Dietary effects of Bacillus subtilis fmbj on the antioxidant capacity of broilers at an early age

Dietary effects of Bacillus subtilis fmbj on the antioxidant capacity of broilers at an early age Lili Zhang, Kaiwen Bai, Jingfei Zhang, Wen Xu, Qiang Huang, and Tian Wang1 College of Animal Science and Technology, Nanjing Agricultural University, No. 6, Tongwei Road, Xuanwu District, Nanjing 210095, People’s Republic of China ABSTRACT This study was designed to evaluate the usage of Bacillus subtilis fmbj (BS fmbj) in broiler diets, and its effects on the antioxidant capacity of broilers at an early age. A total of 240 day-old male Arbor Acres (AA) broilers were randomly assigned to 4 groups, namely the control (CON) group (fed basal diets with 0 cfu/kg BS fmbj), the BS-1 group (fed basal diet with 0.2 × 1011 cfu/kg BS fmbj), BS2 group (fed basal diet with 0.3 × 1011 cfu/kg BS fmbj), and BS-3 group (fed basal diet with 0.4 × 1011 cfu/kg BS fmbj). No differences were found in the average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) among the different treatments at 21 d. The BS groups showed lower (P < 0.05) levels of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) than that in the CON group at 21 d of growth. The dietary BS fmbj increased (P < 0.05) the antioxidant activity in the serum, liver, and hepatic mitochondria, but decreased (P < 0.05)

the serum and hepatic malondialdehyde (MDA) levels compared to those in the CON group at 21 d of feeding. The BS groups showed lower (P < 0.05) level of hepatic mitochondrial reactive oxygen species (ROS), protein carbonyls (PC), and 8-hydroxy-2deoxyguanosine (8-OHdG); however, in this group, higher (P < 0.05) levels of mitochondrial membrane potential (MMP), adenosine triphosphate (ATP), and mitochondria DNA (mtDNA) were determined compared to those in the birds of the CON group at 21 d. The BS group showed increased (P < 0.05) levels of antioxidant related-gene expression in the liver and hepatic mitochondria compared to that in the CON group. In conclusion, BS fmbj (0.3 g/kg in broiler diets) has the potential to improve the antioxidant status of the body as well as the hepatic mitochondrial function and thus, appears to be an important additive for both the consumer and the industry.

Key words: broiler, BS fmbj, hepatic mitochondria, antioxidant status 2017 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pex172

INTRODUCTION

farming aimed at high yields of chicken, which imposes oxidative stress (Salami et al., 2015). The adverse effects of dietary antibiotics have encouraged the use of alternative feed additives, such as probiotics, to improve the animal performance (Fuller, 1989; Latorre et al., 2014). Probiotics are defined as “live microorganisms, which when administered in adequate amounts, confer health benefits on the host”; they exert positive effects on the productivity, immune system (Tarasenko et al., 2008), and antioxidant status of the broilers (Lee et al., 2014). Among the various kinds of probiotics, Bacillus species, including B. subtilis, B. cereus, and B. clausii, have been widely used as direct-fed microbial additives in animals and humans (Zhang et al., 2013a; Park and Kim, 2014; Latorre et al., 2015) for their capacity to sporulate under extreme environments (Griggs and Jacob, 2015). It has been demonstrated that dietary probiotics are beneficial in poultry feeding because of their capacity for improving oxidative damage (Dalloul et al., 2003). This study was conducted to evaluate the dietary effects of BS fmbj on growth performance and in

Oxidative stress is induced by an imbalance in the redox homeostasis and is always accompanied by the excess generation of reactive oxygen species (ROS) (Nath and Sarma, 2010). In brief, when ROS overwhelms the antioxidant defense system in the body, either by increasing the level of oxidative injury or by decreasing the antioxidant capacity of the body, it results in oxidative stress (Ray et al., 2012). Oxidative stress usually results in damage to nucleic acids, proteins, and lipids of living organisms (Kalam et al., 2011), and has been implicated in many diseases (Klaunig and Kamendulis, 1998; Grune, 2000; Giacco and Brownlee, 2010). Broilers are prone to oxidative stress under certain unsuitable physiological and environmental conditions, especially with the development of modern intensive  C 2017 Poultry Science Association Inc. Received January 12, 2017. Accepted June 12, 2017. 1 Corresponding author: [email protected]

1

2

ZHANG ET AL.

improving the serum and hepatic antioxidant capacity of broilers at an early age.

ples according to the method of Willemsen et al. (2010), using commercial diagnostic kits (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China).

MATERIALS AND METHODS Animals and Diets Bacillus subtilis fmbj (CGMCCN 0943, Heng Zeyuan Biological Technology Co., Ltd, Wuxi, People’s Republic of China) used in this study was a wild-type strain originally isolated and characterized at the College of Food Science and Technology, Nanjing Agricultural University. The product used in our study was determined to contain at least 1.0 × 1011 cfu/g of BS fmbj. A total of 240 day-old male Arbor Acres (AA) broilers were obtained from a local commercial hatchery (Kangxin Poultry Co, Nanjing, People’s Republic of China) and were randomly assigned to 4 treatments. Each treatment had 6 replicates of 10 birds. The treatment groups were fed the basal diets with BS fmbj, without antibiotics, for 21 d as follows: control group (CON), 0 cfu/kg; experimental group 1 (BS-1), 0.2 × 1011 cfu/kg; experimental group 2 (BS-2), 0.3 × 1011 cfu/kg; and experimental group 3 (BS-3), 0.4 × 1011 cfu/kg (BS-3). The basal diet was formulated to meet or exceed the nutritional requirements of broilers according to the NRC, 1994. All broilers were raised in an environmentally controlled room (34 to 36◦ C) for 1 to 14 d; the temperature of the room was gradually decreased to 26◦ C at the end of the experiment. All the broilers were kept under continuous lighting, and were allowed access to food and water ad libitum. They were handled in accordance with the guidelines of the Animal Care and Use Committee, Nanjing Agriculture University, Nanjing, People’s Republic of China. The body weights of the broilers were measured at 1, 15, and 21 d of age, and the feed intake was recorded at 15 and 21 d of age in 6 replicates, for calculating the average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR).

Sample Collection At 21 d of age, one bird with a body weight close to the mean body weight was chosen from each replicate. The blood from the jugular vein was individually collected in a 10-mL tube, and centrifuged at 2200 × g for 15 min at 4◦ C, and the serum was stored at −20◦ C for further study. After the collection of blood from the broilers sacrificed by cervical dislocation, liver samples were obtained.

Serum ALT and AST Assay The levels of serum alanine aminotransferase (ALT, No. C009) and serum aspartate aminotransferase (AST, No. C010) were determined from triplicate sam-

Activities of Antioxidant Enzymes At 21 d, 1 g of chicken liver was homogenized at 6800 × g for 10 s in 9 mL of 0.9% sodium chloride solution on ice; the homogenate was centrifuged at 2800 × g for 15 min at 4◦ C. The supernatant and serum were individually used to measure the activities of superoxide dismutase (SOD, No. A001), peroxidase (POD, No. A084), catalase (CAT, No. A007), glutathione (GSH, No. A005), glutathione reductase (GR, No. A062), and glutathione peroxidase (GSH-Px, No. A005) according to the method of Placer et al. (1966); Panckenko et al. (1975); Lawrence and Burk (1976); Abei (1984) using commercial diagnostic kits, as per the respective protocols provided by the manufacturer (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China). All assays were conducted in triplicate.

