Dietary effects of Bacillus subtilis fmbj on growth performance, small intestinal morphology, and its antioxidant capacity of broilers

Dietary effects of Bacillus subtilis fmbj on growth performance, small intestinal morphology, and its antioxidant capacity of broilers Kaiwen Bai, Chengcheng Feng, Luyi Jiang, Ligen Zhang, Jingfei Zhang, Lili Zhang, and Tian Wang1 College of Animal Science and Technology, Nanjing Agricultural University, No. 6, Tongwei Road, Xuanwu District, Nanjing 210095, People’s Republic of China with those in the CON group. The BS groups could improve (P < 0.05) the values of villus length, villus width, crypt depth, and villus area of small intestine compared with that in the CON group. Compared with the CON group, the BS group increased (P < 0.05) small intestinal antioxidant capacity and its mitochondrial antioxidant capacity, and also improved the antioxidant related-gene expression. The BS group exerted a lower (P < 0.05) level of oxidative damages in small intestine than that of the CON group. In conclusion, dietary BS fmbj in broiler diets was potential to improve the small intestinal histomorphology, small intestinal antioxidant capacity, and its mitochondrial antioxidant capacity. Thus this BS fmbj might be considered to be an important additive for the poultry industry.

ABSTRACT This paper aimed to study the dietary effects of Bacillus subtilis fmbj (BS fmbj) on growth performance, small intestinal histomorphology, and its antioxidant capacity of broilers at 21 d of raising. A total of 300 1-d old male Arbor Acres broilers were randomly assigned to 5 groups: broilers fed the basal diets with 0 g/kg BS fmbj (CON), 0.2 g/kg BS fmbj (BS-1), 0.3 g/kg BS fmbj (BS-2), 0.4 g/kg BS fmbj (BS-3), and 0.5 g/kg BS fmbj (BS-4). The results showed that there were no differences in the growth performance among treatments during the trail. Dietary BS fmbj in broiler diets increased (P < 0.05) the serum immunoglobulin A (IgA) and immunoglobulin G (IgG) concentration, and enhanced the secretory immunoglobulin A (sIgA) level of small intestine (jejunum and ileum) compared

Key words: broilers, Bacillus subtilis fmbj, growth performance, small intestine, antioxidant capacity 2018 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pey116

INTRODUCTION

The enormous pressure of modern poultry feeding regarding the antibiotic overuse encourages the discovery of new alternative additives, especially natural products for their capacity for safety and nontoxicity. Probiotics, a natural product, tended to enhance the antioxidant capacity in individuals (Tabidi et al., 2013). Bacillus subtilis, among varieties of probiotics, could be metabolically dormant to face the extreme environments (Nicholson, 2002; Tabidi et al., 2013; Griggs and Jacob, 2015). Dietary supplementation with Bacillus subtilis exerts positive effects on productivity, stimulating the immune system, and improving the antioxidant capacity in poultry raising (La Ragione and Woodward, 2003; Lee et al., 2011). Dietary Bacillus subtilis in diets could improve the intestinal health and welfare of host in different ways, such as lowering the intestinal pH through acid fermentation, stimulating the immune system associated with the gut, increasing intestinal antioxidant capacity, and stimulating the intestinal intraepithelial lymphocytes (Nurmi and Rantala, 1973; Ng et al., 2009). It has been reported that dietary probiotics in diets was beneficial in suppressing the oxidative damage (Dalloul et al., 2003; Chen et al., 2014; Singh et al., 2014). The present study was designed to evaluate the dietary effects of BS fmbj without antibiotics on growth performance, small intestinal histomorphology,

Small intestine, as the most important organ of digestive nutrients, is the first to be damaged when oxidative stress occurs. Lipid peroxidation was one of the major causes of the oxidative damage, which could contribute to the development of oxygen radical-related damages (Koc et al., 2003). Previous study reported that the oxidative damage was induced by the imbalance of antioxidant defense system and free radical generation system (Grune, 2000; Giacco and Brownlee, 2010). There was a complex system containing natural enzymatic and nonenzymatic antioxidants that could protect the body from the oxidative damage. Briefly, the antioxidant enzymes (SOD, MnSOD, CAT, GSH, and GSH-Px) appear to be the first line of defense during oxidative stress, and exert beneficial effects on preventing the oxidative damage in poultry raising (Bai et al., 2016; La Ragione and Woodward, 2003; Tabassum et al., 2010; Rajput et al., 2013; Lee et al., 2014).

 C 2018 Poultry Science Association Inc. Received September 22, 2017. Accepted March 10, 2018. 1 Corresponding author: [email protected]

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

2

BAI ET AL.

and its antioxidant capacity of broilers at 21 d of raising.

Table 1. Ingredients and composition of the basal diets (as-fed basis, %, unless otherwise indicated). Item

MATERIALS AND METHODS Experimental Design The BS fmbj (CGMCCN 0943, Heng Zeyuan Biological Technology Co., Ltd, Wuxi, China) used in this study was a wild-type strain originally isolated and characterized at the College of Food Science and Technology, Nanjing Agricultural University. This product was determined to contain at least 1.0 × 1011 cfu/g of BS fmbj. A total of 300 1-d old male Arbor Acres broiler chickens were provided by a local commercial hatchery (Kangxin Poultry Co, Nanjing, China), and they were randomly assigned to 5 treatments. Each treatment had 6 replicates of 10 birds in each replicate. Treatments included (fed for 21 d): (1) CON group (fed the basal diets with BS fmbj at 0 g/kg); (2) BS-1 group (fed the basal diets with BS fmbj at 0.2 g/kg); (3) BS-2 group (fed the basal diets with BS fmbj at 0.3 g/kg); (4) BS-3 group (fed the basal diets with BS fmbj at 0.4 g/kg); (5) BS-4 group (fed the basal diets with BS fmbj at 0.5 g/kg). The basal diet was formulated to meet or exceed the nutritional requirements of broilers (NRC, 1994). All birds were raised in an environmentally controlled room (34 to 36◦ C) during 1 to 14 d, where the temperature was gradually decreased to 26◦ C until the end of this experiment. All broilers were kept under a constant lighting of 24 h, and allowed to take food and water ad libitum. They were handled in accordance with the guidelines of the Animal Care and Use Committee, Nanjing Agriculture University, Nanjing, People’s Republic of China, which has adopted the Animal Care and Use Guidelines governing all animals used in these experimental procedures. All chemical analyses of the feed samples were measured in triplicate before the raising experiments. The concentration of dry matter (930.15), crude protein (968.06), ether extract (991.36), and ash (942.05) were measured using standard procedures of (AOAC, 2005). The ingredient and chemical compositions of the experimental diets used in this study are shown in Table 1. The body weight (BW), feed intake (FI), and feed conversion ratio (FCR) of broilers were calculated at 1 d, 15 d, and 21 d.

