parameter detection kits (SOD, CAT, and ALP) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). 2.5.4. Biochemical assay The biochemical indices determined in blood plasma included total proteins (TP), creatinine (CREA), UREA, aspartate aminotransferase (AST), alanine aminotranspherase (ALT). Plasma samples were analyzed using a biochemical analyzer (VetTest 8008; Idexx Laboratories, Inc, Westbrook, ME, USA) by the colorimetric method previously used for fish blood biochemistry [18,19]. 2.6. Cytokine expression analyses by qPCR Total RNA was extracted from the samples using Trizol reagent (Invitrogen, Carlsbad, CA). The final RNA was eluted in an appropriate amount of 0.1% diethyl pyrocarbonate (DEPC) treated water (SigmaeAldrich, St. Louis, MO, USA). For each sample, the integrity of RNA extracted was confirmed by agarose gel electrophoresis by staining with ethidium bromide and visualizing under UV light. The amount of RNA extracted was determined, and its purity (OD260/ OD280 ratio between 1.8 and 2.2) was verified using an ND-1000 spectrophotometer (NanoDropTechnologies, Wilmington, DE, USA). The cDNA was synthesized using random primers and a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The primer pairs used for analysis of specific
404
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
Table 1 Primers used for real-time PCR.
Table 3 Effect of laminarin on non-specific immune response in groupers.
Gene name
GenBank number
Products size (bp)
Primer sequences
Parameters
Control group
Laminarin (0.5%)
Laminarin (1.0%)
Laminarin (1.5%)
b-actin
AY510710
123
59.49 ± 19.28a
51.85 ± 23.62b
52.04 ± 13.35b
EF582837
135
IL-8
FJ913064
137
Lysozyme (LZM) (U/ml) C3 (g/L) C4 (mg/L)
46.32 ± 9.82b
IL-1b
0.162 ± 0.011b 9.376 ± 0.476b
0.149 ± 0.026a 5.153 ± 0.992a
0.157 ± 0.022b 6.454 ± 0.810a
0.161 ± 0.031b 8.349 ± 1.451b
TLR2
HM357230
125
CATCACACCTTCTACAACGA AAGGTCTCGAACATGATCTG AAGGGCATTATCTCAGAATCAG TCATATCCTCATCAGTCGGT CATTGTCATCTCCATTGCGG GGTATCAGCTCCACCTTCTC GGACTCTGCTGACTACTGTG CTGAACCCTCCTCATCTCTG
genes (Table 1) were designed with the PerlPrimer software (perlprimer.sourceforge.net). Quantitative real-time PCR was performed on the 7500 Real Time PCR System (Applied Biosystems, USA) with a program of 50 C for 2 min, 95 C for 10 min and 40 cycles of 95 C for 15 s, and 60 C for 1 min. For each sample, template copy numbers were internally normalized with their respective input control. All real time-PCRs were performed at least in triplicate. Data analysis was conducted using the 2DDCT method [20], and b-actin was included as an internal reference for normalization of gene expression data. 2.7. Statistical analysis Values were expressed as mean ± SD. Data were subjected to one-way analysis of variance (ANOVA) to determine whether significant differences occurred in fish fed the different diets. If a significant difference was identified, differences among means were compared by Tukey's multiple range tests (P < 0.05). Statistical analysis was performed using the Statistica software package (Version 6.0, Statsoft, Tulsa, OK, USA). 3. Results 3.1. Survival and growth There was no mortality in the trial (Table 2). The feed intake was significantly higher in the 0.5% laminarin group as compared with the other groups (P < 0.05). The weight gain (WG), weight gain rate (WGR), feed efficiency (FE) in fish in the 0.5% laminarin group and the 1.0% laminarin group was significantly higher than that in the 1.5% laminarin group and the control group. HSI values in the 0.5% laminarin group and the 1.5% laminarin group were significantly higher than those in the other groups (P < 0.05). VSI, and CF values in the 0.5% laminarin group were significantly higher than those in the other groups (P < 0.05). 3.2. Immunological and biochemical parameters 3.2.1. Serum lysozyme activities Dietary supplementation of laminarin regardless of inclusion level could increase the activities of lysozyme in the serum.
Note: Values are expressed as mean ± SD (n ¼ 15). Means in the same row with different letters were significantly different between treatment groups (P < 0.05).
Groupers fed low dose (0.5%) of laminarin showed significant increases of the activities compared with other groups (P < 0.05). However, no significant difference was observed in serum lysozyme activity between the high dose group, medium dose group and the blank control group (Table 3). 3.2.2. Serum complement activity After 48 days of feeding, serum complement C3 and C4 levels of the laminarin treatments were lower than that of control (Table 3). C3 decreased only at 0.5%, and C4 at 0.5% and 1.0% (Table 3). 3.2.3. Antioxidant-related parameters There were no significant differences in the SOD activities between the groups fed with laminarin and the control group (P > 0.05). Plasma CAT activities in the 0.5% laminarin group were significantly higher than those in the other groups (P < 0.05). No significant differences were observed in the activities of ALP among the dietary treatments (P > 0.05) (Table 4). 3.2.4. Plasma biochemical parameters No significant differences were observed in the level of total protein among the dietary treatments (P > 0.05) (Table 4). UREA was significantly lower only at 0.5% laminarin group, and CREA was significantly lower only at 1.5% laminarin group. No significant differences were observed in the activities of AST and ALT among the dietary treatments (P > 0.05) (Table 4). 3.3. Intestinal cytokine and TLR2 gene expression in groupers The expression of immune response genes IL-1b, IL-8, and TLR2 showed significant increases (P < 0.05) in groupers fed low dose (0.5%) and medium dose (1.0%) of laminarin compared with the blank control. Although the high dose (1.5%) of laminarin can also enhance the expression of the immune response genes, but no significant difference was observed between the high dose group and the blank control group (Fig. 1). It appeared that the effect of laminarin on immune response genes expression was independent of the dose of laminarin.
Table 2 Growth performance of E. coioides fed laminarin-supplemented diets for 48 days. Parameters
Control group
Body weight gain (g) Final fish length (cm) Condition factor (CF) Feed efficiency (FE) Viscerasomatic index (VSI) Hepatosomatic index (HSI)
63.59 17.32 8.75 1.31 8.74 3.47
± ± ± ± ± ±
20.55b 2.56 1.80b 0.01b 0.73b 0.66b
Laminarin low (0.5%) 86.51 17.38 10.24 1.16 10.19 3.85
± ± ± ± ± ±
32.67a 1.74 1.82a 0.01a 1.37a 0.74a
Laminarin medium (1.0%) 80.56 18.06 9.47 1.21 8.71 3.44
± ± ± ± ± ±
23.90a 2.05 1.44b 0.01a 0.45b 0.53b
Laminarin high (1.5%) 70.53 17.61.93 9.03 1.25 8.98 4.05
± ± ± ± ± ±
19.10b 1.82 1.65b 0.01b 1.26b 0.73a
Note: Values are expressed as mean ± SD (n ¼ 15). Means in the same row with different letters were significantly different between treatment groups (P < 0.05).
