Dietary olive (Olea europaea) leaf extract suppresses oxidative stress and modulates intestinal expression of antioxidant- and tight junction-related genes in common carp (Cyprinus carpio)

Aquaculture xxx (xxxx) xxxx

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Dietary olive (Olea europaea) leaf extract suppresses oxidative stress and modulates intestinal expression of antioxidant- and tight junction-related genes in common carp (Cyprinus carpio) Hamid Rajabiesterabadia, Afshin Ghelichia,∗, Sarah Jorjania, Seyyed Morteza Hoseinib, Reza Akramia a

Department of Fisheries, Azadshahr Branch, Islamic Azad University, Azadshahr, Iran Inland Waters Aquatics Resources Research Center, Iranian Fisheries Sciences Research Institute, Agricultural Research, Education and Extension Organization, Gorgan, Iran

b

A R T I C LE I N FO

A B S T R A C T

Keywords: Phytotherapy Gut Nutrition Health Medicinal herb

The present study was conducted in order to evaluate the effects of various levels of dietary olive leaf extract (OLE) on growth performance, whole body lipid peroxidation, and intestinal expression of hsp70 and antioxidant- and tight junction-related genes in common carp. Common carp juveniles (15 g) were fed with four diets, i.e. control and three diets supplemented with 0.1% (0.1E), 0.5% (0.5E) and 1% (1E) OLE for eight weeks. The results revealed that there was no significant difference in growth performance and feed efficiency between the control and OLE-treated groups (p > 0.05). There was no change in oxidative conditions among the treatments after one week, but the control group showed oxidative stress after eight weeks. The 0.1E and 0.5E treatments showed significantly suppressed oxidative stress (p < 0.05). After one week, there was no difference in sod gene expression among the treatments; cat showed down-regulation and up-regulation in the 0.1E and 1E treatments, respectively; gr showed up-regulation in the 0.5E and 1E treatments. After eight weeks, the 0.1E showed down-regulation; whereas, the 0.5E showed up-regulation in the antioxidant-related gene expressions compared to the control; the 1E treatment showed diverse changes in the gene expressions at this time. The 1E treatment had significantly lower hsp70 gene expression compared to the control after one week; however, after eight weeks, the 0.1E and 0.5E treatments showed significant down-regulation in the gene expression compared to the control and 1E treatments. Compared to the control group, the 0.1E (occl, cld3 and cld7) and 0.5E (occl and cld3) treatments showed up-regulation in tight junction-related gene expressions after one week. After eight weeks, there was no significant difference in occl and cld3 gene expressions among the treatments, but cld7 showed significant up-regulation along with the increase in dietary OLE supplementation. It is concluded that dietary OLE had no noticeable influence on common carp growth performance, but modulated gene expression of antioxidant enzyme and attenuated oxidative stress after 8 weeks.

1. Introduction Aquaculture is an important sector in supplying high quality protein for humans, and there are great global demands for fish and shellfish due to their health benefits. For these reasons, there are great desires to increase aquaculture production. In this regard, fish production has been intensified in recent decades and there is great desire for further increase in aquaculture production (Taheri Mirghaed et al., 2018). However, diseases outbreaks and health deterioration have accompanied such increases in aquaculture production. This led to extensive use of prophylactic and therapeutic agents in the world, resulting in

∗

environmental contamination, presence of antibiotic-resistant bacteria and low fish flesh quality (Alderman and Hastings, 1998). Due to this, it is crucial to find safe way to increase fish health in aquaculture, in such a way that causes no aforementioned side effects. Fish gut exposed to ambient environment and is an important organ due to its role in nutrition and immune defense (Taheri Mirghaed et al., 2019b). This makes the fish gut reachable for ambient microbial pathogens. Consequently, the pathogens may enter the fish body by passing the fish gut. The fish gut structure and integrity is important in preventing pathogens to enter the fish body (Taheri Mirghaed et al., 2019b). Tight junction proteins are structural molecules, supporting the

Corresponding author. E-mail address: [email protected] (A. Ghelichi).

https://doi.org/10.1016/j.aquaculture.2019.734676 Received 24 October 2019; Received in revised form 30 October 2019; Accepted 3 November 2019 Available online 09 November 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Please cite this article as: Hamid Rajabiesterabadi, et al., Aquaculture, https://doi.org/10.1016/j.aquaculture.2019.734676

