- Email: [email protected]
Differences in DNA methylation and mRNA levels between the breeding and non-breeding seasons of in vitro produced IVF and SCNT sheep embryos
Small Ruminant Research 113 (2013) 390–397
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Differences in DNA methylation and mRNA levels between the breeding and non-breeding seasons of in vitro produced IVF and SCNT sheep embryos Song Hua 1 , Yongsheng Wang 1 , Hao Wu, Fusheng Quan, Hui Zhang, Yong Zhang ∗ College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi Province 712100, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 24 April 2012 Received in revised form 26 March 2013 Accepted 12 April 2013 Available online 8 May 2013
Keywords: Sheep IVF SCNT Season DNA methylation Embryo development
a b s t r a c t In this study, Small Tail Han sheep embryos were produced in the breeding and nonbreeding seasons by in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT). Oocyte recovery and maturation rate, embryo development and blastocyst cell number were evaluated in a series of four experiments using either a 2 treatment (breeding vs. non-breeding season) × 5 replicates or a 2 seasons × 2 embryo types (IVF vs. SCNT) × 5 replicates design. In addition, methylation levels of pluripotent genes (OCT4, SOX2 and LIN28) and imprinted genes (IGF2, IGF2R and GNAS) in matured oocytes and blastocysts, and the expression of these genes in blastocysts were assessed. The number (mean ± SEM) of oocytes recovered per ovary was not significantly different between breeding seasons (3.61 ± 0.22) and non-breeding season (3.33 ± 0.43, P > 0.05); but the percentage of acceptable oocytes and oocyte maturation rate in breeding season (56.4 ± 5.4%, 66.4 ± 8.7%) were significantly higher than those in non-breeding season (44.2 ± 4.3%, 41.8 ± 10.5%, P < 0.05), and the blastocyst formation rates and the cell numbers of blastocyst were significantly higher in breeding season than those in non-breeding season (P < 0.05). Methylation levels of the genes studied were not significantly different between seasons in matured oocytes. SCNT produced blastocysts had significantly higher (P < 0.05 to P < 0.01) methylation levels for OCT4, SOX2 and IGF2, and significantly lower (P < 0.01) methylation levels for GNAS and IGF2R than IVF embryos. Methylation levels for LIN28 did not differ between embryo types. Blastocysts produced in the breeding season had significantly lower methylation levels for OCT4 (P < 0.05) and IGF2 (P < 0.01), and significantly higher levels for IGF2R (P < 0.01). Differences in methylation levels between embryo types were not significant for SOX2, LIN28 and GNAS. IVF blastocysts had a significantly higher (P < 0.05 to P < 0.01) expression levels for OCT4, SOX2 and LIN28 genes, and a significantly lower expression level for the IGF2R gene (P < 0.01) than SCNT blastocysts. Blastocysts produced in the breeding season had significantly higher (P < 0.01) expression levels for OCT4 and SOX2 genes and a significantly lower (P < 0.05) transcript level for the IGF2R gene than in the non-breeding season. No expression of IGF2R or GNAS genes was detected in IVF produced blastocysts and an extremely weak signal was observed in SCNT blastocysts. It is concluded that the season in which oocytes are collected from Small Tail Han sheep significantly affects the number recovered, their quality, maturation rate and development to blastocysts. Season also significantly affects the methylation and transcript levels of some important genes in embryos produced from these oocytes. These effects may be associated with the subsequent developmental potential of the embryos. © 2013 Elsevier B.V. All rights reserved.