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
405
Table 4 Effect of laminarin on plasma biochemical parameters in groupers. Parameters
Control group
CAT (U/ml) SOD (mg/ml) ALP (U/L) TP (g/L) UREA (mmol/L) CREA (mmol/L) AST (U/L) ALT (U/L)
1.12 45.68 193.12 41.13 2.95 441.63 247.88 13,752.62
± ± ± ± ± ± ± ±
0.68b 6.56b 74.58 6.07 0.99a 187.66a 79.71 8097
Laminarin (0.5%) 2.45 72.97 171.13 44.38 2.39 426.25 250.75 14,125.25
± ± ± ± ± ± ± ±
1.27a 19.49a 39.20 8.1 0.07b 141.52a 65.78 9383.02
Laminarin (1.0%) 1.57 53.25 169.37 46.37 2.51 404.00 223.87 13,169.25
± ± ± ± ± ± ± ±
1.40b 24.36b 141.86 11.72 0.30a 173.51a 86.01 7819.3
Laminarin (1.5%) 1.25 48.84 168.37 42.75 2.56 335.25 265.25 11,632.50
± ± ± ± ± ± ± ±
0.62b 14.66b 44.83 9.36 0.35a 146.35b 84.10 4731.72
Note: Values are expressed as mean ± SD (n ¼ 15). Means in the same row with different letters were significantly different between treatment groups (P < 0.05). Catalase (CAT), superoxide dismutase (SOD), alkaline phosphatase (ALP), total proteins (TP), creatinine (CREA), UREA, aspartate aminotransferase (AST), alanine aminotranspherase (ALT).
4. Discussion The main beneficial effects of laminarin use in pigs are the improvement of growth performance and the reduction of the enterobacteriaceae populations [10,21]. In the present study, the potential beneficial effects of laminarin on the fish E. coioides were evaluated in a 48-day feeding trial. We observed a significant increase of WG, SGR and a significant decrease of FCR in fish fed diets supplemented with laminarin for 48 days. This revealed that the fish utilize dietary nutrients more efficiently when feed is supplemented with laminarin. Lysozyme is a cationic enzyme that attacks the peptidoglycan of bacterial cell walls. This enables lysozyme to lyse certain Grampositive bacteria, and in conjunction with complement, even some Gram-negative bacteria. Dietary administration of Bacillus strains could significantly enhance serum lysozyme activity of E. coioides and rainbow trout [2,22,23]. In line with those previous studies, the serum lysozyme activities increased significantly after 48 days of feeding laminarin-containing diets in our study. Complement is the major humoral component of the innate immune responses, which plays an essential role in alerting the host immune system of the presence of potential pathogens as well as their clearance. C3 and C4 are the key components of both classical and lectin pathways [24]. Complement activation is usually beneficial to the host, but persistent activation of complement could lead to adverse effects and immunosuppression to the host. Matsumoto et al. [25] have isolated an anti-complementary polysaccharide from the roots of Bupleurum falcataum. Olafsdottir et al. [26] have reported that O6-branched (1-3)-b-glucan from the lichen possesses an anti-complementary activity. In our study, after 48 days of feeding, laminarin-supplemented groups showed lower levels of C3 and C4 compared with the control, suggesting
Fig. 1. Effect of laminarin on IL-1b, IL-8 and TLR2 mRNA expression in groupers. Experiments were performed in duplicate and repeated in at least three independent experiments using tissues from 6 individual groupers. Results are expressed as mean ± SEM (n ¼ 6). Means in the same row with different letters were significantly different between treatment groups (P < 0.05).
that laminarin may have an anti-complementary activity in E. coioides. Superoxide dismutase (SOD) and catalase (CAT) are the main enzymes that detoxify reactive oxygen species (ROS). SOD catalyzes the dismutation of the highly reactive O 2 to the less reactive H2O2, and belongs to the main antioxidant defense pathways in response to oxidative stress [27]. Catalase (CAT) is a kind of ROS scavenger enzyme, which can decompose H2O2 into of O2 and H2O, removing H2O2 from the body. So, CAT is one of the key enzymes in biological defense system. The effect of dietary administration of Bacillus spp. on SOD activity of shrimp has been studied extensively [28,29]. Kang et al. (2012) have reported that fermented sea tangle could increase the levels of SOD and CAT. In the present study, laminarincontaining diets improved the serum SOD and CAT activities after 48 days of feeding, indicating that laminarin could enhance the non-specific immunity in E. coioides. The levels of UREA and CREA in the plasma can, to some extent, reflect the function of the kidney. In the present study, laminarincontaining diets decreased the levels of UREA and CREA in the serum after 48 days of feeding, indicating that laminarin had no adverse effect on kidney in E. coioides. ALT and AST are mainly distributed in the hepatocytes, and ALT and AST are the most commonly used indicators of liver function. In our study, laminarincontaining diets had no effects on the activity of ALT and AST, suggesting that the supplementary feed had no adverse effect on liver function in E. coioides. Cytokines that regulate innate immunity are produced in response to microbial antigens. IL-1b and IL-8 are important proinflammatory cytokines, which can recruit and activate macrophages and neutrophils to remove the cell debris and invaded microorganisms, and facilitate the regrowth of injured tissues. TLRs play an essential role in the activation of innate immunity by recognizing their cognate ligands [30,31]. Strong evidence has demonstrated that polysaccharides derived from yeast and medicinal mushrooms possess immunomodulatory activity [32]. Feeding b-glucans can stimulate both specific and non-specific immune responses in mice [33]. Additionally, polysaccharides from aloe can also inhibit the inflammatory response [34]. In the present study, we found that laminarin could increase the expression of the cytokines and TLR2, indicting that laminarin can also have an immunomodulatory activity in E. coioides. The findings provide useful information on alternative feed additive to antibiotics and other undesirable additives to improve fish production without harmful effects on the environment or inducing antibiotic resistance. Laminarin has the potential for use as a feed additive for fish. In the present study, we noticed that the effect of the high dose (1.0% or 1.5%) of laminarin on growth performance and feed efficiency was weaker than that of the low dose (0.5%). It appeared that the effect of laminarin was independent of the dose of laminarin. Further research is needed to address this
406
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