Lipid Peroxidation Assay Lipid peroxidation, expressed as malondialdehyde concentration, was determined using a malondialdehyde (MDA, No. A003) assay kit (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China). Briefly, the serum and hepatic supernatants were used to calculate the MDA levels by the thiobarbituric acid (TBA) method (Botsoglou et al., 1994). The amount of MDA– TBA complex formed during the reaction of MDA in serum and liver with TBA was determined by measuring the absorbance at 535 nm (UV-2401 PC, Shimadzu, Japan). All assays were conducted in triplicate.

Isolation of Chicken Hepatic Mitochondria The chicken hepatic mitochondria were isolated according to the method described by Tang et al. (2006). In brief, the liver was homogenized in ice-chilled Dounce homogenizer (1:10, w/v) using the isolation buffer containing 10 mM 3-(N-morpholino)propanesulfonic acid (MOPS) pH 7.4, 250 mM sucrose, 5 mM KH2 PO4 , 2 mM MgCl2 , 1 mM ethylene glycol-bis(β -aminoethyl ether)-N, N, N, N-tetraacetic acid (EGTA), and 0.1% fatty acid-free bovine serum albumin (BSA), and then centrifuged at 1000 × g for 5 min at 4◦ C. The supernatant was removed and the mitochondria-enriched pellets were resuspended gently, and washed with the isolation buffer. Thereafter, the mitochondria were precipitated into a pellet by centrifugation at 12,000 × g for 5 min. The mitochondria were lysed, and the protein was estimated using Micro BCA protein assay kit (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China).

B. SUBTILIS IMPROVES BROILER PERFORMANCE

Assays for Antioxidant Enzyme Activities in the Chicken Liver Mitochondria The activities of manganese superoxide dismutase (MnSOD, No. A001–2), γ -glutamylcysteine ligase (γ -GCL, No. A120), GSH, glutathione peroxidase (GPx, No. A005), GR, glutathione S-transferase (GST, No. A004), and the concentration of proteins in the chicken hepatic mitochondria were determined according to the method of Lowry et al. (1951); Lawrence and Burk, (1976); Van et al. (2004); Langston et al. (2011) in triplicate using the commercially available diagnostic kits, as per the prescribed protocols (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China).

ROS, Protein Oxidation, and 8-hydroxy-2-deoxyguanosine Assays The concentration of ROS in the chicken liver was determined using an ROS assay kit (No. E004, Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China). Briefly, the hepatic mitochondria were incubated with dichlorofluorescein diacetate (DCFH-DA, 10 μM) and with the DNA stain Hoechst 33,342 (10 mmol/L) for 30 min at 37◦ C. Thereafter, the fluorescence of DCFH in the mitochondria was measured at an emission wavelength of 530 nm and an excitation wavelength of 485 nm with a FLX 800 microplate fluorescence reader (Biotech Instruments Inc., USA). The results were expressed as the mean DCFH-DA fluorescence intensity over that of the control. The protein oxidation in the chicken hepatic mitochondria was calculated using the concentration of the protein carbonyls, which was measured using a previously described method (Wei et al., 2006), and was expressed as nmol/mg protein. The content of 8-hydroxy-2-deoxyguanosine (8-OHdG) in the chicken liver was measured using an ELISA kit (No. H165, Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China), and was expressed as ng/mg protein. All assays were conducted in triplicate.

Assay for the Mitochondrial Membrane Potential The changes in the mitochondrial membrane potential (MMP) in the chicken hepatic mitochondria were detected using an MMP assay kit (No. H146, Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China). In brief, the hepatic mitochondria were loaded with 1X JC-1 dye at 37◦ C for 20 min, and then analyzed, after washing, by flow cytometry (FACS Aria III, BD, New Jersey, US). The MMP was calculated as the increase in ratio of green and red fluorescence. When the MMP levels are low, JC-1 exists mainly as a monomer, which emits green fluorescence (excitation wavelength of 490 nm and emission wavelength of 540 nm). However, when the MMP levels are high, JC-1 exists mainly as a polymer, which emits red fluorescence (excita-

3

tion wavelength of 525 nm and emission wavelength of 590 nm). The results were calculated in triplicate as the ratio of the fluorescence of aggregates (red) to that of the monomers (green).

Assay for ATP Concentration The concentration of adenosine triphosphate (ATP) in the chicken liver was determined according to the method described by Liu et al. (2006). In brief, the chicken liver was ground in physiological saline on ice. Thereafter, 0.5 mL tissue homogenate was mixed with 0.1 mL HClO4 , vortexed, and centrifuged at 10,000 × g for 10 min at 4◦ C. The supernatant was collected and its pH was adjusted to 7 with potassium hydroxide solution (1 mol/L). After microfiltration through a membrane filter, 20 μL of this supernatant was used for HPLC analysis. The chromatography was performed on an Agilent 1100 liquid chromatograph equipped with an Agilent Eclipse-XDB C18 column (4.6 mm × 250 mm, 5 μm), the temperature of which was set at 25◦ C. The mobile phase used was phosphate buffer (0.1 mol/L, pH = 6.25). The injection volume was 20 μL and the detection wavelength was 254 nm. The assays were conducted in triplicate.

mtDNA Copy Number Assay The copy number of mitochondria DNA (mtDNA) in the chicken liver was determined using real-time fluorescence quantitative PCR kit (Tli RNaseH Plus). In brief, 20 μL of PCR mixture consisted of 10 μL of SYBR Premix Ex Taq (2X), 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of ROX dye (50X), 6.8 μL of ultrapure water, and 2 μL of cDNA template. The sequence of the MtD-loop gene upstream primer was 5 -AGGACTACGGCTTGAAAAGC 3 , whereas sequence of the downstream primer was 5 -CATCTTGGCATCTTCAGTGCC-3 ; the length of the target fragment was 198 bp. The sequence of the β -actin upstream primer was 5 -TTCTTGGGTATGGAGTCCTG-3 and that of the downstream primer was 5 TAGAAGCATTTGCGGTGG-3 ; the length of the target fragment was 150 bp. The amplification for each chicken liver sample was performed in triplicate. The fold-expression of each gene was calculated according to the 2 −ΔΔCt method (Liu et al., 2012), in which β -actin was used as an internal standard.

Quantitative Real-time PCR Total RNA extracted from the chicken liver using Trizol Reagent (TaKaRa, Dalian, China) was reversetranscribed using a commercial kit (Perfect Real Time, SYBR PrimeScript TaKaRa, China). The mRNA expression levels of the specific genes were quantified by real-time polymerase chain reaction (PCR), using

4

ZHANG ET AL.