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

structure integrity of the fish gut epithelium (Jiang et al., 2015a; Wang et al., 2016). These proteins are sensitive to nutritional conditions such as dietary levels of amino acids (Zhao et al., 2014; Feng et al., 2015; Wang et al., 2016), vitamins (Chen et al., 2015), prebiotic/probiotic (Cerezuela and Meseguer, 2013; Pérez-Sánchez et al., 2015), organic acids (Taheri Mirghaed et al., 2019b) and anti-nutrients (Zeng et al., 2019). Moreover, dietary administration of herbal materials was found to modulate the expression of tight-junction protein genes (PérezSánchez et al., 2015; Tan et al., 2019). Assessment of tight junction proteins may provide useful information about the fish gut health. Oxidative stress is a condition of disrupted balance between prooxidants and antioxidants, leading to formation of reactive oxygen species (ROS) (Fang et al., 2002). ROS is highly reactive and attacks any biological molecules of living cells. Oxidative stress makes an organism to react for preserving vital proteins (structural proteins, hormones, enzymes, mediators, etc.) denaturation. Heat shock proteins (HSP) are important molecules, protecting structure of protein molecules by folding them in right position (Ghelichpour et al., 2019). Previous studies on Oreochromis niloticus (fenugreek seeds powder), Ctenopharyngodon idella (Ficus carica polysaccharide), and Megalobrama amblycephala (Rheum officinale extract) have shown dietary administration of herbal materials modulated the expression of hsp70 gene (Liu et al., 2012; Yang et al., 2015; Moustafa et al., 2019). According to above, assessing oxidative stress, HSPs and tight junction proteins provides an important tool to investigate fish gut health. Phytotherapy is an effective method to increase animal health, which has recently gained great attentions in aquaculture (AbdelTawwab, 2016; Dawood et al., 2018; Van Doan et al., 2019a, 2019b). Most of the herbal treatments stimulate antioxidant system of animals, thus protecting the animal cells against oxidative stress. For example, administration of 1,8-cineole (Taheri Mirghaed et al., 2018, 2019a), cumin seed oil (Nigella sativa) and nettle extract (Awad et al., 2013), Gracilaria gracilis(Hoseinifar et al., 2018b), and coffee bean (AbdelTawwab et al., 2018) augmented antioxidant power in different fish species and protected the fish against oxidative stress (Hoseinifar et al., 2019a,b). Therefore, phytochemical with antioxidant property may protect the fish gut tight junction proteins against oxidative stress. Olive (Olea europaea) leaf contains high concentrations of polyphenols, thus is a strong antioxidant (Benavente-Garcıa et al., 2000), although it encompasses other health beneficial effects such as antibacterial (Waterman and Lockwood, 2007) and antiviral (Micol et al., 2005) effects. It was found to stimulate humoral immune responses, cytokines gene expression and disease resistance in fish (Baba et al., 2018; Karimi Pashaki et al., 2018; Zemheri-Navruz et al., 2019). However, its effects on antioxidant responses and tight junction protein of fish gut needs to be investigated. Common carp (Cyprinus carpio) is an important aquaculture species all over the world, with annual production of 4.6 million tons in 2016 (Taheri Mirghaed et al., 2019a). Accordingly, the aim of the present study was to investigate the effects of different levels of dietary olive leaf extract (OLE) on growth performance, whole body lipid peroxidation and expression of antioxidant enzyme, HSP70 and tight junction proteins of common carp gut.

Table 1 Composition of diets (%).

Soybean meal Fish meal Poultry meal Wheat meal Wheat gluten Fish oil Soybean oil Phytase Lysine Methionine Mineral mix Vitamin mix OLE Dry matter Protein Lipid Ash Energy (kCal/kg)

Control

0.1E

0.5E

1E

17 16 15 38.1 10 1 1 0.5 0.6 0.3 0.25 0.25 0 90.8 39.3 8.87 6.21 3831

17 16 15 38 10 1 1 0.5 0.6 0.3 0.25 0.25 0.1 91 39.2 8.81 6.22 3831

17 16 15 37.6 10 1 1 0.5 0.6 0.3 0.25 0.25 0.5 90.6 39.1 8.78 6.18 3831

17 16 15 37.1 10 1 1 0.5 0.6 0.3 0.25 0.25 1 91.1 39.2 8.91 6.20 3831

2.2. Diets Four diets were used in this experiment; one control and three OLEsupplemented. Table 1 shows the ingredients and compositions of the experimental diets, as recommended for this species (Takeuchi et al., 2002). The OLE-supplemented diets were prepared by adding 0.1% (0.1E), 0.5% (0.5E) and 1% (1E) OLE to the control diet. To make the diets, the ingredients were mixed well before moisturizing with 400 ml/ kg water. The resultant dough was passed through a mesh (3 mm, meat grinder) and the sticks were dried against a fan blow. The sticks were crushed in appropriate size and kept at 4 °C until use. 2.3. Experimental protocol This study was conducted in accordance to Animal rights in laboratory uses and researches of Azadshahr Islamic Azad University. Visually healthy common carp juveniles with 15 g weight used in this experiment were purchased from a local farm. The fish were examined externally and internally for any damages, parasites or lesions. The fish were stocked in 12 tanks (100 L) with stocking density of 10 fish per tank. The tanks were continuously aerated using air stones and half of the tanks’ water was replaced with clean water every day. The fish were allowed to acclimatize to the experimental conditions for one week, during which, they were fed with the control diet based on 2% of biomass. After the acclimation period, the fish were fed with four aforementioned diets for eight weeks. The fish were weighed biweekly to adjust feed amount. Water temperature, dissolved oxygen, pH and ammonia were measured by Hach HQ40d (Loveland, Colorado, USA) and Wagtech photometer (7100, Berkshire, UK), being 22.9 ± 0.55 °C, 6.21 ± 0.78 mg/L, 7.15 ± 0.24 and 0.28 ± 0.03 mg/L, respectively. Gut and whole body were sampled in each treatment (two fish per tank; six fish per treatment) after one and eight week. At the end of the eightweek experiment, weight gain percentage, feed conversion ratio (FCR), and specific growth rate (SGR) were determined in each treatment (Abtahi et al., 2013):