question. To our knowledge, this is the first report showing that laminarin can be used as an additive in fish aquaculture, enhancing growth performance. The precise mechanism for enhanced growth performance by laminarin remains unclear. Further research is needed to address whether both the increased digestibility of nutrients and infection control are responsible for the enhanced growth performance. 5. Conclusion In conclusion, dietary administration of laminarin could improve the feed efficiency and growth rate of E. coioides; it also could enhance the non-specific immunity of E. coioides. Therefore, our data, for the first time, demonstrated that laminarin could be used as an additive to promote growth and enhance immunity in groupers. Acknowledgment This study was financially supported by the Special Marine High-Tech Industry Development of Fujian Provincial Oceanic and Fishery Hall (Min Hai Yu 2012-28). We thank Dr. Shile Huang (Louisiana State University Health Sciences Center, USA) for reading the manuscript. The animal protocol was approved by the Animal Care Committee of Fujian Agriculture and Forestry University. References [1] Harikrishnan R, Balasundaram C, Heo MS. Molecular studies, disease status and prophylactic measures in grouper aquaculture: economic importance, diseases and immunology. Aquaculture 2010;309:1e14. [2] Sun YZ, Yang HL, Ma RL, Lin WY. Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth performance and immune responses of grouper Epinephelus coioides. Fish Shellfish Immunol 2010;29:803e9. [3] Harikrishnan R, Balasundaram C, Heo MS. Impact of plant products on innate and adaptive immune system of cultured finfish and shellfish. Aquaculture 2011;317:1e15. [4] Chakraborty SB, Hancz C. Application of phytochemicals as immunostimulant, antipathogenic and antistress agents in finfish culture. Rev Aquacult 2011;3: 103e19. [5] Ji SC, Jeong GS, Im GS, Lee SW, Yoo JH, Takii K. Dietary medicinal herbs improve growth performance, fatty acid utilization, and stress recovery of Japanese flounder. Fish Sci 2007;73:70e6. [6] Ji SC, Takaoka O, Jeong GS, Lee SW, Ishimaru K, Seoka M, et al. Dietary medicinal herbs improve growth and some non-specific immunity of red sea bream Pagrus major. Fish Sci 2007;73:63e9. [7] Sivaram V, Babu MM, Immanuel G, Murugadass S, Citarasu T, Marian M. Growth and immune response of juvenile greasy groupers (Epinephelus tauvina) fed with herbal antibacterial active principle supplemented diets against Vibrio harveyi infections. Aquaculture 2004;237:9e20. [8] Gahan DA, Lynch MB, Callan JJ, O'Sullivan JT, O'Doherty JV. Performance of weanling piglets offered low-, medium- or high-lactose diets supplemented with a seaweed extract from Laminaria spp. Animal 2009;3:24e31. [9] Reilly P, O'Doherty JV, Pierce KM, Callan JJ, O'Sullivan JT, Sweeney T. The effects of seaweed extract inclusion on gut morphology, selected intestinal microbiota, nutrient digestibility, volatile fatty acid concentrations and the immune status of the weaned pig. Animal 2008;2:1465e73. [10] O'Doherty JV, Dillon S, Figat S, Callan JJ, Sweeney T. The effects of lactose inclusion and seaweed extract derived from Laminaria spp. on performance, digestibility of diet components and microbial populations in newly weaned pigs. Anim Feed Sci Tech 2010;157:173e80. [11] Zvyagintseva TN, Shevchenko NM, Nazarenko EL, Gorbach VI, Urvantseva AM, Kiseleva MI, et al. Water-soluble polysaccharides of some brown algae of the Russian Far-East. Structure and biological action of low-molecular mass polyuronans. J Exp Mar Biol Ecol 2005;320:123e31. [12] Lynch MB, Sweeney T, Callan JJ, O'Sullivan JT, O'Doherty JV. The effect of dietary Laminaria derived laminarin and fucoidan on intestinal microflora and volatile fatty acid concentration in pigs. Livest Sci 2010;133:157e60.
[13] Deville C, Gharbi M, Dandrifosse G, Peulen O. Study on the effects of laminarin, a polysaccharide from seaweed, on gut characteristics. J Sci Food Agric 2007;87:1717e25. [14] Hoffman R, Paper DH, Donaldson J, Alban S, Franz G. Characterisation of a laminarin sulphate which inhibits basic fibroblast growth factor binding and endothelial cell proliferation. J Cell Sci 1995;108(Pt 11): 3591e8. [15] Miao HQ, Elkin M, Aingorn E, Ishai-Michaeli R, Stein CA, Vlodavsky I. Inhibition of heparanase activity and tumor metastasis by laminarin sulfate and synthetic phosphorothioate oligodeoxynucleotides. Int J Cancer 1999;83: 424e31. [16] Deng JM, Kang B, Tao LL, Rong H, Zhang X. Effects of dietary cholesterol on antioxidant capacity, non-specific immune response, and resistance to Aeromonas hydrophila in rainbow trout (Oncorhynchus mykiss) fed soybean meal-based diets. Fish Shellfish Immunol 2013;34:324e31. [17] He SX, Zhou ZG, Liu YC, Shi PJ, Yao B, Ringo E, et al. Effects of dietary Saccharomyces cerevisiae fermentation product (DVAQUA (R)) on growth performance, intestinal autochthonous bacterial community and non-specific immunity of hybrid tilapia (Oreochromis niloticus female xO. aureus male) cultured in cages. Aquaculture 2009;294:99e107. [18] Coz-Rakovac R, Smuc T, Popovic NT, Strunjak-Perovic I, Hacmanjek M, Jadan M. Novel methods for assessing fish blood biochemical data. J Appl Ichthyol 2008;24:77e80. [19] Coz-Rakovac R, Strunjak-Perovic I, Hacmanjek M, Popovic NT, Lipej Z, Sostaric B. Blood chemistry and histological properties of wild and cultured sea bass (Dicentrarchus labrax) in the North Adriatic Sea. Vet Res Commun 2005;29:677e87. [20] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. San Diego, Calif. [21] Dillon S, Sweeney T, Figat S, Callan JJ, O'Doherty JV. The effects of lactose inclusion and seaweed extract on performance, nutrient digestibility and microbial populations in newly weaned piglets. Livest Sci 2010;134: 205e7. [22] Merrifield DL, Bradley G, Baker RTM, Davies SJ. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) II. Effects on growth performance, feed utilization, intestinal microbiota and related health criteria postantibiotic treatment. Aquac Nutr 2010;16:496e503. [23] Merrifield DL, Dimitroglou A, Bradley G, Baker RTM, Davies SJ. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) I. Effects on growth performance, feed utilization, intestinal microbiota and related health criteria. Aquac Nutr 2010;16:504e10. [24] Boshra H, Li J, Sunyer JO. Recent advances on the complement system of teleost fish. Fish Shellfish Immunol 2006;20:239e62. [25] Matsumoto T, Hosono-Nishiyama K, Yamada H. A pectic polysaccharide isolated from the roots of Bupleurum falcatum L. stimulates the tyrosine phosphorylation of lipid rafts of murine B cells. Biol Pharm Bull 2008;31: 931e4. [26] Olafsdottir ES, Omarsdottir S, Paulsen BS, Wagner H. Immunologically active O6-branched (1 -> 3)-beta-glucan from the lichen Thamnolia vermicularis var. subuliformis. Phytomedicine 2003;10:318e24. [27] Fridovich I. Superoxide radical and superoxide dismutases. Annu Rev Biochem 1995;64:97e112. [28] Li K, Zheng T, Tian Y, Xi F, Yuan J, Zhang G, et al. Beneficial effects of Bacillus licheniformis on the intestinal microflora and immunity of the white shrimp, Litopenaeus vannamei. Biotechnol Lett 2007;29:525e30. [29] Tseng DY, Ho PL, Huang SY, Cheng SC, Shiu YL, Chiu CS, et al. Enhancement of immunity and disease resistance in the white shrimp, Litopenaeus vannamei, by the probiotic, Bacillus subtilis E20. Fish Shellfish Immunol 2009;26: 339e44. [30] Valenzuela-Munoz V, Gallardo-Escarate C. TLR and IMD signaling pathways from Caligus rogercresseyi (Crustacea: Copepoda): in silico gene expression and SNPs discovery. Fish Shellfish Immunol 2014;36:428e34. [31] Tang D, Gao YH, Wang RX, Sun YN, Xu TJ. Characterization, genomic organization, and expression profiles of MyD88, a key adaptor molecule in the TLR signaling pathways in miiuy croaker (Miichthys miiuy). Fish Physiol Biochem 2012;38:1667e77. [32] Cheng JY, Ng LT, Lin CL, Jan TR. Pacific oyster-derived polysaccharides enhance antigen-specific T helper (Th)1 immunity in vitro and in vivo. Immunopharmacol Immunotoxicol 2013;35:235e40. [33] Yun CH, Estrada A, Van Kessel A, Park BC, Laarveld B. Beta-glucan, extracted from oat, enhances disease resistance against bacterial and parasitic infections. FEMS Immunol Med Microbiol 2003;35:67e75. [34] Strickland FM, Darvill A, Albersheim P, Eberhard S, Pauly M, Pelley RP. Inhibition of UV-induced immune suppression and interleukin-10 production by plant oligosaccharides and polysaccharides. Photochem Photobiol 1999;69: 141e7.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Dietary administration of laminarin improves the growth performance and immune responses in Epinephelus coioides Guangwen Yin a, 1, Wenwu Li a, 1, Qian Lin a, Xi Lin a, Jianbin Lin b, Qingguo Zhu b, Heji Jiang a, Zhijian Huang a, * a Engineering Laboratory of Animal Pharmaceuticals, College of Animal Science, Fujian Agriculture and Forestry University, Fuzhou, Fujian Province 350002, PR China b Fujian Provincial Institute of Freshwater Fisheries, Fuzhou, Fujian Province 350002, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 June 2014 Received in revised form 9 September 2014 Accepted 20 September 2014 Available online 28 September 2014
This study was conducted to evaluate the effects of laminarin on the growth performance, immunological and biochemical parameters, as well as immune related genes expression in the grouper, Epinephelus coioides. One hundred and eight fish were randomly divided into four groups (45 groupers/ group). Blank control group was fed with the basal diet, while low, medium and high doses of laminarin groups were fed with the basal diet supplemented with 0.5%, 1.0%, and 1.5% laminarin, respectively, for 48 days. The immunological and biochemical parameters in blood were investigated. The mRNA levels of IL-1b, IL-8, and TLR2 in midgut were also evaluated by quantitative real-time PCR. Dietary laminarin supplementation significantly improved the specific growth rate and the feed efficiency ratio of the fish. The level of TP and the activity of LZM, CAT and SOD were higher than that of the control. The levels of UREA and CREA as well as the activity of ALP were lower than of the control. There was no significant difference in the levels of ALT and AST between control groups and treated groups. In addition, dietary laminarin supplementation decreased the levels of C3 and C4. The expression of immune response genes IL-1b, IL-8, and TLR2 showed significant increases (P < 0.05) in groupers fed low dose (0.5%) and medium dose (1.0%) of laminarin compared with the blank control. These results suggest that laminarin modulates the immune response and stimulates growth of the fish. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Laminarin Growth performance Immunological and biochemical parameters Groupers
1. Introduction Groupers, Epinephelus spp. (Epinephelus coioides), are important mariculture fish in China and Southeast Asian countries for their fast growth, popular taste, and high nutritional and economic value [1e3]. Recently, the consumers' demand for farmed fish has increasingly emphasized on quality and safety, and the absence of concomitant pollutants and antibiotics [4]. Therefore, rearing strategies need to focus on feed hygiene, in addition to growth performance [5,6]. This has hastened the search for the identification and development of safe dietary supplements and additives that can enhance the physiological activity, health, and immune function of the farmed fish [3,7]. Recently, seaweeds extracts (SWE) have been studied as an alternative to in-feed antibiotics in pig diets [8e10]. Seaweeds are
* Corresponding author. Tel./fax: þ86 591 83845697. E-mail addresses: [email protected], [email protected] (Z. Huang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2014.09.027 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
known for their richness in polysaccharides, minerals and certain vitamins. The most abundant polysaccharides in brown seaweeds are laminarin, fucoidan and alginic acid [11]. Laminarin is found mainly in the fronds of Laminaria. The content of laminarin varies with season and habitat, and can reach up to 32% of dry weight. Recently, Lynch et al. (2010) have shown that laminarin has antimicrobial properties [12]. Laminarin can also influence the adherence and the translocation of bacteria across the epithelial wall, and seems to be a modulator of the intestinal metabolism by its effects on mucus composition, intestinal pH and short-chain fatty acid production, especially butyrate [13]. Laminarin can boost the immune system, reduce cholesterol levels in serum, and lower systolic blood pressure [14]. Laminarin can also inhibit heparanase activity and tumor metastasis [15]. These findings suggest that seaweed extracts have great potential as a supplement in functional food. To our knowledge, no study using laminarin as a supplement in diet in groupers has been reported. Here, we studied the effect of laminarin on growth performance, immunological and biochemical parameters, and immune related genes expression in the grouper, E. coioides.