Table 1. Primer sequences used for real-time PCR assay. Name

1

Nrf2 HO-1 Cu/ZnSOD MnSOD CAT γ -GCLc γ -GCLm

GPx Trx2 Trx-R2 Prx3

Sequence (5 →3 )2 GATGTCACCCTGCCCTTAG CTGCCACCATGTTATTCC GGTCCCGAATGAATGCCCTTG ACCGTTCTCCTGGCTCTTGG CCGGCTTGTCTGATGGAGAT TGCATCTTTTGGTCCACCGT AGGAGGGGAGCCTAAAGGAGA CCAGCAATGGAATGAGACCTG GGTTCGGTGGGGTTGTCTTT CACCAGTGGTCAAGGCATCT TGCGGTTCTGCACAAAATGG TGCTGTGCGATGAATTCCCT CCAGAACGTCAAAGCACACG TCCTCCCATCCCCCAGAAAT GACCAACCCGCAGTACATCA GAGGTGCGGGCTTTCCTTTA AGTACGAGGTGTCAGCAGTG CACACGTTGTGAGCAGGAAG CCGGGTCCCTGACATCAAA TAGCTTCGCTGGCATCAACA ACCTCGTGCTCTTCTTCTACC ACCACCTCGCAGTTCACATC

Table 2. Dietary effects of Bacillus subtilis fmbj in diets on growth performance of Arbor Acres broiler chickens at 21 d.1

Genbank3 Treatment3

NM 205,117.1 Item2 HM237181.1 NM 205,064.1 NM 204,211.1 NM 0,010,31215.1 XM 419,910.3 NM 0,010,07953.1 NM 0,012,77853.1 NM 0,010,31410.1

1 to 15 d ADG, g/bird ADFI, g/bird FCR, g/g 16 to 21 d ADG, g/bird ADFI, g/bird FCR, g/g

CON

BS-1

BS-2

BS-3

16.35 ± 0.38 16.50 ± 0.40 17.36 ± 0.33 16.65 ± 0.37 23.70 ± 0.25 25.68 ± 0.28 25.47 ± 0.23 26.72 ± 0.24 1.45 ± 0.02 1.56 ± 0.03 1.47 ± 0.03 1.60 ± 0.05 66.19 ± 1.00 65.54 ± 1.01 62.69 ± 0.94 65.75 ± 0.98 96.47 ± 1.03 94.73 ± 1.07 89.97 ± 0.99 96.10 ± 1.01 1.46 ± 0.03 1.45 ± 0.02 1.44 ± 0.03 1.46 ± 0.04

1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). 2 Average daily gain (ADG); average daily feed intake (ADFI); feed conversion ratio (FCR). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

NM 0,011,22691.1 XM 0,049,42320.1

1 Nuclear factor erythroid 2-related factor 2 (Nrf2); heme oxygenase 1 (HO-1); copper and zinc superoxide dismutase (Cu/ZnSOD); manganese superoxide dismutase (MnSOD); catalase (CAT); γ -glutamylcysteine ligase c (γ -GCLc); γ -glutamylcysteine ligase m (γ -GCLm); glutathione peroxidase (Gpx); thioredoxin 2 (Trx2); thioredoxin reductase 2 (Trx-R2); peroxiredoxin 3 (Prx3). 2 Shown as forward primer followed by reverse primer. 3 GenBank Accession Number.

SYBR Premix Ex Taq II (Tli RNaseH Plus) in an ABI 7300 Fast Real-Time PCR detection system (Applied Biosystems, USA). The SYBR Green PCR mixture consisted of 10 μL SYBR Premix Ex Taq (2X), 0.4 μL of the forward and reverse primers, 0.4 μL of ROX reference dye (50X), 6.8 μL of ddH2 O, and 2 μL of the cDNA template. The amplification for each chicken liver was performed in triplicate, and the fold-expression of each gene was calculated according to the 2−ΔΔCt method (Liu et al., 2012), in which β -actin was used as an internal standard. The primer sequences used are given in Table 1.

Statistical Analyses All the data were statistically analyzed by one-way analysis of variance (ANOVA) procedure of Statistical Analysis System (SAS Institute Inc., Cary, NC). This was followed by the Tukey’s test when significant differences were found (P < 0.05). The significance was defined as P < 0.05. The data were expressed as means ± SEM.

RESULTS The results of the growth performance of broilers revealed that there were no differences (P > 0.05) in the ADG, ADFI, and FCR among the different treatments at 21 d of feeding (Table 2). The dietary BS fmbj decreased (P < 0.05) the serum ALT and AST levels

Table 3. Dietary effects of Bacillus subtilis fmbj in diets on serum ALT and AST concentration of Arbor Acres broiler chickens at 21 d.1 Treatment3 Item2

CON

BS-1

BS-2

BS-3

ALT, U/L 5.20 ± 0.50a 3.34 ± 0.33b 2.94 ± 0.19b 3.15 ± 0.30b AST, U/L 22.59 ± 0.60a 19.54 ± 0.59b 15.99 ± 0.51b 17.71 ± 0.47b 1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). The assays were conducted in triplicate. 2 Alanine aminotransferase (ALT); aspartate aminotransferase (AST). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

with respect to their levels in the CON group at 21 d (Table 3). There were no significant differences among the BS groups on the serum ALT and AST levels. The dietary BS fmbj improved (P < 0.05) the serum (Table 4) and hepatic (Table 5) antioxidant capacity (SOD, POD, CAT, GSH, GR, GSH-Px, and MDA), and hepatic mitochondrial (Table 6) antioxidant capacity (MnSOD, γ -GCL, GSH, GR, GPx, and GST) with respect to the values for these parameters in the CON group at 21 d. The supplementation 0.3 g/kg BS fmbj in the broiler diets increased (P < 0.05) the serum POD, GSH, and GSH-Px activities and hepatic SOD, POD, and GSH-Px activities compared to the respective activities in the BS-1 and BS-2 groups at 21 d of growth. There were no significant differences among the BS groups on the serum SOD, CAT, GR, and MDA levels, and on the hepatic CAT, GSH, GR, and MDA levels, as well as on the hepatic mitochondrial antioxidant capacity. As evident from Table 7, the dietary BS fmbj decreased (P < 0.05) the ROS, PC, and 8-OHdG levels at 21 d of feeding, whereas the values of MMP, ATP, mtDNA, and ATP/mtDNA were increased (P < 0.05)

5

B. SUBTILIS IMPROVES BROILER PERFORMANCE Table 4. Dietary effects of Bacillus subtilis fmbj in diets on serum antioxidant capacity of Arbor Acres broiler chickens at 21 d.1 Treatment3 Item2 SOD, U/mL POD, U/mL CAT, U/mL GSH, μ mol/L GR, U/L GSH-Px, U/mL MDA, nmol/mL