∗ Corresponding author. Tel.: +86 29 87080092; fax: +86 29 87080085. E-mail address: [email protected] (Y. Zhang). 1 These authors contributed equally to the paper. 0921-4488/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.smallrumres.2013.04.005
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
391
1. Introduction
2. Materials and methods
Sheep characterized by seasonal reproduction show seasonal variations in their ovulation frequency (ovulation or anovulation), sperm production (from moderate decrease to complete absence), gamete quality (marked by fertilization rates and embryo survival), and also sexual behaviour (Chemineau et al., 2008). Most sheep breeds show distinct seasonal patterns in ovarian function, with ovulatory cycles occurring in the autumn and winter (the breeding season) and anovulation in the spring and summer (non-breeding season or anoestrous season). This ensures that all ewes become pregnant in the late summer or early autumn, and insure that births occur at the optimal time of the year, the early spring or late winter, which allows the lambs to grow under favourable conditions of temperature and feed availability, and maximize their chances of survival (Goodman et al., 2010). In northwest China (longitude 75–110◦ E, latitude 34–45◦ N) the normal breeding season in sheep is from September to March, and the period April to August is the out-of-breeding season during which the sheep do not exhibit oestrus (seasonal anoestrus). Recipient oocytes are critical for the reprogramming of SCNT embryos and embryonic development. DNA methylation plays a key role in reprogramming, and can result in gene silencing and heterochromatin formation (Rideout et al., 2001; Lachner and Jenuwein, 2002), precise DNA methylation patterns are crucial in the early development, especially for some pluripotent genes such as OCT4, SOX2 and LIN28, and imprinted genes such as GNAS, IGF2 and IGF2R. In preimplantation mammalian development the transcription factor SOX2 forms a complex with OCT4 and functions in maintenance of self-renewal of the pluripotent inner cell mass (ICM) (Keramari et al., 2010). LIN28 is an evolutionarily conserved RNA-binding protein, which is important to embryogenesis and may be a master regulator controlling the pluripotency of embryonic stem cells (ESC) (Zhong et al., 2010). In addition, DNA methylation is also an important regulator of imprinted genes and their expression, and improper imprints of these genes can cause developmental abnormalities (Ruddock et al., 2004). IGF2 is paternally expressed, while IGF2R is maternally expressed. Interestingly, GNAS is maternally expressed in the foetus, but then paternally expressed in the chorioallantois (Thurston et al., 2008). Assisted reproduction technologies (ART) such as IVF and SCNT have been used to increase sheep reproductive rate, and improve the varieties and breeds (Fletcher et al., 2007), as well as to overcome seasonal limitations. The outcome of ART may differ between seasons in animals that exhibit seasonal patterns of reproduction. The effects of reproductive seasons on the embryonic development are not well understood in respect of ART in ovine. To investigate the potential differences in embryo development during the breeding and non-breeding seasons, oocytes from Small Tail Han sheep were collected and matured in vitro, and were used to construct SCNT and IVF embryos, the resultant embryo development, methylation patterns as well as expression levels of representative genes were compared and analyzed.