2. Materials and methods 2.1. OLE preparation

Weight gain (%) = 100 × (gained weight/IW) OLE extraction was performed according to Zargari et al. (2018) with some modifications. Olive leaves were dried against a fan blow for one week. Then, the dried leaves were pulverized before mixing with a solvent (70% ethanol) with 1:5 proportion. The mixture was kept at dark place for 7 days, during which, it was shaken occasionally. The mixture was then filtered and the resultant solution was dried for 72 h (−50 °C) by a freeze-drier (Beta LDpluse, Martin Christ Gefriertrocknungsanlagen GmbH, Germany). The dried product was pulverized again and kept at 4 °C until use.

FCR = consumed feed/ gained weight SGR (%/d) = 100 × [(ln FW – ln IW)/d] where, FW was fish final weight (g) and IW was fish initial weight (g). 2.4. Gene expression assay For the sampling, the fish were fasted for 24 h before sampling. 2

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

differences among the treatment combinations. P < 0.05 was considered as significance. The data were analyzed in SPSS v.17 and expressed as mean ± SD.

Table 2 Sequences of the primers related to antioxidant system, stress and tight junction proteins. Gene name

Sequences of primers

sod

Forward: TGGCGAAGAAGGCTGTTTGT Reverse: TTCACTGGAGACCCGTCACT Forward: CTGGAAGTGGAATCCGTTTG Reverse: CGACCTCAGCGAAATAGTTG Forward: CTGGGCTATTGGCAGGGAAC Reverse: TCTGGAACTCATCCACCACG Forward: ATCGGTTCAGTACAATCAGG Reverse: GACAATGAAGCCCATAACAA Forward: GCACCAACTGTATCGAGGATG Reverse: GGTTGTAGAAGTCCCGAATGG Forward: CTTCTATAACCCCTTCACACCAG Reverse: ACATGCCTCCACCCATTATG Forward: TCATGGGAGACACATCTGGA Reverse: AGGTCTGGGTCTGTTTGGTG

cat gr occl cld3 cld7 hsp70

3. Results Data of the fish growth performance are presented in Table 3. Although dietary treatment significantly affected weight gain and FCR, there were no significant difference between the control and OLE-supplemented diets. However, 0.5E and 1E treatments had significantly lower weight gain and FCR compared to the 0.1E treatment. After one week feeding, there was no significant difference in sod gene expression among the treatments; however, after eight weeks, 0.1E and 1E had significantly lower sod gene expression compared to the other treatments. In the 0.5E treatment, there was significant elevation in sod gene expression after eight weeks, compared to the first week (Fig. 1). After one week feeding, the lowest cat gene expression was related to 0.1E treatment, whereas, 1E treatment had the highest gene expression. After eight week feeding, the lowest cat gene expression was observed in the 0.1E treatment; however, 0.5E treatment had significantly highest gene expression. In the 0.5E treatment, there was significant elevation in cat gene expression after eight week, compared to the first week (Fig. 1). After one week feeding, there were significant increases in gr gene expression in the 0.5E and 1E treatments compared to the control. After eight weeks, the lowest gr gene expression was related to the 0.1E treatment; whereas, the highest gene expression was related to the 0.5E and 1E treatments (Fig. 1). After one week feeding, the 1E treatment had significantly lower hsp70 gene expression compared to the control treatment. The 0.1E and 0.5E treatments had significantly lower hsp70 gene expression compared to the control and 1E treatments, after eight weeks feeding. The control and 1E treatments had significantly higher gene expression at the eighth week compared to the first week (Fig. 2). The 0.1E and 0.5E treatment had significantly higher occl and cld3 gene expressions compared to the control and 1E treatment, after one week feeding. There was no significant difference in occl and cld3 gene expressions among the treatment after eight weeks feeding. At this time, the 0.1E and 0.5E treatment had significantly lower occl and cld3 gene expressions compared to the first week (Fig. 3). After one week feeding, the 0.1E treatment had significantly higher cld7 gene expression. After eight weeks feeding all the OLE treatments had significantly higher cld7 gene expression compared to the control. At this time, the 0.5E and 1E treatment had significantly higher gene expression compared to the 0.1E treatment. At the eighth week, cld7 gene expression of the 0.5E and 1E treatments significantly increased compared to the first week (Fig. 3). There were no significant differences in whole body TBARS among the treatments after first week. The OLE treatments had significantly lower TBARS compared to the control treatment after eighth week. After the eighth week, TBARS of the control treatment significantly increased, but the 0.1E and 0.5E showed significantly lower TBARS, compared to the first weekFig. 4).