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
2. Materials and methods 2.1. Experimental diets Laminarin was provided by Addison Biological Technology (Beijing, China). Four diets containing different doses of laminarin were prepared. The proximate analysis of the basal diet was 49.26% crude protein, 7.63% crude lipid, 15.93% ash, and 6.58% moisture. Diets were formulated to contain different levels of laminarin (the basal diet supplemented with 0.5%, 1.0%, and 1.5% laminarin). All diets were individually blended in a mixer and then homogenized after mixed oil was added. Distilled water was included to achieve a proper pelleting consistency, and the mixture was further homogenized. The mixed ingredients were made into pellets using an extruder with a 4 mm diameter and a rotation cutter. The moist pellets were dried in a forced air oven at room temperature for about 12 h, and then stored at 20 C until used for the feeding trial. 2.2. Experimental procedure Grouper (E. coioides) obtained from a local commercial farm were acclimatized to the experimental conditions for 2 weeks before the start of the experiment. Fish of similar sizes (mean weight 90 ± 2.6 g and mean length 15 ± 2.25 cm) were distributed into 12 tanks (each group consisted of three tanks) with 15 groupers per tank. Each tank was then randomly assigned to one of three replicates of the four dietary treatments (blank control, laminarin high, laminarin medium and laminarin low). The fed rate was 3% biomass per day provided in equal rations at 09:00 and 17:00 h for 48 days. The amount of diet consumed was determined by daily recovery of excess feed, which was then dried and weighed. Daily feed was adjusted every 2 weeks by batch weighing after a 24 h of starvation. All rearing tanks were provided with continuous aeration. Water was recirculated through a biological and mechanical filtration system containing vertical quartz sand filter and activated carbon purifier to remove solid and nitrogenous wastes. Water temperature and pH were constant (24e30 C; pH 8.0) during the experimental period, dissolved oxygen was maintained at 6e7 mg/L, and the NH3-N was <0.3 mg/L. 2.3. Growth performance At the beginning and at the end of the feeding trial, the fish were starved for 24 h and anesthetized. Body weight and length were measured for the fish in each tank. Weight gain (WG), feed efficiency (FE) were calculated as follows:
WG ¼ final body weight initial body weight FEð%Þ ¼ WG=feed intake 100 At the end of the feeding trial, 5 fish were removed randomly from each diet group replicate tank for analysis of the hepatosomatic index (HSI), viscerasomatic index (VSI) and condition factor (CF). Liver and viscera were weighed to calculate the HSI and VSI as follows:
HSIð%Þ ¼ ðhepatic weight=body weightÞ 100 VSIð%Þ ¼ ðviscera weight=body weightÞ 100 CF ¼ fish weight 100=fish length
403
Survivalð100%Þ ¼ ðnumber of final fish=number of initial fishÞ 100 2.4. Sample collection Five fish per tank were sampled for analyses of biochemical parameters. Blood was collected from the caudal vein with a heparinized syringe and transferred into a heparinized tube. Plasma was recovered after centrifugation (6000 g, 10 min) and immediately stored at 80 C until analysis. For the tissue sampling, 5 fish per tank were dissected under sterile conditions, and the midgut was pulled out and washed with phosphate buffered saline (PBS) (pH 7.2) to remove the intestinal contents. The tissue fragments were immediately stored at 80 C in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) for RNA extraction. 2.5. Immunological and biochemical parameters 2.5.1. Lysozyme assay Serum lysozyme activity was determined with lysozyme kit (Jiancheng Bioengineering Institute, Nanjing, China) using the method that measures the decrease in turbidity after lysis of Micrococcus peptidoglycan of the cell wall [16]. Results are presented as U (units/ml). 2.5.2. Complement activity The serum complement C3 and C4 levels were assayed using a C3 kit and C4 kit, (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively. Analysis of the complement level included measurement of the increase in turbidity after immunity response of complement and its increased antibody [2,17]. Results of C3 are presented as C3 g/L, while results of C4 are presented as C4 mg/L. 2.5.3. Antioxidant-related parameters assay Superoxide dismutase (SOD), catalase (CAT), alkaline phosphatase (ALP) activities in serum were determined with a UV-2100 spectrophotometer (Unico, USA) at 550, 405 and 520 nm, respectively [16]. Antioxidant-related parameter detection kits (SOD, CAT, and ALP) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). 2.5.4. Biochemical assay The biochemical indices determined in blood plasma included total proteins (TP), creatinine (CREA), UREA, aspartate aminotransferase (AST), alanine aminotranspherase (ALT). Plasma samples were analyzed using a biochemical analyzer (VetTest 8008; Idexx Laboratories, Inc, Westbrook, ME, USA) by the colorimetric method previously used for fish blood biochemistry [18,19]. 2.6. Cytokine expression analyses by qPCR Total RNA was extracted from the samples using Trizol reagent (Invitrogen, Carlsbad, CA). The final RNA was eluted in an appropriate amount of 0.1% diethyl pyrocarbonate (DEPC) treated water (SigmaeAldrich, St. Louis, MO, USA). For each sample, the integrity of RNA extracted was confirmed by agarose gel electrophoresis by staining with ethidium bromide and visualizing under UV light. The amount of RNA extracted was determined, and its purity (OD260/ OD280 ratio between 1.8 and 2.2) was verified using an ND-1000 spectrophotometer (NanoDropTechnologies, Wilmington, DE, USA). The cDNA was synthesized using random primers and a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The primer pairs used for analysis of specific
404
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
Table 1 Primers used for real-time PCR.
Table 3 Effect of laminarin on non-specific immune response in groupers.