Unless otherwise stated, all chemicals were purchased from Sigma Chemical Co. USA. Disposable plastic-ware was purchased from Nunclon (Roskilde, Denmark). All procedures associated with animal were approved by Animal Care and Ethical Standards issued by Northwest A&F University. 2.1. Oocytes collection and maturation in vitro Small Tail Han Sheep ovaries were collected from a local abattoir, and transported to the laboratory within 3 h post-slaughter. Cumulus cell–oocyte complexes (COC) were aspirated from the follicles (3–6 mm in diameter) with a 9# needle attached to a plastic 10 ml syringe using PBS (phosphate buffered saline). After that, the COC were divided into three grades based on morphology in the laboratory prior to maturation culture (good, oocytes with a homogeneous cytoplasm and more than five compact layers of cumulus cells: fair, oocytes with less than or five layers cumulus cells, and with a homogeneous cytoplasm, and poor, oocytes without cumulus cells and with heterogeneous cytoplasm or with some scattered cumulus cells) (Wani et al., 2000). Only COC of acceptable quality (good and fair) was selected for in vitro maturation. In vitro oocyte culture was performed as described previously (Berlinguer et al., 2008). Those oocytes that were observed to have the first polar body were considered mature oocytes, otherwise they were referred to as immature oocytes. 2.2. Preparation of donor somatic cells and in vitro fertilization (IVF) Foetal fibroblast cells were isolated from sheep foetus (3.5 months), and the detailed procedure was carried out according to the reference (Hua et al., 2011). After two subpassages, the cells were frozen and stored in liquid nitrogen. To prepare donors for SCNT, cells were thawed and cultured in DMEM containing 10% foetal bovine serum (FBS) and 0.1% gentamicin in plastic culture dish in advance. Preparation of sperm and IVF were performed as described by Machado et al. (2009). Finally, the presumptive embryos were washed three times with culture medium and cultured under the same conditions as SCNT embryos. 2.3. Nuclear transfer, embryos culture and cell count of blastocysts Nuclear transfer was carried out according to the method described by Hua et al. (2008) with some modifications. Matured oocytes were enucleated by aspirating the first polar body and the adjacent cytoplasm containing metaphase II spindle. The successful enucleation was confirmed by Hoechst 33342 staining. Then a donor cell was transferred to the perivitelline space of the enucleated oocyte. Cell–oocyte complexes were placed into fusion medium (0.3 M mannitol, 0.1 mM Mg2+ and 0.05 M Ca2+ ) in a fusion chamber and a pulse of 1.2 kV cm−1 for 20 s was applied to induce the cells to fuse. After fusion, the couplets were activated by exposure to 5 M ionomycin in TCM199 for 5 min, followed by a 4 h incubation in 2 mM 6-dimethylaminopurine. Presumptive zygotes were cultured in groups of 50. Development rates of 2-cell, 8-cell, 16-cell and blastocysts were examined at time point of 48 h, 72 h, 108 h and 168 h, respectively. At each time point, corresponding embryos were transferred to fresh medium and cultured in groups of 30. Activated embryos were cultured at 38.5 ◦ C in an atmosphere of 5% CO2 in air, with maximum humidity. Cell number of blastocysts was determined by staining embryos with the fluorescent bisbenzimidazole Hoechst dyes, described previously by Pursel et al. (1985). 2.4. Sodium bisulfite genomic sequencing To analyze the methylation difference in the pluripotent gene promoter (OCT4, SOX2 and LIN28) and imprinted gene exon 1 (GNAS, IGF2 and IGF2R), mature oocytes and blastocysts produced by SCNT and IVF were analyzed using sodium bisulfite genomic sequencing. Five subsets of 10 oocytes or embryos per treatment were used to carry out the sodium bisulfite treatment by an EZ DNA Methylation-DirectTM Kit (Zymo Research, Los Angeles, CA, USA) according to the manufacturer instructions. Converted DNA was amplified with Zymo TaqTM DNA Polymerase (Zymo Research, Los Angeles, CA, USA) using specific primers (Table 1) designed using
392
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
Table 1 Primer sequences for sodium bisulfite genomic sequencing of in vitro matured oocytes recovered from Small Tail Han sheep and blastocysts produced by in vitro fertilization (IVF) or by somatic cell nuclear transfer (SCNT). Gene OCT4 (Accession No. HM118848) SOX2 (Accession No. X96997)
Sequencing primers (5 –3 ) Left: GATTTGGATGAGTTTTTAAGGGTT Right: ACTCCAACTTCTCCTTATCCAACTT Left: TATTAAAAGAGTAAATTTAAGATTAAGTT Right: CAAATTAATAAACAACCATCCATATAAC