Sample Collection At d 21 of raising, one bird, close to the mean body weight, was chosen from each pen and weighed. The serum was obtained by centrifugation the blood at 2000 × g for 15 min at 4◦ C, and stored at −20◦ C until analysis. After blood collection, small intestine (jejunum and ileum) was isolated and rapidly frozen in liquid nitrogen, and stored at −80◦ C until the analysis of the sIgA level, antioxidant enzymes activity, and gene expression.

Starter diet (1 to 21 d)

Ingredient Corn Soybean meal Corn gluten meal Soybean oil Dicalcium phosphate Limestone L-Lysine DL-Methionine Salt Premix1 Total Calculated composition2 Metabolisable energy (MJ/kg) Crude protein Calcium Available phosphorus Lysine Methionine Methionine + cysteine Analyzed composition3 Dry matter Crude protein Ether extract Ash

54.79 32.70 4.50 3.20 1.80 1.30 0.28 0.13 0.30 1.00 100.00 12.55 22.07 1.00 0.43 1.20 0.50 0.87 89.38 21.17 5.71 5.06

1 Premix provided per kg of diet: vitamin A (transretinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3000 IU; vitamin E (all-rac-α -tocopherol acetate), 30 IU; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 600 mg; calcium pantothenate, 10 mg; pyidoxine rHCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B12 (cobalamine), 0.013 mg; Fe (from ferrous sulphate), 80 mg; Cu (from copper sulphate), 8 mg; Mn (from manganese sulphate), 110 mg; iodine (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg. 2 The nutrient levels were as fed basis. 3 Values based on analysis of triplicate samples of diets.

Serum Immunoglobulin Analysis Serum IgA (H108), IgG (H106), and IgM (H109) concentrations were measured in triplicate with corresponding ELSA assay kits (Nanjing Jiancheng Bioengineering Institute) according to the previous method (Lebacq-Verheyden et al., 1972a and Leslie and Benedict, 1968; 1972b).

Intestinal sIgA Level Analysis At 21-d feeding, 1 g of chicken small intestine was homogenized at 6800 × g for 10 s in 9 mL of 0.9% sodium chloride buffer on ice, and then centrifuged at 2800 × g at 4◦ C for 15 min. This supernatant was used to measure the intestinal sIgA level with corresponding assay kits (Nanjing Jiancheng Bioengineering Institute) in triplicate according to the method described by Hu (Hu et al., 2002).

Histological Study

The small intestine (jejunum and ileum) samples fixed in 4% buffered formaldehyde were dried up using a graded series of xylene and ethanol, after which they were embedded in paraffin for histological study. The https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663

Downloaded from by University of Pennsylvania Libraries user on 15 April 2018

B. SUBTILIS IMPROVE BROILER PERFORMANCE

small intestine samples (8 microns in size) were then deparaffinized using xylene and rehydrated with graded dilutions of ethanol. The slides were stained with hematoxylin and eosin. Ten slides for each sample (the middle site of the sample) were prepared, and the images were acquired using an optical binocular microscope. The values of villus length (L), crypt depth, and villus width (W) were measured 5 times from different villus and crypts per slide. The villus area (S) was calculated using the following formula: 

S=π×

W 2

 

W 2

2

+ L2

Antioxidant Enzymes Activity Analysis The supernatant of chicken small intestine was used to measure the superoxide dismutase (SOD, A001), catalase (CAT, A007), glutathione peroxidase (GSHPx, A005), and glutathione (GSH1, A005) activity with corresponding assay kits (Nanjing Jiancheng Bioengineering Institute) in triplicate according to the method described previously (Placer et al., 1966; Panckenko et al., 1975; Lawrence and Burk, 1976; Abei, 1984).

Lipid Peroxidation Analysis Lipid peroxidation, expressed as malondialdehyde concentration, was determined in triplicate with a malondialdehyde (MDA, A003) assay kit according to the method described by the instructions of the manufacturer (Nanjing Jiancheng Bioengineering Institute). Briefly, chicken small intestinal supernatant was used to measure the MDA level by the method of thiobarbituric acid (TBA). The MDA–TBA mixture produced during the reaction of MDA in small intestine with TBA was measured at 535 nm (UV-2401 PC, Shimadzu, Japan).

Isolation of Chicken Intestinal Mitochondria Chicken small intestinal mitochondria were prepared according to the method described by Tang (Tang et al., 2006). Namely, chicken small intestine was homogenized in ice-chilled Dounce homogenizers (1:10, w/v) using isolation buffer containing 10 mM MOPS pH 7.4, 250 mM sucrose, 5 mM KH2 PO4 , 2 mM MgCl2 , 1 mM EGTA, 0.1% fatty acid-free BSA, and centrifuged at 1000 × g for 5 min at 4◦ C. The supernatants were removed and the mitochondria-enriched pellets were gently re-suspended and washed with the isolation buffer, after which the pellets were obtained by centrifugation at 12,000 × g for 5 min.

Antioxidant Enzyme Activity of Intestinal Mitochondria Analysis

3

glutathione peroxidase (GPx, A005), and protein concentrations (A045–3) of chicken small intestinal mitochondria were measured in triplicate with corresponding assay kits (Nanjing Jiancheng Bioengineering Institute) according to the method of (Lowry et al., 1951; Lawrence and Burk, 1976; Van et al., 2004; Langston et al., 2011).

Oxidative Damage Analysis The reactive oxygen species (ROS) level in chicken small intestinal mitochondria was detected in triplicate with a ROS (E004) assay kit according to the manufacturer instructions (Nanjing Jiancheng Bioengineering Institute). Briefly, the intestinal mitochondria were incubated with DCFH-DA (10 μM) and DNA stain Hoechst 33,342 (10 mmol/L) at 37◦ C for 30 min. Then, the DCFH fluorescence of mitochondria was measured in triplicate at an emission wavelength of 530 nm and an excitation wavelength of 485 nm with a FLX 800 microplate fluorescence reader (Biotech Instruments Inc., USA). The results were expressed as the mean DCFHDA fluorescence intensity over that of the control. Protein oxidation of chicken intestinal mitochondria was calculated using the concentrations of protein carbonyls (PC) (Wei et al., 2006), and presented in nmol/mg protein. The level of 8-hydroxy-2-deoxyguanosine (8-OHdG) in chicken small intestinal mitochondria was calculated in triplicate with an ELSA assay kit (Beyotime Institute of Biotechnology) according to the method described by the manufacturer instructions, and presented in ng/mg protein.