Then, the fish were caught and placed in an anesthetic bath of 100 mg/ L eugenol for 60 s (Yousefi et al., 2018). Then, they were euthanized by spinal cord severance and hind gut was dissected and frozen in liquid nitrogen. The samples were then transferred to −70 °C freezer until gene expression analysis. After the gut sampling, the fish body were frozen in −70 °C for thiobarbituric reactive substances (TBARS) assay. Expression of superoxide dismutase (sod), catalase (cat), glutathione reductase (gr), hsp70, occludin (occl), claudin 3 (cld3) and claudin 7 (cld7) genes were assayed. For this, total RNA of the samples were first extracted using RNX-plus kit (Sinagene, Iran) according to the manufacturer protocol. After confirmation of the extracted RNA quality and quantity by spectrophotometry and agarose gel, Dnase I (Fermentas, Lithuania) was used to avoid DNA contamination. Afterward, Complementary DNA (cDNA) was synthesized using cDNA synthesis kit (Fermentas, Lithuania) according to the manufacturer's protocol. Primers of the target genes were designed based on GeneBank (Table 2). SYBR green method was used to quantify the gene expression using RT-PCR, normalized based on beta-actin gene expression. After verification of PCR efficiency to be around 100%, the gene expression data were analyzed based on DDCt method (Hoseinifar et al., 2018a). 2.5. Whole body TBARS determination Whole body TBARS levels were determined according to Hoseini and Yousefi (2019). Briefly, the fish headless bodies were minced with a meat grinder. The minced samples were homogenized in buffer (100 mM Tris–HCl, 0.1 mM EDTA and 1 ml/L Triton X-100 (v/v), pH 7.8) on ice. After centrifugation, supernatant was used for TBARS assay using commercial kit (ZellBio, Germany). 2.6. Statistical analysis The data normality was checked using Shapiro-Wilk test. Then the data were analyzed by Two-Way ANOVA with sampling time and OLE levels as the factors. When there was an interaction effect of the factors, one-way ANOVA and Tuckey tests were applied to find significant

Table 3 Growth performance and feed efficiency of common carp after eight weeks feeding with diets supplemented with 0, 0.1, 0.5 and 1% OLE. Different letters show significant difference among the experimental diets.

Control 0.1E 0.5E 1E P-value

Initial weight (g)

Final weight (g)

Weight gain (%)

FCR

22.3 ± 20.8 ± 21.2 ± 20.6 ± 0.208

41.5 ± 40.0 ± 38.5 ± 36.6 ± 0.052

45.5 ± 49.1 ± 42.2 ± 42.2 ± 0.034

3.70 ± 3.15 ± 4.23 ± 4.30 ± 0.024

1.58 0.58 1.18 0.83

2.47 1.13 2.23 1.34

3

0.25ab 0.29b 0.12a 0.33a

SGR (%/d) 0.38ab 0.17b 0.23a 0.62a

0.63 ± 0.67 ± 0.59 ± 0.59 ± 0.035

0.03ab 0.03b 0.01a 0.04a

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

Fig. 1. Expression of sod, cat and gr genes in gut of common carp after one (gray bars) and eight (black bars) weeks feeding with diet containing different levels of OLE. Different letters above the bars show significant difference among the dietary OLE levels, separately at each time. Asterisks show significant difference between the first and eighth weeks (*P < 0.05; **P < 0.01; ****P < 0.0001). 4

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

Fig. 2. Expression of hsp70 gene in gut of common carp after one (gray bars) and eight (black bars) weeks feeding with diet containing different levels of OLE. Different letters above the bars show significant difference among the dietary OLE levels, separately at each time. Asterisks show significant difference between the first and eighth weeks (**P < 0.01).

4. Discussion

normal function under stress. Elevation of HSPs indicates the organism’ cells are under stress (Ghelichpour et al., 2019). hsp70 gene expression is a suitable indicator of fish health, as it showed relationships with immune-related genes and disease resistance (Liu et al., 2012; Yang et al., 2015). In the present study, OLE had a rapid but narrow effect on hsp70 gene expression. This might be related to the augmented antioxidant responses (up-regulation of the antioxidant enzymes’ gene expression), an indicator of less oxidative stress (Hoseini and Yousefi, 2019). On the other hand, this indicates that intestinal cells of the 1E treatment were in healthier state compared to the control group, as hsp70 elevation is indicator of cell stress (Sung et al., 2012). This hypothesis was better supported after eight weeks, when, hsp70 expression pattern fitted TBARS levels, suggesting that after a long-term OLE administration, 1% OLE has negative effects on fish gut health. In teleost, tight junction proteins are important for intestinal integrity and tightening. It has been shown that expression of occl, cld3 and cld7 genes are modulated by dietary nutrient levels. Up-regulation of these proteins gene expression might be an indicator of improved gut health and integrity after a short-term treatment with 0.1 and 0.5% OLE, as observed in the fish fed with optimum levels of butyrate, phenylalanine, leucine, valine, choline and fatty acids (Luo et al., 2014; Feng et al., 2015; Jiang et al., 2015b; Wu et al., 2016, 2018; Zeng et al., 2016). However, the results were not lasted for the long-term feeding, suggesting further studies are needed to determine short- and long-term mechanism by which OLE affects tight junctions and gut health. In this case, other studies have shown negative responses of the tight junction protein genes to dietary nutrient optimization and fish health conditions. For example, the genes showed down-regulation in carp, when fed with optimum levels of arginine (Wang et al., 2016) and isoleucine (Zhao et al., 2014). In conclusion, dietary OLE had no marked effects on common carp growth performance, but modulated gene expression of antioxidant enzyme. There were interaction effects of dietary OLE levels and time of administration on different gene expressions, generally suggest that higher levels of OLE are beneficial within short-term administration, but may cause some negative effects after a long-term. OLE attenuated oxidative stress, which might be due to modulation of antioxidant system at transcriptional levels, or its radical scavenging effects. According to the results, dietary 0.1–1% OLE supplementation is recommended for the short-term (1 week) feeding; whereas, dietary 0.1 and 0.5% OLE supplementation is recommended for the long-term (8 weeks) feeding in common carp. Further studies are encouraged to illustrate the effects of OLE administration on fish health.