Gene name
GenBank number
Products size (bp)
Primer sequences
Parameters
Control group
Laminarin (0.5%)
Laminarin (1.0%)
Laminarin (1.5%)
b-actin
AY510710
123
59.49 ± 19.28a
51.85 ± 23.62b
52.04 ± 13.35b
EF582837
135
IL-8
FJ913064
137
Lysozyme (LZM) (U/ml) C3 (g/L) C4 (mg/L)
46.32 ± 9.82b
IL-1b
0.162 ± 0.011b 9.376 ± 0.476b
0.149 ± 0.026a 5.153 ± 0.992a
0.157 ± 0.022b 6.454 ± 0.810a
0.161 ± 0.031b 8.349 ± 1.451b
TLR2
HM357230
125
CATCACACCTTCTACAACGA AAGGTCTCGAACATGATCTG AAGGGCATTATCTCAGAATCAG TCATATCCTCATCAGTCGGT CATTGTCATCTCCATTGCGG GGTATCAGCTCCACCTTCTC GGACTCTGCTGACTACTGTG CTGAACCCTCCTCATCTCTG
genes (Table 1) were designed with the PerlPrimer software (perlprimer.sourceforge.net). Quantitative real-time PCR was performed on the 7500 Real Time PCR System (Applied Biosystems, USA) with a program of 50 C for 2 min, 95 C for 10 min and 40 cycles of 95 C for 15 s, and 60 C for 1 min. For each sample, template copy numbers were internally normalized with their respective input control. All real time-PCRs were performed at least in triplicate. Data analysis was conducted using the 2DDCT method [20], and b-actin was included as an internal reference for normalization of gene expression data. 2.7. Statistical analysis Values were expressed as mean ± SD. Data were subjected to one-way analysis of variance (ANOVA) to determine whether significant differences occurred in fish fed the different diets. If a significant difference was identified, differences among means were compared by Tukey's multiple range tests (P < 0.05). Statistical analysis was performed using the Statistica software package (Version 6.0, Statsoft, Tulsa, OK, USA). 3. Results 3.1. Survival and growth There was no mortality in the trial (Table 2). The feed intake was significantly higher in the 0.5% laminarin group as compared with the other groups (P < 0.05). The weight gain (WG), weight gain rate (WGR), feed efficiency (FE) in fish in the 0.5% laminarin group and the 1.0% laminarin group was significantly higher than that in the 1.5% laminarin group and the control group. HSI values in the 0.5% laminarin group and the 1.5% laminarin group were significantly higher than those in the other groups (P < 0.05). VSI, and CF values in the 0.5% laminarin group were significantly higher than those in the other groups (P < 0.05). 3.2. Immunological and biochemical parameters 3.2.1. Serum lysozyme activities Dietary supplementation of laminarin regardless of inclusion level could increase the activities of lysozyme in the serum.
Note: Values are expressed as mean ± SD (n ¼ 15). Means in the same row with different letters were significantly different between treatment groups (P < 0.05).
Groupers fed low dose (0.5%) of laminarin showed significant increases of the activities compared with other groups (P < 0.05). However, no significant difference was observed in serum lysozyme activity between the high dose group, medium dose group and the blank control group (Table 3). 3.2.2. Serum complement activity After 48 days of feeding, serum complement C3 and C4 levels of the laminarin treatments were lower than that of control (Table 3). C3 decreased only at 0.5%, and C4 at 0.5% and 1.0% (Table 3). 3.2.3. Antioxidant-related parameters There were no significant differences in the SOD activities between the groups fed with laminarin and the control group (P > 0.05). Plasma CAT activities in the 0.5% laminarin group were significantly higher than those in the other groups (P < 0.05). No significant differences were observed in the activities of ALP among the dietary treatments (P > 0.05) (Table 4). 3.2.4. Plasma biochemical parameters No significant differences were observed in the level of total protein among the dietary treatments (P > 0.05) (Table 4). UREA was significantly lower only at 0.5% laminarin group, and CREA was significantly lower only at 1.5% laminarin group. No significant differences were observed in the activities of AST and ALT among the dietary treatments (P > 0.05) (Table 4). 3.3. Intestinal cytokine and TLR2 gene expression in groupers The expression of immune response genes IL-1b, IL-8, and TLR2 showed significant increases (P < 0.05) in groupers fed low dose (0.5%) and medium dose (1.0%) of laminarin compared with the blank control. Although the high dose (1.5%) of laminarin can also enhance the expression of the immune response genes, but no significant difference was observed between the high dose group and the blank control group (Fig. 1). It appeared that the effect of laminarin on immune response genes expression was independent of the dose of laminarin.
Table 2 Growth performance of E. coioides fed laminarin-supplemented diets for 48 days. Parameters
Control group
Body weight gain (g) Final fish length (cm) Condition factor (CF) Feed efficiency (FE) Viscerasomatic index (VSI) Hepatosomatic index (HSI)
63.59 17.32 8.75 1.31 8.74 3.47
± ± ± ± ± ±
20.55b 2.56 1.80b 0.01b 0.73b 0.66b
Laminarin low (0.5%) 86.51 17.38 10.24 1.16 10.19 3.85
± ± ± ± ± ±
32.67a 1.74 1.82a 0.01a 1.37a 0.74a
Laminarin medium (1.0%) 80.56 18.06 9.47 1.21 8.71 3.44
± ± ± ± ± ±
23.90a 2.05 1.44b 0.01a 0.45b 0.53b
Laminarin high (1.5%) 70.53 17.61.93 9.03 1.25 8.98 4.05
± ± ± ± ± ±
19.10b 1.82 1.65b 0.01b 1.26b 0.73a
Note: Values are expressed as mean ± SD (n ¼ 15). Means in the same row with different letters were significantly different between treatment groups (P < 0.05).
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
405
Table 4 Effect of laminarin on plasma biochemical parameters in groupers. Parameters
Control group
CAT (U/ml) SOD (mg/ml) ALP (U/L) TP (g/L) UREA (mmol/L) CREA (mmol/L) AST (U/L) ALT (U/L)
1.12 45.68 193.12 41.13 2.95 441.63 247.88 13,752.62
± ± ± ± ± ± ± ±
0.68b 6.56b 74.58 6.07 0.99a 187.66a 79.71 8097
Laminarin (0.5%) 2.45 72.97 171.13 44.38 2.39 426.25 250.75 14,125.25
± ± ± ± ± ± ± ±
1.27a 19.49a 39.20 8.1 0.07b 141.52a 65.78 9383.02
Laminarin (1.0%) 1.57 53.25 169.37 46.37 2.51 404.00 223.87 13,169.25
± ± ± ± ± ± ± ±
1.40b 24.36b 141.86 11.72 0.30a 173.51a 86.01 7819.3
Laminarin (1.5%) 1.25 48.84 168.37 42.75 2.56 335.25 265.25 11,632.50
± ± ± ± ± ± ± ±
0.62b 14.66b 44.83 9.36 0.35a 146.35b 84.10 4731.72
Note: Values are expressed as mean ± SD (n ¼ 15). Means in the same row with different letters were significantly different between treatment groups (P < 0.05). Catalase (CAT), superoxide dismutase (SOD), alkaline phosphatase (ALP), total proteins (TP), creatinine (CREA), UREA, aspartate aminotransferase (AST), alanine aminotranspherase (ALT).