Mitochondrial Membrane Potential (MMP) Analysis The changes in the mitochondrial membrane potential (MMP) in the chicken hepatic mitochondria were detected using an MMP assay kit (No. H146, Nanjing Jiancheng Institute of Bioengi-neering, Jiangsu, China). In brief, the hepatic mitochondria were loaded with 1X JC-1 dye at 37◦ C for 20 min, and then analyzed, after washing, by flow cytometry (FACS Aria III, BD, New Jersey, US). The MMP was calculated as the increase in ratio of green and red fluorescence. When the MMP levels are low, JC-1 exists mainly as a monomer, which emits green fluorescence (excitation wavelength of 490 nm and emission wavelength of 540 nm). However, when the MMP levels are high, JC-1 exists mainly as a polymer, which emits red fluorescence (excitation wavelength of 525 nm and emission wavelength of 590 nm). The results were calculated in triplicate as the ratio of the fluorescence of aggregates (red) to that of the monomers (green).

Quantitative Real-Time PCR Analysis

The activity of manganese superoxide dismutase Total RNA was obtained from chicken small in(MnSOD, A001–2), glutathione (GSH2, A005), testine using Trizol Reagent (TaKaRa), and then Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

4

BAI ET AL.

Table 2. Primer sequences used for real-time PCR assay. Name1 Nrf2 HO-1 SOD CAT GSH-Px β -Actin

avUCP NRF1 NRF2 TFAM PGC-1α

Sequence (5’→3’)2 GATGTCACCCTGCCCTTAG CTGCCACCATGTTATTCC GGTCCCGAATGAATGCCCTTG ACCGTTCTCCTGGCTCTTGG CCGGCTTGTCTGATGGAGAT TGCATCTTTTGGTCCACCGT GGTTCGGTGGGGTTGTCTTT CACCAGTGGTCAAGGCATCT GACCAACCCGCAGTACATCA GAGGTGCGGGCTTTCCTTTA TGCTGTGTTCCCATCTATCG TTGGTGACAATACCGTGTTCA ACAACGTCCCCTGTCACTTC ATGAACATCACCACGTTCCA AAGAACACGGCGTGACTCAA TCGCTTCCGTTTCTTACCCG GAGCCCATGGCCTTTCCTAT CACAGAGGCCCTGACTCAAA GTGAAAGCCTGGCGAAACTG CACAGCTCAGGTTACACCGT GATTCTTCACCTGGGTGGCA TCAGCCCGAATTTCCTGGTC

Genbank3 NM 205,117.1 HM237181.1 NM 205,064.1 NM 0,010,31215.1 NM 0,012,77853.1 NM 205,518.1 AB088685.1 NM 0,010,30646.1 NM 0,010,07858.1 NM 204,100.1 NM 0,010,06457.1

1 nuclear factor erythroid 2-related factor 2 (Nrf2); heme oxygenase 1 (HO-1); superoxide dismutase (SOD); hydrogen peroxidase (CAT); glutathione peroxidase (GSH-Px); avian uncoupling protein (avUCP); nuclear respiratory factor 1 (NRF1); nuclear respiratory factor 2 (NRF2); mitochondrial transcription factor A (TFAM); peroxisome proliferatoractivated receptor gamma coactivator 1α (PGC-1α ). 2 Shown as forward primer followed by reverse primer. 3 GenBank Accession Number.

reverse-transcribed using a commercial kit (Perfect R PrimeScriptTM TaKaRa) with the Real Time, SYBR method described by the manufacturer instructions. The mRNA expression level of specific genes was quanR tified via real-time PCR, using SYBR Premix Ex TM II (Tli RNaseH Plus) and an ABI 7300 Fast Taq Real-Time PCR detection system (Applied Biosystems, USA). The SYBR Green PCR reaction mixture conR sisted of 10 μL SYBR Premix Ex Taq (2X), 0.4 μL of the forward and reverse primers, 0.4 μL of ROX reference dye (50X), 6.8 μL of ddH2 O, and 2 μL of cDNA template. Each chicken small intestine was amplified in triplicate. The fold-expression of each gene (Table 2) was calculated according to the 2 −ΔΔCt method (Liu et al., 2012), in which β -actin gene was used as an internal standard.

Statistical Analyses All the data were statistically analyzed by one-way ANOVA procedure of Statistical Analysis System (SAS Institute Inc., Cary, NC). This was followed by the Tukey’s test, when significant differences were found (P < 0.05). The significance was defined as P < 0.05. The data were expressed as means ± SD.

RESULTS AND DISCUSSION The inhibition usage of antibiotics in poultry diets encourages the discovery of new alternative additives, especially natural products for their capacity for nontox-

icity and safety. In the previous study, dietary BS fmbj in diets appeared to be beneficial to the broiler performance with no side effects observed (Bai et al., 2016). It has been reported that dietary Bacillus in broiler diets could improve its performance during 21 d of raising (Ahmed, 2014; Park and Kim, 2014). However, the growth performance of broilers in the current study was not affected by dietary BS fmbj in diets during 21-d feeding (Table 3). In agreement with our results, some studies have found that there were no differences in the growth performance among treatments during 21d feeding (Zhang, 2014). Another study also indicated that dietary B. subtilis natto in diets exerted no differences on broiler growth performance among treatments for 28 d (Samanya and Yamauchi, 2002). These different results on the growth performance with Bacillus in broiler diets can be ascribed to several factors, such as the dose of Bacillus species, the age of animals, diet composition, and feed form. The concentration of IgA, IgG, and IgM are the major parameters to reflect the body immune status for their capacity for fighting against various infections. Previous studies have evaluated the dietary effects of probiotics on the immune system, and the results were generally unproductive and even conflicting. In the present study, the concentrations of serum IgA and serum IgG (Table 4) were increased (P < 0.05) in the BS group compared with those in the CON group. It has been indicated that dietary L. acidophilus in diets could increase the number of IgA-producing cells (Perdigon et al., 1995). Another study reported that dietary probiotics in broiler diets could improve the serum IgA and IgG concentration compared with the control group (Yang et al., 2012; Amerah et al., 2013). Previous study found that dietary probiotics in broiler diets could increase the level of serum immunoglobulin through its immunomodulatory function (Paturi et al., 2007). Small intestine usually acts as an immune protection barrier in individuals. Dietary Bacillus in diets could improve the body immune status by regulating the intestine mucosal cytokines (Patterson and Burkholder, 2003). The IgA could turn to sIgA in cell gap with the secreted fragments produced by epithelial cells, and then binds with the corresponding antigen to protect the intestinal mucosa from the oxidative damage (Brandtzaeg, 2002). The current study indicated that the small intestinal sIgA level (Table 5) was increased (P < 0.05) in the BS group compared with those in the CON group. Consistent with our results, dietary Bacillus in broiler diets could improve its immune status, including the changes of mucosal lymphocyte populations that were associated with IgA class switching (Lee, 2010). Another study also found that dietary probiotics could increase the sIgA level of small intestine at 21-d feeding compared with the control group (Amerah et al., 2013). However, some studies reported that dietary probiotics in diets exerted little beneficial effects on its immune status, and this might be due to the different experimental design and the different time of