The present study showed OLE had negligible effects on the fish growth performance, as there was no significant difference in growth performance and feed efficiency between the control and OLE-treated groups. Similar to the present study, Karimi Pashaki et al. (2018) found no significant change in weight gain but slight (4–8%) improvement in FCR of common carp fed with the diets supplemented by 0.1 and 0.5% OLE, compared to a control group. Moreover, Baba et al. (2018) found no significant effects of dietary 0.1–1% OLE on growth performance and feed efficiency in Oncorhynchus mykiss. Cumulatively, OLE components seem not to improve digestion and absorption, nor to stimulate growth processes. Antioxidant enzymes show dual responses to oxidative stress; they may increase or decrease. For example, Taheri Mirghaed et al. (2018) found increase in SOD and CAT activity due to dietary cineole supplementation in O. mykiss, but during an oxidative condition, SOD significantly increased, whereas, CAT decreased. Mourente et al. (2002) found that dietary vitamin E administration significantly decreased SOD and CAT, but increase GR activities in Sparus aurata; when the fish faced an oxidative condition, CAT increased but SOD and GR showed no change. Such inconsistencies is due that sometimes decreased antioxidant enzymes' activity led to oxidative stress, but sometimes, the enzymes' activity increases during oxidative stress to suppress the negative effects (Hoseini et al., 2019). In the present study, TBARS show there was no change in the case of oxidative conditions among the treatments after one week, but the control group showed oxidative stress after eight week. This might be due to rearing the fish in captivity and increased biomass per area unit. Taking together the antioxidantrelated genes and TBARS levels, the results suggest that the 0.1E treatment experienced no oxidative conditions (low TBARS), so, no needs for activation of antioxidant system (low gene expression). This suggests that OLE has radical scavenging effects. Moreover, the 0.5E treatment faced no oxidative condition, but stimulated the antioxidant system. There is no report on antioxidant effects of OLE in fish, but radical scavenging effects of OLE has been demonstrated in vitro (Benavente-Garcıa et al., 2000). Moreover, OLE restored antioxidant enzymes’ activity in rat fed a high-fat diet (Jemai et al., 2008). 1% OLE seems to be high for common carp, causing negative effects on the oxidative condition and antioxidant enzymes in the fish. Similarly, Taheri Mirghaed et al. (2018) and Hoseini et al. (2019) found surplus levels of phytochemicals caused negative effects on antioxidant system of fish. Moreover, Baba et al. (2018) and Zemheri-Navruz et al. (2019) reported negative effects of 1% OLE supplementation on immune function of fish. HSPs are important molecules, protecting proteins' structure and 5

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

Fig. 3. Expression of occl, cld3 and cld7 genes in gut of common carp after one (gray bars) and eight (black bars) weeks feeding with diet containing different levels of OLE. Different letters above the bars show significant difference among the dietary OLE levels, separately at each time. Asterisks show significant difference between the first and eighth weeks (****P < 0.0001). 6

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

Fig. 4. Whole body TBARS levels of common carp after one (gray bars) and eight (black bars) weeks feeding with diet containing different levels of OLE. Different letters above the bars show significant difference among the dietary OLE levels, separately at each time. Asterisks show significant difference between the first and eighth weeks (*P < 0.05).