4. Discussion The main beneficial effects of laminarin use in pigs are the improvement of growth performance and the reduction of the enterobacteriaceae populations [10,21]. In the present study, the potential beneficial effects of laminarin on the fish E. coioides were evaluated in a 48-day feeding trial. We observed a significant increase of WG, SGR and a significant decrease of FCR in fish fed diets supplemented with laminarin for 48 days. This revealed that the fish utilize dietary nutrients more efficiently when feed is supplemented with laminarin. Lysozyme is a cationic enzyme that attacks the peptidoglycan of bacterial cell walls. This enables lysozyme to lyse certain Grampositive bacteria, and in conjunction with complement, even some Gram-negative bacteria. Dietary administration of Bacillus strains could significantly enhance serum lysozyme activity of E. coioides and rainbow trout [2,22,23]. In line with those previous studies, the serum lysozyme activities increased significantly after 48 days of feeding laminarin-containing diets in our study. Complement is the major humoral component of the innate immune responses, which plays an essential role in alerting the host immune system of the presence of potential pathogens as well as their clearance. C3 and C4 are the key components of both classical and lectin pathways [24]. Complement activation is usually beneficial to the host, but persistent activation of complement could lead to adverse effects and immunosuppression to the host. Matsumoto et al. [25] have isolated an anti-complementary polysaccharide from the roots of Bupleurum falcataum. Olafsdottir et al. [26] have reported that O6-branched (1-3)-b-glucan from the lichen possesses an anti-complementary activity. In our study, after 48 days of feeding, laminarin-supplemented groups showed lower levels of C3 and C4 compared with the control, suggesting
Fig. 1. Effect of laminarin on IL-1b, IL-8 and TLR2 mRNA expression in groupers. Experiments were performed in duplicate and repeated in at least three independent experiments using tissues from 6 individual groupers. Results are expressed as mean ± SEM (n ¼ 6). Means in the same row with different letters were significantly different between treatment groups (P < 0.05).
that laminarin may have an anti-complementary activity in E. coioides. Superoxide dismutase (SOD) and catalase (CAT) are the main enzymes that detoxify reactive oxygen species (ROS). SOD catalyzes the dismutation of the highly reactive O 2 to the less reactive H2O2, and belongs to the main antioxidant defense pathways in response to oxidative stress [27]. Catalase (CAT) is a kind of ROS scavenger enzyme, which can decompose H2O2 into of O2 and H2O, removing H2O2 from the body. So, CAT is one of the key enzymes in biological defense system. The effect of dietary administration of Bacillus spp. on SOD activity of shrimp has been studied extensively [28,29]. Kang et al. (2012) have reported that fermented sea tangle could increase the levels of SOD and CAT. In the present study, laminarincontaining diets improved the serum SOD and CAT activities after 48 days of feeding, indicating that laminarin could enhance the non-specific immunity in E. coioides. The levels of UREA and CREA in the plasma can, to some extent, reflect the function of the kidney. In the present study, laminarincontaining diets decreased the levels of UREA and CREA in the serum after 48 days of feeding, indicating that laminarin had no adverse effect on kidney in E. coioides. ALT and AST are mainly distributed in the hepatocytes, and ALT and AST are the most commonly used indicators of liver function. In our study, laminarincontaining diets had no effects on the activity of ALT and AST, suggesting that the supplementary feed had no adverse effect on liver function in E. coioides. Cytokines that regulate innate immunity are produced in response to microbial antigens. IL-1b and IL-8 are important proinflammatory cytokines, which can recruit and activate macrophages and neutrophils to remove the cell debris and invaded microorganisms, and facilitate the regrowth of injured tissues. TLRs play an essential role in the activation of innate immunity by recognizing their cognate ligands [30,31]. Strong evidence has demonstrated that polysaccharides derived from yeast and medicinal mushrooms possess immunomodulatory activity [32]. Feeding b-glucans can stimulate both specific and non-specific immune responses in mice [33]. Additionally, polysaccharides from aloe can also inhibit the inflammatory response [34]. In the present study, we found that laminarin could increase the expression of the cytokines and TLR2, indicting that laminarin can also have an immunomodulatory activity in E. coioides. The findings provide useful information on alternative feed additive to antibiotics and other undesirable additives to improve fish production without harmful effects on the environment or inducing antibiotic resistance. Laminarin has the potential for use as a feed additive for fish. In the present study, we noticed that the effect of the high dose (1.0% or 1.5%) of laminarin on growth performance and feed efficiency was weaker than that of the low dose (0.5%). It appeared that the effect of laminarin was independent of the dose of laminarin. Further research is needed to address this
406
G. Yin et al. / Fish & Shellfish Immunology 41 (2014) 402e406
question. To our knowledge, this is the first report showing that laminarin can be used as an additive in fish aquaculture, enhancing growth performance. The precise mechanism for enhanced growth performance by laminarin remains unclear. Further research is needed to address whether both the increased digestibility of nutrients and infection control are responsible for the enhanced growth performance. 5. Conclusion In conclusion, dietary administration of laminarin could improve the feed efficiency and growth rate of E. coioides; it also could enhance the non-specific immunity of E. coioides. Therefore, our data, for the first time, demonstrated that laminarin could be used as an additive to promote growth and enhance immunity in groupers. Acknowledgment This study was financially supported by the Special Marine High-Tech Industry Development of Fujian Provincial Oceanic and Fishery Hall (Min Hai Yu 2012-28). We thank Dr. Shile Huang (Louisiana State University Health Sciences Center, USA) for reading the manuscript. The animal protocol was approved by the Animal Care Committee of Fujian Agriculture and Forestry University. References [1] Harikrishnan R, Balasundaram C, Heo MS. Molecular studies, disease status and prophylactic measures in grouper aquaculture: economic importance, diseases and immunology. Aquaculture 2010;309:1e14. [2] Sun YZ, Yang HL, Ma RL, Lin WY. Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth performance and immune responses of grouper Epinephelus coioides. Fish Shellfish Immunol 2010;29:803e9. [3] Harikrishnan R, Balasundaram C, Heo MS. Impact of plant products on innate and adaptive immune system of cultured finfish and shellfish. Aquaculture 2011;317:1e15. [4] Chakraborty SB, Hancz C. Application of phytochemicals as immunostimulant, antipathogenic and antistress agents in finfish culture. Rev Aquacult 2011;3: 103e19. [5] Ji SC, Jeong GS, Im GS, Lee SW, Yoo JH, Takii K. Dietary medicinal herbs improve growth performance, fatty acid utilization, and stress recovery of Japanese flounder. Fish Sci 2007;73:70e6. [6] Ji SC, Takaoka O, Jeong GS, Lee SW, Ishimaru K, Seoka M, et al. Dietary medicinal herbs improve growth and some non-specific immunity of red sea bream Pagrus major. Fish Sci 2007;73:63e9. [7] Sivaram V, Babu MM, Immanuel G, Murugadass S, Citarasu T, Marian M. Growth and immune response of juvenile greasy groupers (Epinephelus tauvina) fed with herbal antibacterial active principle supplemented diets against Vibrio harveyi infections. Aquaculture 2004;237:9e20. [8] Gahan DA, Lynch MB, Callan JJ, O'Sullivan JT, O'Doherty JV. Performance of weanling piglets offered low-, medium- or high-lactose diets supplemented with a seaweed extract from Laminaria spp. Animal 2009;3:24e31. [9] Reilly P, O'Doherty JV, Pierce KM, Callan JJ, O'Sullivan JT, Sweeney T. The effects of seaweed extract inclusion on gut morphology, selected intestinal microbiota, nutrient digestibility, volatile fatty acid concentrations and the immune status of the weaned pig. Animal 2008;2:1465e73. [10] O'Doherty JV, Dillon S, Figat S, Callan JJ, Sweeney T. The effects of lactose inclusion and seaweed extract derived from Laminaria spp. on performance, digestibility of diet components and microbial populations in newly weaned pigs. Anim Feed Sci Tech 2010;157:173e80. [11] Zvyagintseva TN, Shevchenko NM, Nazarenko EL, Gorbach VI, Urvantseva AM, Kiseleva MI, et al. Water-soluble polysaccharides of some brown algae of the Russian Far-East. Structure and biological action of low-molecular mass polyuronans. J Exp Mar Biol Ecol 2005;320:123e31. [12] Lynch MB, Sweeney T, Callan JJ, O'Sullivan JT, O'Doherty JV. The effect of dietary Laminaria derived laminarin and fucoidan on intestinal microflora and volatile fatty acid concentration in pigs. Livest Sci 2010;133:157e60.