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

5

B. SUBTILIS IMPROVE BROILER PERFORMANCE Table 3. Dietary effects of Bacillus subtilis fmbj on growth performance of broilers.1 Treatment3 Item2 1 to 15 d BW (g/bird) FI (g/bird) FCR (g/g) 16 to 21 d BW (g/bird) FI (g/bird) FCR (g/g)

CON

BS-1

BS-2

BS-3

BS-4

245.25 ± 8.43 355.50 ± 11.45 1.45 ± 0.03

247.50 ± 7.98 385.20 ± 12.11 1.56 ± 0.02

260.40 ± 9.09 382.05 ± 12.42 1.47 ± 0.03

249.75 ± 8.57 400.80 ± 14.12 1.60 ± 0.03

254.55 ± 8.44 399.30 ± 13.86 1.57 ± 0.04

330.95 ± 10.76 482.35 ± 14.41 1.46 ± 0.04

327.7 ± 10.44 473.65 ± 14.22 1.45 ± 0.03

313.45 ± 9.98 449.85 ± 14.75 1.44 ± 0.03

328.75 ± 10.82 480.50 ± 15.01 1.46 ± 0.02

327.40 ± 10.34 477.10 ± 14.88 1.45 ± 0.03

1 Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 body weight (BW); feed intake (FI); feed conversion ratio (FCR). 3 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

Table 4. Dietary effects of Bacillus subtilis fmbj on serum IgA, IgG, and IgM concentration of broilers.1 Treatment2 Item (mg/mL) IgA IgG IgM

CON

BS-1

5.28 ± 0.17 2.84 ± 0.12b 1.61 ± 0.11 b

BS-2

5.80 ± 0.22 3.53 ± 0.17a 1.71 ± 0.14 a

BS-3

6.63 ± 0.27 4.70 ± 0.20a 1.90 ± 0.11 a

BS-4

6.36 ± 0.23 4.19 ± 0.21a 1.84 ± 0.12 a

6.33 ± 0.22a 4.15 ± 0.17a 1.79 ± 0.11

1 Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

Table 5. Dietary effects of Bacillus subtilis fmbj on small intestinal sIgA level of broilers.1 Treatment2 sIgA(μ mol/g) Jejunum Ileum

CON

BS-1

BS-2

BS-3

BS-4

9.45 ± 0.35b 7.85 ± 0.28b

10.88 ± 0.33a 8.51 ± 0.31a

11.37 ± 0.41a 9.09 ± 0.30a

11.05 ± 0.38a 8.87 ± 0.33a

10.91 ± 0.37a 8.77 ± 0.35a

1 Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

collection (Mountzouris et al., 2010; Zhang et al., 2012). Further studies are still required in order to draw any conclusions on the dietary effects of Bacillus on the immune system. Oxidative stress is a common process in life, and it could produce varieties of ROS in bodies like hydroxylfree radicals and superoxide anions. The excess of ROS can damage the proteins, nucleic acids, and other biological macromolecules, and produce large amounts of MDA leading to tissue damage and tissue mitochondrial damage, thus contributing to the development of diseases. Broilers are prone to oxidative stress under certain unsuitable physiological and environmental conditions, especially with the development of modern intensive farming aimed at high yields of chicken, which imposes oxidative stress (Salami et al., 2015).

The lipid content is relatively high in broiler chickens, which tends to damage the body by producing ROS for its nutritional and physiological characteristics. Small intestine is the earliest damaged organ in the oxidative damage, and its integrity structure is important in resisting the oxidative damage. The probiotic tends to improve the small intestinal performance for its capacity for lowering its pH value, stimulating its intraepithelial lymphocytes, and increasing its antioxidant capacity (Nurmi and Rantala, 1973; Ng et al., 2009; Ferket, 2011). The present study indicated that dietary BS fmbj in broiler diets could improve (P < 0.05) the values of villus length, villus width, crypt depth, and villus area of small intestine compared with those in the CON group (Table 6, Figure 1). Antioxidant enzymes (SOD, CAT, GSH, and GSH-Px) act as the first line to

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

6

BAI ET AL. Table 6. Dietary effects of Bacillus subtilis fmbj on small intestine histological morphology of broilers.1 Treatment2 Item Jejunum villus length (μ m) villus width (μ m) crypt depth (μ m) villus area (mm2 ) Ileum villus length (μ m) villus width (μ m) crypt depth (μ m) villus area (mm2 )

CON

BS-1

BS-2

BS-3

BS-4

680.56 69.07 91.68 0.074

± ± ± ±

30.29b 3.44b 4.13b 0.008b

756.10 73.32 104.65 0.087

± ± ± ±

32.33a 4.13a 5.07a 0.010a

802.05 79.96 110.76 0.101

± ± ± ±

34.12a 4.52a 5.34a 0.009a

761.33 75.60 106.54 0.090

± ± ± ±

30.29a 3.99a 5.22a 0.011a

758.44 74.83 105.22 0.089

± ± ± ±

30.03a 4.33a 4.27a 0.008a

500.07 63.58 84.32 0.050

± ± ± ±

25.19b 3.23b 3.43b 0.009b

630.42 70.46 91.27 0.070

± ± ± ±

24.99a 4.12a 3.71a 0.008 a

677.57 75.87 95.36 0.081

± ± ± ±

25.37a 3.95a 3.69a 0.010a

650.11 71.66 91.60 0.073

± ± ± ±

25.43a 3.33a 3.57a 0.009a

647.75 71.23 91.54 0.072

± ± ± ±

24.96a 4.02a 4.01a 0.009a

1 Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

Figure 1. Haematoxylin and eosin (H&E) staining of jejunum and ileum at 21 d of age. Note: Scale bar, 100 μ m.