Declaration of competing interest

298–309. Hoseini, S.M., Yousefi, M., Hoseinifar, S.H., Van Doan, H., 2019. Antioxidant, enzymatic and hematological responses of common carp (Cyprinus carpio) fed with myrcene- or menthol-supplemented diets and exposed to ambient ammonia. Aquaculture 506, 246–255. Hoseinifar, S.H., Hosseini, M., Paknejad, H., Safari, R., Jafar, A., YousefiVan Doan, M., Mozanzadeh, M.T., 2019a. Enhanced mucosal immune responses, immune related genes and growth performance in common carp (Cyprinus carpio) juveniles fed dietary Pediococcus acidilactici MA18/5M and raffinose. Dev Comp Immunol 94, 59–65. Hoseinifar, S.H., Khodadadian Zou, H., Van Doan, H., Kolangi Miandare, H., Hoseini, S.M., 2018a. Evaluation of some intestinal cytokines genes expression and serum innate immune parameters in common carp (Cyprinus carpio) fed dietary loquat (Eriobotrya japonica) leaf extract. Aquacult. Res. 49, 120–127. Hoseinifar, S.H., Yousefi, S., Capillo, G., Paknejad, H., Khalili, M., Tabarraei, A., Van Doan, H., Spanò, N., Faggio, C., 2018b. Mucosal immune parameters, immune and antioxidant defence related genes expression and growth performance of zebrafish (Danio rerio) fed on Gracilaria gracilis powder. Fish Shellfish Immunol. 83, 232–237. Hoseinifar, S.H., Zou, H.K., Van Doan, H., Harikrishnan, R., Yousefi, M., Paknejad, H., Ahmadifar, E., 2019b. Can dietary jujube (Ziziphus jujuba Mill.) fruit extract alter cutaneous mucosal immunity, immune related genes expression in skin and growth performance of common carp (Cyprinus carpio)? Fish Shellfish Immunol 94, 705–710. Jemai, H., Bouaziz, M., Fki, I., El Feki, A., Sayadi, S., 2008. Hypolipidimic and antioxidant activities of oleuropein and its hydrolysis derivative-rich extracts from Chemlali olive leaves. Chem. Biol. Interact. 176, 88–98. Jiang, W.-D., Wen, H.-L., Liu, Y., Jiang, J., Kuang, S.-Y., Wu, P., Zhao, J., Tang, L., Tang, W.-N., Zhang, Y.-A., 2015a. The tight junction protein transcript abundance changes and oxidative damage by tryptophan deficiency or excess are related to the modulation of the signalling molecules, NF-κB p65, TOR, caspase-(3, 8, 9) and Nrf2 mRNA levels, in the gill of young grass carp (Ctenopharyngodon idellus). Fish Shellfish Immunol. 46, 168–180. Jiang, W.-D., Deng, Y.-P., Liu, Y., Qu, B., Jiang, J., Kuang, S.-Y., Tang, L., Tang, W.-N., Wu, P., Zhang, Y.-A., 2015b. Dietary leucine regulates the intestinal immune status, immune-related signalling molecules and tight junction transcript abundance in grass carp (Ctenopharyngodon idella). Aquaculture 444, 134–142. Karimi Pashaki, A., Ghasemi, M., ZorriehZahra, J., Shrif Rohani, M., Hosseini, S.M., 2018. Effect of diets containing aqueous-alcoholic extract of olive leaf (Olea eurcpaea L.) on growth performance and some blood and immune parameters in common carp (Cyprinus carpio) fingerlings. Iran. Fish. Sci. J. 27, 71–80. Liu, B., Ge, X., Xie, J., Xu, P., He, Y., Cui, Y., Ming, J., Zhou, Q., Pan, L., 2012. Effects of anthraquinone extract from Rheum officinale Bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32, 1–7. Luo, J.-B., Feng, L., Jiang, W.-D., Liu, Y., Wu, P., Jiang, J., Kuang, S.-Y., Tang, L., Zhang, Y.-A., Zhou, X.-Q., 2014. The impaired intestinal mucosal immune system by valine deficiency for young grass carp (Ctenopharyngodon idella) is associated with decreasing immune status and regulating tight junction proteins transcript abundance in the intestine. Fish Shellfish Immunol. 40, 197–207. Micol, V., Caturla, N., Pérez-Fons, L., Más, V., Pérez, L., Estepa, A., 2005. The olive leaf extract exhibits antiviral activity against viral haemorrhagic septicaemia rhabdovirus (VHSV). Antivir. Res. 66, 129–136. Mourente, G., Dıaz-Salvago, E., Bell, J.G., Tocher, D.R., 2002. Increased activities of hepatic antioxidant defence enzymes in juvenile gilthead sea bream (Sparus aurata L.) fed dietary oxidised oil: attenuation by dietary vitamin E. Aquaculture 214, 343–361. Moustafa, E.M., Dawood, M.A., Assar, D.H., Omar, A.A., Elbialy, Z.I., Farrag, F.A., Shukry, M., Zayed, M.M., 2019. Modulatory effects of fenugreek seeds powder on the histopathology, oxidative status, and immune related gene expression in Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila. Aquaculture 515, 734589. Pérez-Sánchez, J., Benedito-Palos, L., Estensoro, I., Petropoulos, Y., Calduch-Giner, J.A.,