CON 10.42 6.93 3.64 6.36 23.31 191.88 7.87

± ± ± ± ± ± ±

BS-1

0.88b 0.76c 0.35b 0.59c 0.71b 2.32c 0.73a

12.82 7.90 4.64 7.45 26.13 215.27 7.47

± ± ± ± ± ± ±

BS-2

0.79a 0.71b 0.41a 0.62b 1.01a 2.71b 0.79b

13.08 8.25 5.00 9.09 28.05 244.28 7.46

± ± ± ± ± ± ±

BS-3

0.91a 0.73a 0.44a 0.7a 0.97a 2.73a 0.63b

12.83 7.62 4.46 7.36 27.33 215.40 7.58

± ± ± ± ± ± ±

0.95a 0.77b 0.51a 0.60b 1.02a 2.65b 0.79b

1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). The assays were conducted in triplicate. 2 Superoxide dismutase (SOD); peroxidase (POD); catalase (CAT); glutathione (GSH); glutathione reductase (GR); glutathione peroxidase (GSH-Px); malondialdehyde (MDA). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

Table 5. Dietary effects of Bacillus subtilis fmbj in diets on hepatic antioxidant capacity of Arbor Acres broiler chickens at 21 d.1 Treatment3 Item2 SOD, U/g protein POD, U/mg protein CAT, U/g protein GSH, μ mol/g protein GR, U/g protein GSH-Px, U/g protein MDA, nmol/mg protein

CON 22.63 1.03 15.21 15.90 5.43 15.78 1.22

± ± ± ± ± ± ±

0.85c 0.09c 0.60b 0.56b 0.59b 0.58c 0.10a

BS-1 23.80 1.12 18.30 30.00 10.11 18.42 1.12

± ± ± ± ± ± ±

BS-2

0.73b 0.08b 0.71a 0.78a 0.61a 0.67b 0.10b

26.94 1.25 19.44 34.79 15.04 22.59 1.02

± ± ± ± ± ± ±

0.80a 0.10a 0.77a 0.71a 0.84a 0.73a 0.98b

BS-3 23.79 1.17 18.38 29.73 12.29 19.06 1.06

± ± ± ± ± ± ±

0.79b 0.09b 0.70a 0.63a 0.77a 0.60b 0.11b

1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). The assays were conducted in triplicate. 2 Superoxide dismutase (SOD); peroxidase (POD); catalase (CAT); glutathione (GSH); glutathione reductase (GR); glutathione peroxidase (GSH-Px); malondialdehyde (MDA). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

Table 6. Dietary effects of Bacillus subtilis fmbj in diets on hepatic mitochondrial antioxidant capacity of Arbor Acres broiler chickens at 21 d.1 Treatment3 Item2 MnSOD, U/mg protein γ -GCL, U/mg protein GSH, μ g/g protein GR, U/mg protein GPx, U/mg protein GST, U/mg protein

CON 48.20 0.21 0.67 0.22 9.58 4.55

± ± ± ± ± ±

1.06b 0.03b 0.03b 0.01b 0.11b 0.10b

BS-1 52.11 0.39 0.70 0.27 10.49 4.98

± ± ± ± ± ±

1.30a 0.02a 0.03a 0.01ab 0.15a 0.11a

BS-2 56.77 0.46 0.88 0.42 11.05 5.59

± ± ± ± ± ±

1.22a 0.03a 0.06a 0.01a 0.13a 0.12a

BS-3 54.67 0.42 0.79 0.38 10.66 5.29

± ± ± ± ± ±

1.35a 0.03a 0.04a 0.01a 0.11a 0.10a

1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). The assays were conducted in triplicate. 2 Manganese superoxide dismutase (MnSOD); γ -glutamylcysteine ligase (γ -GCL); glutathione (GSH); glutathione reductase (GR); glutathione peroxidase (GPx); glutathione S-transferases (GST). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

in the hepatic mitochondria compared to the respective values in the CON group at 21 d. There were no significant differences in the levels of oxidative damage among the BS groups. The dietary BS fmbj improved (P < 0.05) the antioxidant enzyme related-gene expression in the liver (Nrf2,

HO-1, Cu/ZnSOD, CAT, γ -GCLc, γ -GCLm, and GPx) and in the hepatic mitochondria (Trx2, Trx-R2, Prx3, and MnSOD) compared to the expression of these proteins in the CON group at 21 d (Table 8). There were no significant differences in the expression levels of the related genes among the BS groups.

6

ZHANG ET AL. Table 7. Dietary effects of Bacillus subtilis fmbj in diets on oxidative damage index of Arbor Acres broiler chickens at 21 d.1 Treatment3 Item2

CON

ROS, % over control PC, nmol/mg protein 8-OHdG, ng/mg protein MMP, % over control ATP, % over control mtDNA, % over control ATP/mtDNA, % over control

100.00 28.90 0.19 100.00 100.00 100.00 1.00

± ± ± ± ± ± ±

BS-1

2.25a 0.65a 0.03a 2.19b 2.35b 2.15b 0.03b

94.00 25.00 0.16 106.00 117.00 107.00 1.09

± ± ± ± ± ± ±

2.33b 0.33b 0.02b 2.24a 2.13a 2.23a 0.02a

BS-2 90.00 22.00 0.14 111.00 126.00 110.00 1.15

± ± ± ± ± ± ±

2.19b 0.78b 0.03b 2.08a 2.09a 2.19a 0.01a

BS-3 92.00 23.00 0.15 108.00 119.00 108.00 1.10

± ± ± ± ± ± ±

2.30b 0.64b 0.02b 2.22a 2.23a 2.36a 0.02a

1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). The assays were conducted in triplicate. 2 Reactive oxygen species (ROS); protein carbonyls (PC); 8-hydroxy-2- deoxyguanosine (8-OHdG); mitochondrial membrane potential (MMP); adenosine triphosphate (ATP); mitochondria DNA (mtDNA). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

Table 8. Dietary effects of Bacillus subtilis fmbj in diets on gene expression level of Arbor Acres broiler chickens at 21 d.1 Treatment3 Item2

CON

Nrf2 HO1 Cu/ZnSOD CAT γ -GCLc γ -GCLm Gpx Trx2 Trx R2 Prx3 MnSOD

100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00

± ± ± ± ± ± ± ± ± ± ±

1.61b 1.44b 3.40b 1.17b 1.02b 0.93b 1.09b 2.07b 1.79b 0.93b 2.35b

BS-1 107.00 112.00 111.00 108.00 105.00 104.00 117.00 106.00 108.00 103.00 114.00

± ± ± ± ± ± ± ± ± ± ±

BS-2

0.86a 3.29a 2.74a 1.22a 0.92a 0.65a 1.43a 0.88a 0.89a 1.02a 0.86a

111.00 119.00 115.00 115.00 110.00 109.00 125.00 109.00 111.00 109.00 121.00

± ± ± ± ± ± ± ± ± ± ±

0.64a 3.15a 1.86a 1.14a 1.28a 1.06a 1.89a 1.48a 2.74a 1.23a 2.62a

BS-3 109.00 115.00 113.00 111.00 107.00 106.00 120.00 105.00 109.00 106.00 118.00

± ± ± ± ± ± ± ± ± ± ±

0.66a 3.41a 2.18a 1.02a 2.05a 1.10a 1.86a 0.93a 2.62a 0.58a 1.03a

1 Data are expressed as mean ± SEM, n = 6. Values in the same row with different superscripts were significantly different (P < 0.05). The assays were conducted in triplicate. 2 Nuclear factor erythroid 2-related factor 2 (Nrf2); heme oxygenase 1 (HO-1); copper and zinc superoxide dismutase (Cu/ZnSOD); catalase (CAT); γ -glutamylcysteine ligase c (γ -GCLc); γ -glutamylcysteine ligase m (γ -GCLm); glutathione peroxidase (Gpx); thioredoxin 2 (Trx2); thioredoxin reductase 2 (Trx-R2); peroxiredoxin 3 (Prx3); manganese superoxide dismutase (MnSOD). 3 CON, birds fed the basal diet without BS fmbj and antibiotics; BS-1, birds fed the basal diet with 0.2 × 1011 cfu/kg BS fmbj without antibiotics; BS-2, birds fed the basal diet with 0.3 × 1011 cfu/kg BS fmbj without antibiotics; BS-3, birds fed the basal diet with 0.4 × 1011 cfu/kg BS fmbj without antibiotics.