Table 7. Dietary effects of Bacillus subtilis fmbj on small intestinal antioxidant capacity of broilers.1 Treatment3 Item2 Jejunum SOD (U/mg protein) CAT (U/mgprotein) GSH-Px (U/mg protein) GSH1 (μ mol/g protein) MnSOD (U/mg protein) GPx (U/mg protein) GSH2 (μ mol/g protein) Ileum SOD (U/mg protein) CAT (U/mg protein) GSH-Px (U/mg protein) GSH1 (μ mol/g protein) MnSOD (U/mg protein) GPx (U/mg protein) GSH2 (μ mol/g protein)

CON

BS-1

BS-2

BS-3

BS-4 105.05 ± 2.56a 6.660.22 57.46 ± 1.58a 18.12 ± 1.38a 0.59 ± 0.05a 26.98 ± 1.29a 0.50 ± 0.06a

90.07 6.22 50.38 10.38 0.41 24.33 0.39

± ± ± ± ± ± ±

2.36b 0.25 1.54b 1.33b 0.06b 1.21b 0.04b

101.11 6.33 56.38 16.38 0.59 26.57 0.48

± ± ± ± ± ± ±

2.78a 0.29 1.52a 1.34a 0.06a 1.29a 0.05a

107.33 6.97 61.37 21.37 0.66 29.34 0.60

± ± ± ± ± ± ±

2.94a 0.26 1.63a 1.39a 0.06a 1.33a 0.04a

105.74 6.79 58.46 18.46 0.61 27.15 0.52

± ± ± ± ± ± ±

2.45a 0.31 1.66a 1.35a 0.07a 1.31a 0.07a

65.13 4.25 24.79 9.79 0.38 23.11 0.36

± ± ± ± ± ± ±

2.54b 0.33 1.32b 1.35b 0.03b 1.13b 0.04b

73.34 4.31 31.49 11.49 0.55 25.35 0.45

± ± ± ± ± ± ±

3.12a 0.32 1.40a 1.42a 0.04a 1.22a 0.05a

80.17 4.50 36.41 16.41 0.61 27.58 0.57

± ± ± ± ± ± ±

3.43a 0.31 1.42a 1.49a 0.04a 1.28a 0.05a

75.27 4.39 34.16 14.16 0.57 26.49 0.51

± ± ± ± ± ± ±

3.15a 0.35 1.33a 1.44a 0.03a 1.27a 0.04a

75.10 4.33 33.82 13.57 0.57 26.00 0.50

± ± ± ± ± ± ±

3.11a 0.40 1.45a 1.50a 0.05a 1.30a 0.04a

1 Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 superoxide dismutase (SOD); catalase (CAT); glutathione peroxidase (GSH-Px); glutathione (GSH1); mitochondria manganese superoxide dismutase (MnSOD); mitochondria glutathione peroxidase (GPx); mitochondria glutathione (GSH2). 3 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

B. SUBTILIS IMPROVE BROILER PERFORMANCE

suppress the oxidative damage. The SOD enzyme enhances the production of O2 and H2 O2 from O2− , which are decomposed to water by CAT and GSH-Px, thus suppressing the oxidative damage by inhibiting the formation of OH− . The GSH and GSH-Px enzymes relieve the oxidative damage by eliminating the excessively generated free radicals. Consistent with our results, it has been reported that dietary Bacillus subtilis in diets was beneficial on the antioxidant capacity of broilers (La Ragione and Woodward, 2003). In the present study, we also measured the small intestine mitochondrial antioxidant enzymes (MnSOD, GSH, and GPx) activity, and the results indicated that they were increased (P < 0.05) in the BS group compared with those in the CON group (Table 7). The GPx is essential both in the GSH oxidation and in the metabolic pathway of GSH. In this process, these peroxides finally prove to be nonoxidative, toxic, or more stable metabolites. In the current study, the broilers in BS group also increased (P < 0.05) the small intestine mitochondrial MnSOD, GPx, and GSH2 activity compared with those in the CON group (Table 7). It has been found that dietary probiotics in diets could improve the body antioxidant capacity (Tabidi et al., 2013). Although little study was focused on the dietary effects of probiotics on the mitochondrial antioxidant capacity of small intestine, it has been reported that dietary probiotics in diets exerted beneficial effects on the oxidative damage by enhancing its antioxidant capacity (Mtakahashis, 2005; Bai et al., 2016). Another study also reported that dietary Bacillus subtilis in diets was beneficial to the antioxidant capacity of animals (Rajput et al., 2013). The above results indicated that dietary BS fmbj in diets could enhance the antioxidant capacity of broilers mainly due to its capacity for activating relative gene expression, and further study is still needed on this specific mechanism. The oxidative damage is associated with the disruption of redox status and the damage of small intestinal structure. The MDA level is a main degradation product of lipid peroxidation, which is associated with the oxidative damage. Reactive oxygen species is the main product in mitochondria oxidative phosphorylation reaction. Once the generated ROS exceeds the scavenging ability of the antioxidant system, it can lead to oxidative damage in individuals. DNA transcription, translation, and replication can be disturbed by the oxidative damage, and finally result in cell death. These damaged cellular components, in turn, can affect the efficiency of the oxidative phosphorylation reaction in the mitochondria and generate more ROS. Thus, ROS is another important indicator of the oxidative damage (Jones, 2006). The PC assay is important in studying the protein-oxidative damage in individual and the 8-OHdG is another parameter of cellular oxidative damage. It has been reported that the excessively generated free radicals could be removed by the antioxidant enzymes (Ko et al., 2004). In the present study, the BS group showed a lower (P < 0.05) MDA, ROS, PC, and

7

8-OHdG level of small intestine than those of the CON group (Table 8). Dietary BS fmbj in broiler diets exerted a higher (P < 0.05) MMP level of small intestine than the birds in the CON group (Table 8). In agreement with our results, it has been found that dietary probiotics were of great benefit in oxidation resistance for their capacity for increasing the antioxidant activity (Capcarova et al., 2010). With regard to the antioxidant capacity, the endogenous antioxidant system is also dependent on other external sources, such as probiotics, which appear to be the natural additive to suppress the oxidative damage. The changes of MMP level act as the starting of the mitochondrial damage. The decreased MMP level is accompanied by the increasing of ROS level, which finally leads to the mitochondrial damage. Some studies reported that dietary probiotics in diets could improve the oxidative damage (Deng et al., 2012), increase the antioxidant capacity (Sanders, 1993), and improve the body performance (Fuller, 1989). The above results indicated that dietary BS fmbj groups could improve their antioxidant capacity by eliminating the excessively generated free radicals compared with those in the CON group. Further study is still needed to understand the mechanism behind this. It is essential to activate Nrf2 nuclear transcription factor in regulating the expression of the II metabolic enzyme gene. It has been found that many natural substances could enhance the II-phase metabolic enzyme activity by activating Nrf2-related signaling pathway (Kode et al., 2008). In the present study, in addition to GSH metabolism-related enzymes gene, the HO-1, SOD, CAT, and other antioxidant properties of the II-phase metabolic enzymes gene were also measured. HO-1 is the limited enzyme in the decomposition of hemoglobin, whose products contain endogenous carbon monoxide, biliverdin, and Fe2+ . Biliverdin and bilirubin are two important endogenous antioxidants that are involved in the formation of physiological system against the protein oxidation. The gene expression level of NRF1, NRF2, PGC-1α, and TFAM is mainly associated with the mitochondrial biogenesis. NRF1/2 is important in regulating the gene expression of mitochondria respiratory chain. TFAM is mainly involved in the mitochondrial DNA replication and transcription. PGC-1α takes part in regulating the mitochondrial biogenesis, and also enhances the level of mitochondrial biosynthesis by increasing the expression of NRF1/2 and TFAM. The avUCP is the mitochondrial transporter protein of broilers, and is located on the inner mitochondrial membrane involving varieties of physiological functions, including the regulation of ROS generation (Kikusato and Toyomizu, 2013). Interestingly, the current study suggested that the expression level of antioxidant related-gene and mitochondrial related-genes of small intestine were improved (P < 0.05) in the BS group compared with that in the CON group (Table 9). Future study is still needed on the relationship between antioxidant capacity and