On behalf of the coauthors, I declare there is no conflict of interest about this manuscript. Acknowledgement No fund was received for this study and there is no conflict of interest about the article. References Abdel-Tawwab, M., Sharafeldin, K., Ismaiel, N., 2018. Interactive effects of coffee bean supplementation and waterborne zinc toxicity on growth performance, biochemical variables, antioxidant activity and zinc bioaccumulation in whole body of common carp, Cyprinus carpio L. Aquacult. Nutr. 24, 123–130. Abdel-Tawwab, M., 2016. Feed Supplementation to Freshwater Fish: Experimental Approaches. LAP LAMBERT Academic Publishing, Germany. Abtahi, B., Yousefi, M., Kenari, A.A., 2013. Influence of dietary nucleotides supplementation on growth, body composition and fatty acid profile of Beluga sturgeon juveniles (Huso huso). Aquacult. Res. 44, 254–260. Alderman, D., Hastings, T., 1998. Antibiotic use in aquaculture: development of antibiotic resistance–potential for consumer health risks. Int. J. Food Sci. Technol. 33, 139–155. Awad, E., Austin, D., Lyndon, A.R., 2013. Effect of black cumin seed oil (Nigella sativa) and nettle extract (Quercetin) on enhancement of immunity in rainbow trout, Oncorhynchus mykiss (Walbaum). Aquaculture 388–391, 193–197. Baba, E., Acar, Ü., Yılmaz, S., Zemheri, F., Ergün, S., 2018. Dietary olive leaf (Olea europea L.) extract alters some immune gene expression levels and disease resistance to Yersinia ruckeri infection in rainbow trout Oncorhynchus mykiss. Fish Shellfish Immunol. 79, 28–33. Benavente-Garcıa, O., Castillo, J., Lorente, J., Ortuno, A., Del Rio, J., 2000. Antioxidant activity of phenolics extracted from Olea europaea L. leaves. Food Chem. 68, 457–462. Cerezuela, R., Meseguer, J., 2013. Effects of dietary inulin, Bacillus subtilis and microalgae on intestinal gene expression in gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 34, 843–848. Chen, L., Feng, L., Jiang, W.-D., Jiang, J., Wu, P., Zhao, J., Kuang, S.-Y., Tang, L., Tang, W.-N., Zhang, Y.-A., 2015. Intestinal immune function, antioxidant status and tight junction proteins mRNA expression in young grass carp (Ctenopharyngodon idella) fed riboflavin deficient diet. Fish Shellfish Immunol. 47, 470–484. Dawood, M.A., Koshio, S., Esteban, M.Á., 2018. Beneficial roles of feed additives as immunostimulants in aquaculture: a review. Rev. Aquac. 10, 950–974. Fang, Y.Z., Yang, S., Wu, G., 2002. Free radicals, antioxidants, and nutrition. Nutrition 18, 872–879. Feng, L., Li, W., Liu, Y., Jiang, W.-D., Kuang, S.-Y., Jiang, J., Tang, L., Wu, P., Tang, W.-N., Zhang, Y.-A., 2015. Dietary phenylalanine-improved intestinal barrier health in young grass carp (Ctenopharyngodon idella) is associated with increased immune status and regulated gene expression of cytokines, tight junction proteins, antioxidant enzymes and related signalling molecules. Fish Shellfish Immunol. 45, 495–509. Ghelichpour, M., Mirghaed, A.T., Hoseinifar, S.H., Khalili, M., Yousefi, M., Van Doan, H., Jimenez, A.P., 2019. Expression of immune, antioxidant and stress related genes in different organs of common carp exposed to indoxacarb. Aquat. Toxicol. 208, 208–216. Hoseini, S.M., Yousefi, M., 2019. Beneficial effects of thyme (Thymus vulgaris) extract on oxytetracycline-induced stress response, immunosuppression, oxidative stress and enzymatic changes in rainbow trout (Oncorhynchus mykiss). Aquacult. Nutr. 25,