DISCUSSION The prohibition of using antibiotics in the poultry industry encouraged us to find new alternative additives, especially natural products, which are non-toxic and safe for consumers. In our previous study, the use of BS fmbj in broiler diets was speculated to have no negative side effects (Bai et al., 2017). Several studies have reported that dietary Bacillus could improve the growth performance of broilers during 21 d of feeding (Salim et al., 2013; Ahmed, 2014; Park and Kim, 2014). However, in agreement with our present results, it has been reported that there was no significant difference in growth performance between a group fed multi-strain probiotic preparation and a control group, during 21 d of growth (Zhang, 2014). Another study also indicated that addition of B. subtilis natto in the broiler diets did not result in any significant difference in the growth

performance of broilers after 28 d of feeding (Samanya and Yamauchi, 2002). The different results could be due to several factors, including the dose of Bacillus species, the age of animals, composition of diet, and the form of the feed. Liver is crucial in metabolizing different compounds, and ALT and AST are essential enzymes in such metabolic processes. Upon exposure to oxidative stress, ALT and AST are released into the blood (Tang et al., 2012). Thus, the increasing levels of serum ALT and AST could be considered as toxicity markers of hepatic injury (Ramesh et al., 2012). It was reported that the hepatic damage induced by CCl4 resulted in a significant increase in the serum ALT and AST levels (Zhang et al., 2013b). Few studies have focused on the dietary effects of probiotics on serum ALT and AST levels. In the present study, the levels of these enzymes in the BS group was significantly lower than those in

B. SUBTILIS IMPROVES BROILER PERFORMANCE

the CON group, which is suggestive of a lower oxidative injury in the liver of broilers when dietary BS fmbj was provided. However, further studies are required to draw any conclusions from these results. Broilers are susceptible to oxidative stress under certain unsuitable physiological and environmental conditions, especially with the development of modern intensive farming aimed at high yields of chicken, which results in oxidative stress. During the starter period of broilers, they can produce free radicals through enzymatic and non-enzymatic systems, which finally results in oxidative stress along with the reduction in the antioxidant capacity. The normal development of cells requires a balance between the production of ROS and the protective capacity of the anti-oxidant systems. The levels of oxidation and antioxidants also act as indicators of whether the body is subjected to oxidative stress (Alpsoy et al., 2009; Kotan et al., 2011). The antioxidant defense system suppresses the levels of oxidative damage indices (MDA, ROS, PC, and 8-OHdG) that are essentially increased under oxidative stress. The antioxidant enzymes (SOD, POD, CAT, GSH, GR, and GSH-Px) appear to be the first line of defense during oxidative stress, and exert beneficial effects in preventing the oxidative damage. The SOD enzyme promotes generation of O2 and H2 O2 from O2− , which, in turn, are decomposed to H2 O by CAT and GSH-Px, thus inhibiting the formation of OH− . The activity of POD is related to the metabolism of phenols, and plays an important role in the anti-oxidative mechanism. The CAT enzyme is a major antioxidant enzyme that protects the body from oxidative stress. Three antioxidants, namely GSH, GR, and GSH-Px, are crucial in eliminating the free radicals and in protecting against lipid peroxidation. It has been reported that dietary B. subtilis improves the performance of the body by improving its antioxidant capacity (La Ragione and Mj, 2003; Lee et al., 2014). In the present study, we found that hepatic mitochondrial antioxidant activities (MnSOD, γ -GCL, GSH, GR, GPx, and GST) of broilers were increased by supplementation of BS fmbj in the diets. The intracellular superoxide dismutase is mainly composed of Cu/ZnSOD and MnSOD. The Cu/ZnSOD is concentrated in the cytoplasm, and MnSOD is an isoform of superoxide dismutase unique to mitochondria. The γ -GCL enzyme is the major rate-limiting enzyme in the synthesis of γ -glutamylcysteine. The GPx enzyme is important in the oxidation of GSH in the metabolic pathway of GSH. In this process, the peroxides, such as hydrogen peroxide, are ultimately converted to nonoxidative, toxic, or more stable free radical metabolites. The main function of GST is to catalyze the conjugation between the intracellular GSH and electrophilic substances, and this accelerates the rate of removal of toxic metabolites and active free radicals. It has been indicated that the MnSOD and GSH activities in the hepatic mitochondria of animals treated with lipoic acid were significantly higher than that in the CON group (Tabassum et al., 2010). Thus, MnSOD might play an

7

important role in the mitochondrial antioxidant defense system. Although very few studies have focused on the dietary effects of probiotics on the hepatic mitochondrial antioxidant capacity, it has been reported that probiotics are beneficial to animal health because they suppress the oxidative stress and increase the antioxidant capacity of animals (Takahashi et al., 2004; Bai et al., 2017). In another study, it was found that B. subtilis, which is well known for its resistance to harsh environments, was beneficial in improving the antioxidant capacity of animals (Rajput et al., 2013). The above results indicate that the dietary BS fmbj could enhance the antioxidant ability with respect to that in the CON group. One possible mechanism leading to oxidative stress is the disruption of redox status (Ravikumar et al., 2005). MDA is the main degradation product of lipid peroxidation, which is associated with the oxidative damage in the body (Lin et al., 2010). Reactive oxygen species is one of the products in mitochondrial oxidative phosphorylation reaction, and can react with a variety of cellular components, including nucleic acids, lipids, proteins, amino acids, and carbohydrates. Once the levels of ROS increase beyond the capability of the antioxidant system to counter them, oxidative stress is induced, which results in altered gene expression, lipid peroxidation, enzyme inactivation, and DNA base modification and strand scission (Stohs et al., 1990). Oxidative damage of DNA can disrupt transcription, translation, and replication, which results in mutations or cell death, and even alters the gene expression through non-genotoxic signaling mechanism (Winn and Wells, 1997; Upham and Wagner, 2001). These damaged cellular components, in turn, can influence the efficiency of the oxidative phosphorylation reaction in the mitochondria, and generate more ROS. Therefore, ROS is an important indicator of oxidative stress and cell damage in the body (Jones, 2006). The PC assay is essential in studying the oxidative damage of protein, and different species can generate PCs containing free radicals and ROS. Another index of oxidative damage is 8-OHdG, which is also considered to be a factor for diseases (Pilger et al., 2001). Consistent with our results, it has been reported that dietary probiotics were beneficial in the resistance to oxidation, in scavenging the excessive ROS, and in enhancing the antioxidant capability (Capcarova et al., 2010). With regard to the antioxidant ability, the endogenous antioxidant defense system of animals also depends on other external sources, such as probiotics, which act as natural additives for the suppression of the oxidative stress (Rajput et al., 2013). Studies have shown that the use of dietary probiotics is increasing gaining momentum in the poultry industry because they can counteract and minimize the oxidative stress by increasing the antioxidant capacity of the body (Dalloul et al., 2003). The changes in MMP usually act as the start of mitochondria-dependent apoptosis. With the decrease of MMP value, the oxidative phosphorylation of