[13] Deville C, Gharbi M, Dandrifosse G, Peulen O. Study on the effects of laminarin, a polysaccharide from seaweed, on gut characteristics. J Sci Food Agric 2007;87:1717e25. [14] Hoffman R, Paper DH, Donaldson J, Alban S, Franz G. Characterisation of a laminarin sulphate which inhibits basic fibroblast growth factor binding and endothelial cell proliferation. J Cell Sci 1995;108(Pt 11): 3591e8. [15] Miao HQ, Elkin M, Aingorn E, Ishai-Michaeli R, Stein CA, Vlodavsky I. Inhibition of heparanase activity and tumor metastasis by laminarin sulfate and synthetic phosphorothioate oligodeoxynucleotides. Int J Cancer 1999;83: 424e31. [16] Deng JM, Kang B, Tao LL, Rong H, Zhang X. Effects of dietary cholesterol on antioxidant capacity, non-specific immune response, and resistance to Aeromonas hydrophila in rainbow trout (Oncorhynchus mykiss) fed soybean meal-based diets. Fish Shellfish Immunol 2013;34:324e31. [17] He SX, Zhou ZG, Liu YC, Shi PJ, Yao B, Ringo E, et al. Effects of dietary Saccharomyces cerevisiae fermentation product (DVAQUA (R)) on growth performance, intestinal autochthonous bacterial community and non-specific immunity of hybrid tilapia (Oreochromis niloticus female xO. aureus male) cultured in cages. Aquaculture 2009;294:99e107. [18] Coz-Rakovac R, Smuc T, Popovic NT, Strunjak-Perovic I, Hacmanjek M, Jadan M. Novel methods for assessing fish blood biochemical data. J Appl Ichthyol 2008;24:77e80. [19] Coz-Rakovac R, Strunjak-Perovic I, Hacmanjek M, Popovic NT, Lipej Z, Sostaric B. Blood chemistry and histological properties of wild and cultured sea bass (Dicentrarchus labrax) in the North Adriatic Sea. Vet Res Commun 2005;29:677e87. [20] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. San Diego, Calif. [21] Dillon S, Sweeney T, Figat S, Callan JJ, O'Doherty JV. The effects of lactose inclusion and seaweed extract on performance, nutrient digestibility and microbial populations in newly weaned piglets. Livest Sci 2010;134: 205e7. [22] Merrifield DL, Bradley G, Baker RTM, Davies SJ. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) II. Effects on growth performance, feed utilization, intestinal microbiota and related health criteria postantibiotic treatment. Aquac Nutr 2010;16:496e503. [23] Merrifield DL, Dimitroglou A, Bradley G, Baker RTM, Davies SJ. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) I. Effects on growth performance, feed utilization, intestinal microbiota and related health criteria. Aquac Nutr 2010;16:504e10. [24] Boshra H, Li J, Sunyer JO. Recent advances on the complement system of teleost fish. Fish Shellfish Immunol 2006;20:239e62. [25] Matsumoto T, Hosono-Nishiyama K, Yamada H. A pectic polysaccharide isolated from the roots of Bupleurum falcatum L. stimulates the tyrosine phosphorylation of lipid rafts of murine B cells. Biol Pharm Bull 2008;31: 931e4. [26] Olafsdottir ES, Omarsdottir S, Paulsen BS, Wagner H. Immunologically active O6-branched (1 -> 3)-beta-glucan from the lichen Thamnolia vermicularis var. subuliformis. Phytomedicine 2003;10:318e24. [27] Fridovich I. Superoxide radical and superoxide dismutases. Annu Rev Biochem 1995;64:97e112. [28] Li K, Zheng T, Tian Y, Xi F, Yuan J, Zhang G, et al. Beneficial effects of Bacillus licheniformis on the intestinal microflora and immunity of the white shrimp, Litopenaeus vannamei. Biotechnol Lett 2007;29:525e30. [29] Tseng DY, Ho PL, Huang SY, Cheng SC, Shiu YL, Chiu CS, et al. Enhancement of immunity and disease resistance in the white shrimp, Litopenaeus vannamei, by the probiotic, Bacillus subtilis E20. Fish Shellfish Immunol 2009;26: 339e44. [30] Valenzuela-Munoz V, Gallardo-Escarate C. TLR and IMD signaling pathways from Caligus rogercresseyi (Crustacea: Copepoda): in silico gene expression and SNPs discovery. Fish Shellfish Immunol 2014;36:428e34. [31] Tang D, Gao YH, Wang RX, Sun YN, Xu TJ. Characterization, genomic organization, and expression profiles of MyD88, a key adaptor molecule in the TLR signaling pathways in miiuy croaker (Miichthys miiuy). Fish Physiol Biochem 2012;38:1667e77. [32] Cheng JY, Ng LT, Lin CL, Jan TR. Pacific oyster-derived polysaccharides enhance antigen-specific T helper (Th)1 immunity in vitro and in vivo. Immunopharmacol Immunotoxicol 2013;35:235e40. [33] Yun CH, Estrada A, Van Kessel A, Park BC, Laarveld B. Beta-glucan, extracted from oat, enhances disease resistance against bacterial and parasitic infections. FEMS Immunol Med Microbiol 2003;35:67e75. [34] Strickland FM, Darvill A, Albersheim P, Eberhard S, Pauly M, Pelley RP. Inhibition of UV-induced immune suppression and interleukin-10 production by plant oligosaccharides and polysaccharides. Photochem Photobiol 1999;69: 141e7.