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

8

BAI ET AL. Table 8. Dietary effects of Bacillus subtilis fmbj on small intestinal oxidative damage of broilers.1 Treatment3 Item2

CON

Jejunum MDA (nmol/mg protein) ROS (%, over CON) PC (nmol/mg protein) 8-OHdG (ng/mg protein) MMP (%, over CON) Ileum MDA (nmol/mg protein) ROS (%, over CON) PC (nmol/mg protein) 8-OHdG (ng/mg protein) MMP (%, over CON)

BS-1

BS-2

BS-3

BS-4

7.50 100.00 32.50 0.25 1.00

± ± ± ± ±

0.30a 2.51a 0.50a 0.02a 0.03b

6.48 86.16 28.48 0.20 1.16

± ± ± ± ±

0.31b 2.48b 0.48b 0.02b 0.03a

5.60 80.35 24.60 0.15 1.22

± ± ± ± ±

0.39b 2.12b 0.33b 0.02b 0.04a

6.25 84.17 26.25 0.18 1.19

± ± ± ± ±

0.40b 2.33b 0.42b 0.02b 0.03a

6.33 84.98 27.31 0.19 1.18

± ± ± ± ±

0.42b 2.41b 0.39b 0.03b 0.03a

7.95 100.00 35.44 0.29 1.00

± ± ± ± ±

0.25a 2.27a 0.55a 0.03a 0.03b

6.64 87.39 30.64 0.24 1.14

± ± ± ± ±

0.31b 2.33b 0.50b 0.03b 0.03a

5.12 82.44 25.12 0.17 1.19

± ± ± ± ±

0.35b 2.38b 0.44b 0.04b 0.03a

6.33 85.10 28.33 0.20 1.16

± ± ± ± ±

0.33b 2.31b 0.39b 0.03b 0.04a

6.42 86.18 29.32 0.22 1.14

± ± ± ± ±

0.30b 2.42b 0.41b 0.03b 0.04a

1 The values of CON group is set to 1% (MMP) or 100% (ROS). Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 malondialdehyde (MDA); reactive oxygen species (ROS); protein carbonyls (PC); 8-hydroxy-2-deoxyguanosine (8-OHdG); mitochondrial membrane potential (MMP). 3 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

Table 9. Dietary effects of Bacillus subtilis fmbj on small intestinal gene expression level of broilers.1 Treatment3 Item

2

Jejunum Nrf2 HO-1 SOD CAT GSH-Px av-UCP NRF1 NRF2 TFAM PGC-1α Ileum Nrf2 HO-1 SOD CAT GSH-Px av-UCP NRF1 NRF2 TFAM PGC-1α

CON

BS-1

BS-2

BS-3

BS-4

100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00

± ± ± ± ± ± ± ± ± ±

2.67b 2.66b 2.77b 2.61 2.65b 2.42b 2.51b 2.72b 2.53b 2.44b

115.28 124.05 113.38 111.85 125.65 115.27 117.17 116.18 118.03 116.30

± ± ± ± ± ± ± ± ± ±

2.72a 2.73a 4.05a 3.12 3.33a 2.89a 3.28a 3.25a 2.89a 2.87a

120.54 130.77 116.22 113.25 133.51 119.33 121.80 120.16 122.41 123.51

± ± ± ± ± ± ± ± ± ±

2.77a 2.84a 2.98a 3.04 3.46a 3.23a 3.37a 3.34a 4.02a 2.98a

117.25a ± 2.68 126.85 ± 2.59a 114.61 ± 2.82a 112.61 ± 2.98 128.15 ± 3.29a 117.30 ± 3.19a 119.29 ± 3.22a 117.12 ± 3.21a 120.16 ± 3.05a 117.62 ± 2.74a

116.33 125.27 114.11 112.03 127.78 116.79 119.03 116.85 119.67 117.32

± ± ± ± ± ± ± ± ± ±

2.71a 2.81a 2.88a 3.11 3.41a 3.21a 3.38a 3.40a 3.11a 4.02a

100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00

± ± ± ± ± ± ± ± ± ±

2.72b 2.43b 2.57b 2.92 2.75b 3.48b 2.66b 2.72b 2.63b 2.95b

114.92 121.66 112.24 112.39 123.58 114.14 115.45 115.58 116.56 114.15

± ± ± ± ± ± ± ± ± ±

3.02a 2.96a 3.01a 3.14 4.03a 3.58a 3.11a 4.08a 4.03a 3.15a

118.35 128.32 115.19 114.12 129.33 116.09 120.60 119.48 118.77 120.57

± ± ± ± ± ± ± ± ± ±

3.01a 3.02a 3.03a 2.97 3.03a 3.26a 3.20a 3.18a 3.11a 3.22a

115.63 122.53 114.64 113.25 125.18 115.39 117.74 116.52 117.38 116.35

± ± ± ± ± ± ± ± ± ±

115.21 122.09 113.99 112.98 124.75 115.01 117.22 115.92 117.12 115.91

± ± ± ± ± ± ± ± ± ±

3.21a 3.30a 3.15a 3.17 4.10a 3.29a 3.23a 3.28a 4.17a 3.22a

3.01a 3.09a 2.99a 3.08 3.12a 3.41a 3.04a 3.12a 3.09a 3.20a

1 The values of CON group is set to 100%. Data are expressed as mean ± SD, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 nuclear factor erythroid 2-related factor 2 (Nrf2); heme oxygenase 1 (HO-1); superoxide dismutase (SOD); catalase (CAT); glutathione peroxidase (GSH-Px); avian uncoupling protein (avUCP); nuclear respiratory factor 1 (NRF1); nuclear respiratory factor 2 (NRF2); mitochondrial transcription factor A (TFAM); peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α ). 3 CON, birds fed the basal diet without BS fmbj; BS-1, birds fed the basal diet with 0.2 g/kg BS fmbj; BS-2, birds fed the basal diet with 0.3 g/kg BS fmbj; BS-3, birds fed the basal diet with 0.4 g/kg BS fmbj; BS-4, birds fed the basal diet with 0.5 g/kg BS fmbj.

antioxidant-related gene expression when dietary probiotics in broiler diets.