8

ZHANG ET AL.

mitochondria is uncoupled, and the ROS level is increased along with the consumption of excessive amounts of ATP. This is followed by the release of many substances in the cytoplasm, including cytochrome c, an apoptosis-inducing factor, and it ultimately results in apoptosis (Kowaltowski and Vercesi, 1999). One product of oxidative phosphorylation reaction is ATP, which is responsible for providing the energy required for the physiological response, and is also an important substrate for RNA synthesis. The intracellular ATP level is associated with the mitochondrial function (Zeng et al., 2008). It has been reported that mitochondrial injury was accompanied by the reduction in the intracellular ATP levels (Zhang et al., 2010). Another study indicated that the changes in the ATP levels are not only associated with the energy state of the body, but they also effect the mitochondrial macromolecular biosynthesis; however, the specific mechanism still needs to be elucidated. The mitochondria have their own mtDNA genome that is responsible for the synthesis and regulation of genes that are related to the mitochondrial functions. Mitochondrial dysfunction is induced by the oxidative modification of mtDNA, including the destruction of its integrity, and reduction in the copy number of mtDNA. The copy number of mtDNA is an indicator of oxidative stress, and is related to many diseases. Studies have found that oxidative stress could significantly reduce the copy number of mtDNA, and leads to the damage of mtDNA by altering the reductive environment of cells and mitochondria (Liu et al., 2003). The value of ATP/mtDNA is related to the function of mitochondria with respect to the ATP production capacity per unit of mitochondria (Liu et al., 2003). The higher is the value of ATP/mtDNA, the stronger is the ability of mitochondria to generate ATP and lesser are the damages. It has been found that dietary probiotics could improve the oxidative stress (Deng et al., 2012), and increasing the antioxidant capacity (Sanders, 1993), thus improving the body health (Fuller, 1989). The results mentioned above indicate that dietary BS fmbj could eliminate the excessive free radicals induced by oxidative stress, and improve the mitochondrial function compared to that in the CON group. The activation of Nrf2 nuclear transcription factor and its repressor protein Keap1 is crucial in regulating the expression of the phase II metabolizing enzyme genes, most of which contain the ARE binding elements. Nrf2 could combine with the ARE through this element that regulates the expression of the genes of phase II metabolism (Lee and Johnson, 2004). It has been found that many natural substances are inducers of phase II metabolizing enzymes, and could regulate the metabolism of phase II enzymes by activating the Nrf2-related signaling pathway (Kode et al., 2008). In the current study, in addition to GSH metabolismrelated enzymes, the HO-1, Cu/ZnSOD, MnSOD, CAT, and other antioxidant enzymes of the phase II metabolizing enzymes were also measured. The HO-1 is the lim-

iting enzyme in the decomposition of hemoglobin, and its products containing endogenous carbon monoxide, biliverdin, and ferrous (Fe2+ ) ion (Morse et al., 2009). Biliverdin and bilirubin are the most important endogenous antioxidant that inhibits peroxynitrite-mediated protein oxidation (Chiu et al., 2002). Trx2 is one of proteins with free radical scavenging capacity in the mitochondria, and is an important factor involved in the regulation of mitochondria-dependent apoptotic pathways (Holmgren et al., 2005). Prx3 is another efficient peroxidase used in the scavenging of free radicals in the mitochondria. Trx2, Trx-R2, and Prx3 are rich in mitochondria, and they compose a unique Trx2/Prx3 antioxidant defense system to protect the cells from oxidative stress (Michelet et al., 2006). The expression levels of Trx-R2 are associated with mitochondrial lipid peroxidation and mitochondrial DNA integrity. It has been reported that the increased activity of Trx2/TrxR2 is beneficial in improving the mitochondrial dysfunction induced by excessive free radicals (P´erez et al., 2008). Remarkably, in the present study, we found that dietary BS fmbj could enhance the expression of antioxidant-related genes, leading to the increased activity of antioxidant-related enzymes that might be an important reason for the low level of damage parameters in the broiler chickens. Few studies have been conducted to investigate as to how the dietary probiotics could improve the anti-oxidant capability and reduce the parameters of liver damage; thus, an in-depth study is needed in this regard in the future.

ACKNOWLEDGMENTS The authors gratefully acknowledged the Jiangsu Province Government (China) for its support through the program “Twelve Five” Rural areas research of national science and technology (2013BAD10B03). This study was also supported by the Jiangsu Science and Technology Project (BY2013074–01), and funded by a project of II phase: Priority Academic Program Development of Jiangsu Higher Education Institutions.

REFERENCES Abei, A. 1984. Catalase in vitro. Methods Enzymol. 105:121–126. Ahmed, S. T. 2014. Effects of Bacillus amyloliquefaciens as a probiotic strain on growth performance, cecal microflora, and fecal noxious gas emissions of broiler chickens. Poult. Sci. 93:1963– 1971. Alpsoy, L., A. Yildirim, and G. Agar. 2009. The antioxidant effects of vitamin A, C, and E on aflatoxin B1-induced oxidative stress in human lymphocytes. Toxicol. Ind. Health 25:121–127. Bai, K. W., Q. Huang, J. F. Zhang, J. T. He, L. L. Zhang, and W. Tian. 2017. Supplemental effects of probiotic Bacillus subtilis fmbJ on growth performance, antioxidant capacity, and meat quality of broiler chickens. Poult. Sci. 96:74–82. Botsoglou, N. A., D. J. Fletouris, G. E. Papageorgiou, V. N. Vassilopoulos, A. J. Mantis, and A. G. Trakatellis. 1994. Rapid, sensitive, and specific thiobarbituric acid method for measuring lipid peroxidation in animal tissue, food, and feedstuff samples. J. Agric. Food Chem. 42:1931–1937. Capcarova, M., J. Weiss, C. Hrncar, A. Kolesarova, and G. Pal. 2010. Effect of Lactobacillus fermentum and Enterococcus