7

Aquaculture xxx (xxxx) xxxx

H. Rajabiesterabadi, et al.

oil. Altern. Med. Rev. 12, 331–342. Wu, P., Jiang, W.-D., Jiang, J., Zhao, J., Liu, Y., Zhang, Y.-A., Zhou, X.-Q., Feng, L., 2016. Dietary choline deficiency and excess induced intestinal inflammation and alteration of intestinal tight junction protein transcription potentially by modulating NF-κB, STAT and p38 MAPK signaling molecules in juvenile Jian carp. Fish Shellfish Immunol. 58, 462–473. Wu, P., Tian, L., Zhou, X.-Q., Jiang, W.-D., Liu, Y., Jiang, J., Xie, F., Kuang, S.-Y., Tang, L., Tang, W.-N., 2018. Sodium butyrate enhanced physical barrier function referring to Nrf2, JNK and MLCK signaling pathways in the intestine of young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 73, 121–132. Yang, X., Guo, J.L., Ye, J.Y., Zhang, Y.X., Wang, W., 2015. The effects of Ficus carica polysaccharide on immune response and expression of some immune-related genes in grass carp, Ctenopharyngodon idella. Fish Shellfish Immunol. 42, 132–137. Yousefi, M., Hoseini, S.M., Vatnikov, Y.A., Nikishov, A.A., Kulikov, E.V., 2018. Thymol as a new anesthetic in common carp (Cyprinus carpio): efficacy and physiological effects in comparison with eugenol. Aquaculture 495, 376–383. Zargari, A., Mazandarani, M., Hoseini, S.M., 2018. Effects of safflower (Carthamus tinctorius) extract on serum antibacterial activity of rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila, Streptococcus iniae and Yersinia ruckeri. Int. J. Aquat. Biol. 6, 1–7. Zemheri-Navruz, F., Acar, Ü., Yılmaz, S., 2019. Dietary supplementation of olive leaf extract increases haematological, serum biochemical parameters and immune related genes expression level in common carp (Cyprinus carpio) juveniles. Fish Shellfish Immunol. 89, 672–676. Zeng, Y.-Y., Jiang, W.-D., Liu, Y., Wu, P., Zhao, J., Jiang, J., Kuang, S.-Y., Tang, L., Tang, W.-N., Zhang, Y.-A., 2016. Dietary alpha-linolenic acid/linoleic acid ratios modulate intestinal immunity, tight junctions, anti-oxidant status and mRNA levels of NF-κB p65, MLCK and Nrf2 in juvenile grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 51, 351–364. Zeng, Z.-Z., Jiang, W.-D., Wu, P., Liu, Y., Zeng, Y.-Y., Jiang, J., Kuang, S.-Y., Tang, L., Zhou, X.-Q., Feng, L., 2019. Dietary aflatoxin B1 decreases growth performance and damages the structural integrity of immune organs in juvenile grass carp (Ctenopharyngodon idella). Aquaculture 500, 1–17. Zhao, J., Feng, L., Liu, Y., Jiang, W., Wu, P., Jiang, J., Zhang, Y., Zhou, X., 2014. Effect of dietary isoleucine on the immunity, antioxidant status, tight junctions and microflora in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Fish Shellfish Immunol. 41, 663–673.

Browdy, C.L., Sitjà-Bobadilla, A., 2015. Effects of dietary NEXT ENHANCE® 150 on growth performance and expression of immune and intestinal integrity related genes in gilthead sea bream (Sparus aurata L.). Fish Shellfish Immunol. 44, 117–128. Sung, Y., Roberts, R., Bossier, P., 2012. Enhancement of Hsp70 synthesis protects common carp, Cyprinus carpio L., against lethal ammonia toxicity. J. Fish Dis. 35, 563–568. Taheri Mirghaed, A., Hoseini, S.M., Ghelichpour, M., 2018. Effects of dietary 1, 8-cineole supplementation on physiological, immunological and antioxidant responses to crowding stress in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 81, 182–188. Taheri Mirghaed, A., Fayaz, S., Hoseini, S.M., 2019a. Effects of dietary 1, 8-cineole supplementation on serum stress and antioxidant markers of common carp (Cyprinus carpio) acutely exposed to ambient ammonia. Aquaculture 509, 8–15. Taheri Mirghaed, A., Yarahmadi, P., Soltani, M., Paknejad, H., Hoseini, S.M., 2019b. Dietary sodium butyrate (Butirex® C4) supplementation modulates intestinal transcriptomic responses and augments disease resistance of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 92, 621–628. Takeuchi, T., Satoh, S., Kiron, V., 2002. Common carp, Cyprinus carpio. In: Webster, C.D., Lim, C. (Eds.), Nutrient Requirements and Feeding of Finfish for Aquaculture. CABI Publishing, NY, USA, pp. 245–261. Tan, X., Sun, Z., Ye, C., 2019. Dietary Ginkgo biloba leaf extracts supplementation improved immunity and intestinal morphology, antioxidant ability and tight junction proteins mRNA expression of hybrid groupers (Epinephelus lanceolatus× Epinephelus fuscoguttatus) fed high lipid diets. Fish Shellfish Immunol. Van Doan, H., Hoseinifar, S.H., Chitmanat, C., Jaturasitha, S., Paolucci, M., Ashouri, G., Dawood, M.A., Esteban, M.Á., 2019a. The effects of Thai ginseng, Boesenbergia rotunda powder on mucosal and serum immunity, disease resistance, and growth performance of Nile tilapia (Oreochromis niloticus) fingerlings. Aquaculture 513, 734388. Van Doan, H., Hoseinifar, S.H., Sringarm, K., Jaturasitha, S., Yuangsoi, B., Dawood, M.A., Esteban, M.Á., Ringø, E., Faggio, C., 2019b. Effects of Assam tea extract on growth, skin mucus, serum immunity and disease resistance of Nile tilapia (Oreochromis niloticus) against Streptococcus agalactiae. Fish Shellfish Immunol. Wang, B., Feng, L., Chen, G.-F., Jiang, W.-D., Liu, Y., Kuang, S.-Y., Jiang, J., Tang, L., Wu, P., Tang, W.-N., 2016. Jian carp (Cyprinus carpio var. Jian) intestinal immune responses, antioxidant status and tight junction protein mRNA expression are modulated via Nrf2 and PKC in response to dietary arginine deficiency. Fish Shellfish Immunol. 51, 116–124. Waterman, E., Lockwood, B., 2007. Active components and clinical applications of olive

8