FUNDING The authors gratefully acknowledge the Jiangsu Province Government (China) for its support through

the program “Twelve Five” Rural areas research of national science and technology (2013BAD10B03). This study was funded by the Jiangsu Science and Technology Project (BY2013074–01), and was also supported by a project of II phase: Priority Academic Program Development of Jiangsu Higher Education Institutions.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

B. SUBTILIS IMPROVE BROILER PERFORMANCE

REFERENCES Abei, A. 1984. Catalase in vitro. Methods Enzymol. 105:121–126. Ahmed, S. T. 2014. Effects of Bacillus amyloliquefaciens as a probiotic strain on growth performance, cecal microflora, and fecal noxious gas emissions of broiler chickens. Poult. Sci. 93:1963– 1971. Amerah, A. M., A. Quiles, P. Medel, J. S´ anchez, M. J. Lehtinen, and M. I. Gracia. 2013. Effect of pelleting temperature and probiotic supplementation on growth performance and immune function of broilers fed maize/soy-based diets. Anim. Feed Sci. Technol. 180:55–63. AOAC. 2005. Official Methods of Analysis, 18th ed. AOAC International, Washington, DC. Bai, K., Q. Huang, J. Zhang, J. He, L. Zhang, and T. Wang. 2017. Supplemental effects of probiotic Bacillus subtilis fmbJ on growth performance, antioxidant capacity, and meat quality of broiler chickens. Poult. Sci. 96:74–82. Brandtzaeg, P. 2002. Current understanding of gastrointestinal immunoregulation and its relation to food allergy. Ann. N. Y. Acad. Sci. 964:13–45. Capcarova, M., J. Weiss, C. Hrncar, A. Kolesarova, and G. Pal. 2010. Effect of Lactobacillus fermentum and Enterococcus faecium strains on internal milieu, antioxidant status and body weight of broiler chickens. J. Anim. Physiol. Anim. Nutr. (Berl.) 94:e215–e224. Chen, X. L., L. Z. Gong, and J. X. Xu. 2014. The protective effects of probiotics on high fat diet-induced oxidative damage using a comet assay in rats. AMR 998–999:350–353. Singh, A. K., S. K. Pandey, and K. G. Naresh. 2014. Pyrroloquinoline quinone-secreting probiotic escherichia coli nissle 1917 ameliorates ethanol-induced oxidative damage and hyperlipidemia in rats. Alcohol Clin. Exp. Res. 38:2127–2137. Dalloul, R. A., H. S. Lillehoj, T. A. Shellem, and J. A. Doerr. 2003. Enhanced mucosal immunity against Eimeria acervulina in broilers fed a Lactobacillus-based probiotic. Poult. Sci. 82:62– 66. Deng, W., X. F. Dong, J. M. Tong, and Q. Zhang. 2012. The probiotic Bacillus licheniformis ameliorates heat stress-induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens. Poult. Sci. 91:575–582. Ferket, P. R. 2011. Nutrition-disease interactions regarding gut health in chickens. Proceedings of the 18th European Symposium on Poultry Nutrition. Cesme, Izmir, Turkey. Fuller, R. 1989. Probiotics in man and animals. J. Appl. Bacteriol. 66:365–378. Giacco, F., and M. Brownlee. 2010. Oxidative stress and diabetic complications. Circ. Res. 107:1058–1070. Griggs, J. P., and J. P. Jacob. 2005. Alternatives to antibiotics for organic poultry production. J. Appl. Poult. Res. 14:750–756. Grune, T. 2000. Oxidative stress, aging and the proteasomal system. Biogerontology. 1:31–40. Hu, Z. Q., L. G. Jiang, Y. M. Wei, and M. Y. Cai. 2002. Separation and purification of secretory component of siga. Progress in Microbiology and Immunology. Jones, D. P. 2006. Redefining oxidative stress. Antioxidants & Redox Signaling. 8:1865–1879. Kikusato, M., and M. Toyomizu. 2013. Crucial role of membrane potential in heat stress-induced overproduction of reactive oxygen species in avian skeletal muscle mitochondria. PLoS One 33: 6953–6960(6958). Ko, Y. H., H. Y. Yang, and I. S. Jang. 2004. Effect of conjugated linoleic acid on intestinal and hepatic antioxidant enzyme activity and lipid peroxidation in broiler chickens. Asian Australas. J. Anim. Sci 17:1162–1167. Koc, M., S. Taysi, M. E. Buyukokuroglu, and N. Bakan. 2003. Melatonin protects rat liver against irradiation-induced oxidative injury. J. Radiat. Res. 44:211–215. Kode, A., S. Rajendrasozhan, S. Caito, S. R. Yang, I. L. Megson, and I. Rahman. 2008. Resveratrol induces glutathione synthesis by activation of nrf2 and protects against cigarette smoke-mediated oxidative stress in human lung epithelial cells. American Journal of Physiology-Lung Cellular and Molecular Physiology. 294:L478– L488.