B. SUBTILIS IMPROVES BROILER PERFORMANCE faecium strains on internal milieu, antioxidant status and body weight of broiler chickens. J. Anim. Physiol. Anim. Nutr. (Berl.) 94:215–224. Chiu, H., J. A. Brittingham, and D. L. Laskin. 2002. Differential induction of heme oxygenase-1 in macrophages and hepatocytes during acetaminophen-induced hepatotoxicity in the rat: effects of hemin and biliverdin. Toxicol. Appl. Pharmacol. 181: 106–115. Dalloul, R. A., H. S. Lillehoj, T. A. Shellem, and J. A. Doerr. 2003. Enhanced mucosal immunity against Eimeria acervulina in broilers fed a Lactobacillus-based probiotic. Poult. Sci. 82:62–66. Deng, W., X. F. Dong, J. M. Tong, and Q. Zhang. 2012. The probiotic Bacillus licheniformis ameliorates heat stress-induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens. Poult. Sci. 91:575–582. Fuller, R. 1989. Probiotics in man and animal. J. Appl. Bacteriol. 66:365–378. Giacco, F., and M. Brownlee. 2010. Oxidative stress and diabetic complications. Circ. Res. 107:1058–1070. Griggs, J. P., and J. P. Jacob. 2015. Alternatives to antibiotics for organic poultry production. J. Appl. Poult. Res. 14:750–756. Grune, T. 2000. Oxidative stress, aging and the proteasomal system. Biogerontology. 1:31–40. Holmgren, A., C. Johansson, C. Berndt, M. E. L¨ onn, C. Hudemann, and C. H. Lillig. 2005. Thiol redox control via thioredoxin and glutaredoxin systems. Biochem. Soc. Trans. 33:1375–1377. Jones, D. P. 2006. Redefining oxidative stress. Antiox. Redox Signal. 8:1865–1879. Kalam, S., R. Singh, A. Mani, J. Patel, F. N. Khan, and A. Pandey. 2011. Antioxidants: elixir of life. Int. Multidiscipl. Res. J. 2:18–34. Klaunig, J. E., and L. M. Kamendulis. 1998. The role of oxidative stress in carcinogenesis. Environmental Health Perspectives. 106 Suppl 1:289–295. Kode, A., S. Rajendrasozhan, S. Caito, S. R. Yang, I. L. Megson, and I. Rahman. 2008. Resveratrol induces glutathione synthesis by activation of Nrf2 and protects against cigarette smoke-mediated oxidative stress in human lung epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 294:478–488. Kotan, E., L. Alpsoy, M. Anar, A. Aslan, and G. Agar. 2011. Protective role of methanol extract of Cetraria islandica (L.) against oxidative stress and genotoxic effects of AFB1 in human lymphocytes in vitro. Toxicol. Ind. Health. 27:599–605. Kowaltowski, A. J., and A. E. Vercesi. 1999. Mitochondrial damage induced by conditions of oxidative stress. Free. Radic. Biol. Med. 26:463–471. Langston, J. W., W. Li, L. Harrison, and T. Y. Aw. 2011. Activation of promoter activity of the catalytic subunit of γ glutamylcysteine ligase (gcl) in brain endothelial cells by insulin requires antioxidant response element 4 and altered glycemic status: implication for gcl expression and gsh synthesis. Free. Radic. Biol. Med. 51:1749–1757. La Ragione, R. M., and W. Mj. 2003. Competitive exclusion by Bacillus subtilis spores of Salmonella enterica serotype Enteritidis and Clostridium perfringens in young chickens. Vet. Microbiol. 94:245–256. Latorre, J. D., X. Hernandez-Velasco, M. H. Kogut, J. L. Vicente, R. Wolfenden, and A. Wolfenden. 2014. Role of a Bacillus subtilis direct-fed microbial on digesta viscosity, bacterial translocation, and bone mineralization in turkey poults fed with a rye-based diet. Front. Vet. Sci. 1:26. Latorre, J. D., X. Hernandez-Velasco, V. A. Kuttappan, R. E. Wolfenden, J. L. Vicente, and A. D. Wolfenden. 2015. Selection of Bacillus spp. for cellulase and xylanase production as direct-fed microbials to reduce digesta viscosity and Costridium perfringens proliferation using an in vitro digestive model in different poultry diets. Front. Vet. Sci. 2:25. Lawrence, R. A., and R. F. Burk. 1976. Glutathione peroxidase activity in selenium deficient rat liver. Biochem. Biophys. Res. Commun. 71:952−958. Lee, J. M., and J. A. Johnson. 2004. An important role of Nrf2-ARE pathway in the cellular defense mechanism. J. Biochem. Mol. Biol. 37:139–143. Lee, K. W., H. S. Lillehoj, S. I. Jang, S. H. Lee, K. W. Lee, and H. S. Lillehoj. 2014. Effects of salinomycin and Bacillus subtilis, on

9

growth performance and immune responses in broiler chickens. Res. Vet. Sci. 97:304–308. Lin, Y., G. Y. Tan, Y. Q. Fu, J. H. Feng, and M. H. Zhang. 2010. Effects of acute heat stress and subsequent stress removal on function of hepatic mitochondrial respiration, ROS production and lipid peroxidation in broiler chickens. Comp. Biochem. Physiol. Pt. C Toxicol. Pharmacol. 151:204–208. Liu, C. S., C. S. Tsai, C. L. Kuo, H. W. Chen, C. K. Lii, and Y. S. Ma. 2003. Oxidative stress-related alteration of the copy number of mitochondrial DNA in human leukocytes. Free. Radic. Res. 37:1307–1317. Liu, H., Y. Jiang, Y. Luo, and W. Jiang. 2006. A simple and rapid determination of ATP, ADP and AMP concentrations in pericarp tissue of litchi fruit by high performance liquid chromatography. Food Technol. Biotechnol. 44:531–534. Liu, J., D. Chen, Y. Yao, B. Yu, X. Mao, and J. He. 2012. Intrauterine growth retardation increases the susceptibility of pigs to highfat diet-induced mitochondrial dysfunction in skeletal muscle. PLoS One. 7:e34835. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin−phenol reagent. J. Biol. Chem. 193:265–275. Michelet, L., M. Zaffagnini, V. Massot, E. Keryer, H. Vanacker, and M. Miginiacmaslow. 2006. Thioredoxins, glutaredoxins, and glutathionylation: new crosstalks to explore. Photosynth. Res. 89:225–245. Morse, D., L. Lin, A. M. Choi, and S. W. Ryter. 2009. Heme oxygenase-1, a critical arbitrator of cell death pathways in lung injury and disease. Free. Radic. Biol. Med. 47:1–12. Nath, R., and S. Sarma. 2010. The role of oxidative stress in small ruminants’ health and production. R. Bras. Zootecn. 39:348–363. National Research Council (NRC). 1994. Nutrient Requirements of Poultry. 9th rev. ed. National Academy Press, Washington, DC. P´erez, V. I., C. M. Lew, L. A. Cortez, C. R. Webb, M. Rodriguez, and Y. Liu. 2008. Thioredoxin 2 haploinsufficiency in mice results in impaired mitochondrial function and increased oxidative stress. Free. Radic. Biol. Med. 44:882–892. Park, J. H., and I. H. Kim. 2014. Supplemental effect of probiotic Bacillus subtilis B2A on productivity, organ weight, intestinal Salmonella microflora, and breast meat quality of growing broiler chicks. Poult. Sci. 93:2054–2059. Panckenko, L. F., O. S. Brusov, A. M. Gerasimov, and A. E. Loktaeva. 1975. Intramitochondrial localization and release of rat liver superoxide dismutase. FEBS Lett. 55:84−87. Pilger, A., D. Germadnik, K. Riedel, I. Megerkossien, G. Scherer, and W. H. R¨ udiger. 2001. Longitudinal study of urinary 8-hydroxy2 -deoxyguanosine excretion in healthy adults. Free. Radic. Res., 35:273–280. Placer, Z. A., L. L. Cushman, and B. C. Johnson. 1966. Estimation of product of lipid peroxidation (malondialdehyde) in biochemical systems. Anal. Biochem. 16:359−364. Rajput, I.R., Y. L. Li, X. Xu, Y. Huang, W. C. Zhi, D. Y. Yu, and W. F. Li. 2013. Supplementary effects of Saccharomyces boulardii and Bacillus subtilis B10 on digestive enzyme activities, antioxidation capacity and blood homeostasis in broiler. Int. J. Agric. Biol. 15:1560–8530. Ramesh, B., R. Karuna, R. S. Sreenivasa, K. Haritha, M. D. Sai, and B. R. Sasi. 2012. Effect of Commiphora mukul gum resin on hepatic marker enzymes, lipid peroxidation and antioxidants status in pancreas and heart of streptozotocin induced diabetic rats. Asian Pac. J. Trop. Biomed. 2:895–900. Ravikumar, V., K. S. Shivashangari, and T. Devaki. 2005. Effect of Tridax procumbens on liver antioxidant defense system during lipopolysaccharide-induced hepatitis in D-galactosamine sensitised rats. Mol. Cell Biochem. 269:131–136. Ray, P. D., H. B. Wen, and T. Yoshiaki. 2012. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal. 24:981–990. Salami, S. A., M. A. Majoka, S. Saha, A. Garber, and J. F. Gabarrou. 2015. Efficacy of dietary antioxidants on broiler oxidative stress, performance and meat quality: science and market. Avian Biol. Res. 8:65–78. Salim, H. M., H. K. Kang, N. Akter, D. W. Kim, J. H. Kim, M. J. Kim, J. C. Na, H. B. Jong, H. C. Choi, and O. S. Suh. 2013.

10

ZHANG ET AL.

Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. Poult. Sci. 92:2084–2090. Samanya, M., and K. E. Yamauchi. 2002. Histological alterations of intestinal villi in chickens fed dried Bacillus subtilis var. natto. Comp. Biochem. Physiol. Pt. A Mol. Integr. Physiol. 133:95–104. Sanders, M. E. 1993. Summary of conclusions from a consensus panel of experts on health attributes of lactic cultures: significance to fluid milk products containing cultures. J. Dairy Sci. 76:1819– 1828. Stohs, S. J., M. A. Shara, N. Z. Alsharif, Z. Z. Wahba, and Z. A. Al-Bayati. 1990. 2,3,7,8-Tetrachlorodibenzo-p-dioxin-induced oxidative stress in female rats. Toxicol. Appl. Pharmacol. 106:126– 135. Tabassum, H., S. Parvez, S. T. Pasha, B. D. Banerjee, and S. Raisuddin. 2010. Protective effect of lipoic acid against methotrexateinduced oxidative stress in liver mitochondria. Food. Chem. Toxicol. 48:1973–1979. Takahashi, M., M. Sakayori, S. Takahashi, T. Kato, M. Kaji, and M. Kawahara. 2004. A novel germline mutation of the LKB1 gene in a patient with Peutz-Jeghers syndrome with early-onset gastric cancer. J. Gastroenterol. 39:1210–1214. Tang, X., G. Jing, Y. Wang, Y. M. Fan, L. Z. Xu, X. N. Zhao, X. Qiang, and M. Q. Zhong. 2006. Effective protection of Terminalia catappa L. leaves from damage induced by carbon tetrachloride in liver mitochondria. J. Nutr. Biochem. 17:177–182. Tang, Y., C. Gao, M. Xing, Y. Li, L. Zhu, and D. Wang. 2012. Quercetin prevents ethanol-induced dyslipidemia and mitochondrial oxidative damage. Food Chem. Toxicol. 50:1194–1200. Tarasenko, O., L. Soderberg, and K. Hester. 2008. Glycoconjugates enhanced the intracellular killing of bacillus spores, increasing macrophage viability and activation. Arch. Microbiol. 189:579– 587. Upham, B. L., and J. G. Wagner. 2001. Toxicant-induced oxidative stress in cancer. Toxicol. Sci. 64:1–3. Van, R. H., Y. Ikeno, M. Hamilton, M. Pahlavani, N. Wolf, and S. R. Thorpe. 2004. Life-long reduction in MNSOD activity results in

increased DNA damage and higher incidence of cancer but does not accelerate aging. Physiol. Genomics. 16:29–37. Wei, Q. Y., W. F. Chen, B. Zhou, L. Yang, and Z. L. Liu. 2006. Inhibition of lipid peroxidation and protein oxidation in rat liver mitochondria by curcumin and its analogues. Biochim. Biophys. Acta. 1760:70–77. Willemsen, G., E. J. de Geus, M. Bartels, C. E. van Beijsterveldt, A. I. Brooks, and G. F. Estourgie-van Burk. 2010. The netherlands twin register biobank: a resource for genetic epidemiological studies. Twin Res. Human Genet. 13:231–245. Winn, L. M., and P. G. Wells. 1997. Evidence for embryonic prostaglandin H synthase-catalyzed bioactivation and reactive oxygen species-mediated oxidation of cellular macromolecules in phenytoin and benzo[a]pyrene teratogenesis. Free. Radic. Biol. Med. 22:607–621. Zhang, R., K. A. Kang, J. P. Mei, W. Y. Chang, Y. H. Maeng, S. Chae, I. K. Lee, B. J. Kim, and W. H. Jin. 2010. Butin reduces oxidative stress-induced mitochondrial dysfunction via scavenging of reactive oxygen species. Food Chem. Toxicol. 48: 922–927. Zhang, S., B. Lu, X. Han, L. Xu, Y. Qi, and L. Yin. 2013a. Protection of the flavonoid fraction from Rosa laevigata michx fruit against carbon tetrachloride-induced acute liver injury in mice. Food Chem. Toxicol. 55:60–69. Zeng, T., C. L. Zhang, Z .P. Zhu, L. H. Yu, X. L. Zhao, and K. Q. Xie. 2008. Diallyl trisulfide (DATS) effectively attenuated oxidative stress-mediated liver injury and hepatic mitochondrial dysfunction in acute ethanol-exposed mice. Toxicology. 252:86–91. Zhang, Z. F. 2014. Effects of multistrain probiotics on growth performance, apparent ileal nutrient digestibility, blood characteristics, cecal microbial shedding, and excreta odor contents in broilers. Poult. Sci. 93:364–370. Zhang, Z. F., J. H. Cho, and I. H. Kim. 2013b. Effects of Bacillus subtilis UBT-MO 2 on growth performance, relative immune organ weight, gas concentration in excreta, and intestinal microbial shedding in broiler chickens. Livest. Sci. 155: 343–347.