9

Langston, J. W., W. Li, L. Harrison, and T. Y. Aw. 2011. Activation of promoter activity of the catalytic subunit of γ -glutamylcysteine ligase (GCL) in brain endothelial cells by insulin requires antioxidant response element 4 and altered glycemic status: Implication for GCL expression and GSH synthesis. Free Radic. Biol. Med. 51:1749–1757. La Ragione, R. M., and M. J. Woodward. 2003. Competitive exclusion by Bacillus subtilis spores of Salmonella enterica serotype Enteritidis and Clostridium perfringens in young chickens. Vet. Microbiol. 94:245–256. Lawrence, R. A., and R. F. Burk. 1976. Glutathione peroxidase activity in selenium-deficient rat liver. Biochem. Biophys. Res. Commun. 71:952–958. Lebacq-Verheyden, A. M., J. P. Vaerman, and J. F. Heremans. 1972a. A possible homologue of mammalian IgA in chicken serum and secretions. Immunology. 22:165. Lebacq-Verheyden, A. M., J. P. Vaerman, and J. F. Heremans. 1972b. Immunohistologic distribution of the chicken immunoglobulins. J. Immunol. 109:652. Lee, K. W. 2010. Effects of direct-fed microbials on growth performance, gut morphometry, and immune characteristics in broiler chickens. Poult. Sci. 89:203–216. Lee, K. W., G. Li, H. S. Lillehoj, S. H. Lee, S. I. Jang, U. S. Babu, E. P. Lillehoj, A. P. Neumann, and G. R. Siragusa. 2011. Bacillus subtilis-based direct-fed microbials augment macrophage function in broiler chickens. Res. Vet. Sci. 91:e87–e91. Lee, K. W., H. S. Lillehoj, S. I. Jang, S. H. Lee, K. W. Lee, and H. S. Lillehoj. 2014. Effects of salinomycin and Bacillus subtilis on growth performance and immune responses in broiler chickens. Res. Vet. Sci. 97:304–308. Leslie, G. A., and A. A. Benedict. 1968. Nonhemagglutinating Nondissociable 7S Subunits of Chicken IgM Antibody. Exp. Biol. Med. 128:1012–1016. Liu, J., D. Chen, Y. Yao, B. Yu, X. Mao, J. He, Z. Huang, and P. Zheng. 2012. Intrauterine growth retardation increases the susceptibility of pigs to high-fat diet-induced mitochondrial dysfunction in skeletal muscle. PLoS One 7:e34835. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin-phenol reagent. J. Biol. Chem. 193:265–275. Mountzouris, K. C., P. Tsitrsikos, I. Palamidi, A. Arvaniti, M. Mohnl, G. Schatzmayr, and K. Fegeros. 2010. Effects of probiotic inclusion levels in broiler nutrition on growth performance, nutrient digestibility, plasma immunoglobulins, and cecal microflora composition. Poult. Sci. 89:58–67. Mtakahashis, T. M. 2005. A novel germline mutation of the LKB1 gene in a patient with Peutz-Jeghers syndrome with early-onset gastric cancer. J. Gastroenterol. 39:1210–1214. Ng, S. C., A. L. Hart, M. A. Kamm, A. J. Stagg, and S. C. Knight. 2009. Mechanisms of action of probiotics: recent advances. Inflamm. Bowel Dis. 15:300–310. Nicholson, W. L. 2002. Roles of Bacillus endospores in the environment. Cellular and Molecular Life Sciences (CMLS) 59:410– 416. NRC. 1994. Nutrient Requirements of Poultry: National Research Council. National Academy Press, Washington, DC, USA. Nurmi, E., and M. Rantala. 1973. New aspects of Salmonella infection in broiler production. Nature 241:210–211. Panchenko, L. F., O. S. Brusov, A. M. Gerasimov, and T. D. Loktaeva. 1975. Intramitochondrial localization and release of rat liver superoxide dismutase. FEBS Lett. 55:84–87. Park, J. H., and I. H. Kim. 2014. Supplemental effect of probiotic Bacillus subtilis B2A on productivity, organ weight, intestinal salmonella microflora, and breast meat quality of growing broiler chicks. Poult. Sci. 93:2054–2059. Patterson, J. A., and K. M. Burkholder. 2003. Application of prebiotics and probiotics in poultry production. Poult. Sci. 82:627–631. Paturi, G., M. Phillips, M. Jones, and K. Kailasapathy. 2007. Immune enhancing effects of Lactobacillus acidophilus LAFTI L10 and Lactobacillus paracasei LAFTI L26 in mice. Int. J. Food Microbiol. 115:115–118. Perdigon, G., S. Alvarez, M. Rachid, G. Ag¨ uero, and N. Gobbato. 1995. Immune system stimulation by probiotics. J. Dairy Sci. 78:1597–1606.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018

10

BAI ET AL.

Placer, Z. A., L. L. Cushman, and B. C. Johnson. 1966. Estimation of product of lipid peroxidation (malonyl dialdehyde) in biochemical systems. Anal. Biochem. 16:359–364. Rajput, I. R., Y. L. Li, X. Xu, Y. Huang, W. C. Zhi, D. Y. Yu, and W. F. Li. 2013. Supplementary effects of Saccharomyces boulardii and Bacillus subtilis B10 on digestive enzyme activities, antioxidation capacity and blood homeostasis in broiler. Int. J. Agric. Biol. 15:1560–8530. Salami, S. A., M. A. Majoka, S. Saha, A. Garber, and J. F. Gabarrou. 2015. Efficacy of dietary antioxidants on broiler oxidative stress, performance and meat quality: science and market. Avian Biol. Res. 8:65–78. Samanya, M., and K. E. Yamauchi. 2002. Histological alterations of intestinal villi in chickens fed dried Bacillus subtilis var. natto. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology. 133:95–104. Sanders, M. E. 1993. Summary of conclusions from a consensus panel of experts on health attributes of lactic cultures: significance to fluid milk products containing cultures. J. Dairy Sci. 76:1819– 1828. Tabassum, H., S. Parvez, S. T. Pasha, B. D. Banerjee, and S. Raisuddin. 2010. Protective effect of lipoic acid against methotrexateinduced oxidative stress in liver mitochondria. Food Chem. Toxicol. 48:1973–1979. Tabidi, M. H., A. M. Mukhtar, and H. I. Mohammed. 2013. Effects of probiotic and antibiotic on performance and growth

attributes of broiler chicks. Glob. J. Med. Plant Res. 1:136– 142. Tang, X., G. Jing, Y. Wang, Y. M. Fan, L. Z. Xu, X. N. Zhao, X. Qiang, and M. Q. Zhong, 2006. Effective protection of Terminalia catappa L. leaves from damage induced by carbon tetrachloride in liver mitochondria. J. Nutr. Biochem. 17:177–182. Van, R. H., Y. Ikeno, M. Hamilton, M. Pahlavani, N. Wolf, and S. R. Thorpe. 2004. Life-long reduction in mnsod activity results in increased dna damage and higher incidence of cancer but does not accelerate aging. Physiol. Genomics. 16:29–37. Wei, Q. Y., W. F. Chen, B. Zhou, L. Yang, and Z. L. Liu. 2006. Inhibition of lipid peroxidation and protein oxidation in rat liver mitochondria by curcumin and its analogues. Biochim. Biophys. Acta. 1760:70–77. Yang, C. M., G. T. Cao, P. R. Ferket, T. T. Liu, L. Zhou, L. Zhang, Y. P. Xiao, and A. G. Chen. 2012. Effects of probiotic, clostridium butyricum, on growth performance, immune function, and cecal microflora in broiler chickens. Poult. Sci. 91:2121–2129. Zhang, Z. F. 2014. Effects of multistrain probiotics on growth performance, apparent ileal nutrient digestibility, blood characteristics, cecal microbial shedding, and excreta odor contents in broilers. Poult. Sci. 93:364–370. Zhang, Z. F., T. X. Zhou, X. Ao, and I. H. Kim. 2012. Effects of β -glucan and Bacillus subtilis on growth performance, blood profiles, relative organ weight and meat quality in broilers fed maize– soybean meal based diets. Livestock Science. 150:419–424.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey116/4967663 by University of Pennsylvania Libraries user on 15 April 2018