Position on the full-gene sequence
Tm (◦ C)
7–122
55.5
1021–1303
55.0
LIN28 (Accession No. GQ131421)
Left: TAAATTAGTAGTTTGTAGGTGGTTG Right: ACAACTTACTCTAATACACAAAAAC
14–238
55.5
GNAS (Accession No. AY376066) (Thurston et al., 2008)
Left: GTATGTTAAGGTTTTTTGGGAGGAT Right: AATCTCAAAAATTCCAAAAATCAAA
181–411
59.0
IGF2 (Accession No. M89789)
Left: TTAATGGGGATTATAGTAGGAAAGT Right: AATAAATCTCCAACAAAACCAAATC
935–1043
55.0
IGF2R (Accession No. AF353513)
Left: TGGAATTTTTGAGGGTTTAAATATT Right: ACCCAATCTCAACAAATAATTCATT
204–382
57.0
online software (http://www.urogene.org/methprimer/). Reaction conditions were 95 ◦ C for 8 min followed by, 40 cycles of 94 ◦ C for 45 s, 56 ◦ C for 30 s, and 72 ◦ C for 30 s. PCR products were purified using ZymocleanTM Gel DNA Recovery Kit (Zymo Research, Los Angeles, CA, USA), and cloned into a pMD18-T vector (Takara Biotech, Dalian, China), followed by transforming into Escherichia coli strain DH5˛. Finally, individual clones were sequenced (Takara Biotech, Dalian, China) and methylation percentages were calculated based on the total number of cytosine molecules and the number of converted cytosine within the fragment amplified. 2.5. Expression analysis by RT-qPCR Semi-quantitative RT-qPCR was performed to determine the expression levels of the studied genes. Total mRNA was extracted from the four groups of blastocysts (breeding season IVF and SCNT, non-breeding IVF and SCNT) using a High Pure Viral RNA kit (Roche, Germany), each with five subsets of 10 intact embryos. Sheep GAPDH was used as reference gene. cDNA and positive control were prepared using the High Fidelity PrimeScriptTM RT-PCR Kit (Takara Biotech, Dalian, China), according to the manufacturer’s instructions. Negative controls contained all cDNA synthesis components but no sample RNA. QPCR reactions for the reference gene and target genes were carried out with three parallel tests (primers listed in Table 2). Each reaction was run in 25 l reaction mixtures with 12.5 l SYBR Premix Ex TaqTM (Takara Biotech, Dalian, China), 0.5 l each primer (about 0.5 m), 1.5 l distilled water, and 10 l of template cDNA (about 0.1 pm). The reaction conditions were as follows: 94 ◦ C for 40 s, followed by 45 cycles at 94 ◦ C for 30 s, 55 ◦ C for 40 s, and 72 ◦ C for 30 s. The threshold cycle was normalized to the reference gene GAPDH. RT-qPCR was performed using a SmartCycler (Cepheid, USA). The same experiments were repeated five times. The expression level was calculated using the 2−Ct method as previously described (Livak and Schmittgen, 2001). Samples for the methylation and DNA analyses were prepared by extracting the DNA and RNA from oocytes and embryos in each season and storing the samples at −80 ◦ C until the samples from both seasons could be analyzed at the same time. 2.6. Experiments and experimental designs 2.6.1. Experiment 1 The effect of season on oocyte maturation was studied in Experiment 1. There were two treatments (breeding season vs. non-breeding season) each replicated five times in this experiment. Oocytes were collected in each season and those of acceptable quality cultured in groups of 80–100 for 24 h. The experiment was concluded at the end of maturation. 2.6.2. Experiment 2 Presumptive zygotes were cultured in groups of 50. Development rates of 2-cell, 8-cell, 16-cell and blastocysts were examined at time point of 48 h, 72 h, 108 h and 168 h, respectively. At each time point, corresponding embryos were transferred to fresh medium and cultured in groups of 30. Differences in the frequencies of embryos undergoing cleavage or developing to 8-cell, 16-cell, and blastocyst stages, as well as the mean cell number of blastocyst were determined using a 2 × 2 × 5 factorial design to
decide the effect of seasons (breeding vs. non-breeding) and embryo types (SCNT vs. IVF) on embryonic development, and the raw data were arcsine square-root-transformed prior to testing for homogeneity of variance. 2.6.3. Experiment 3 Differences between breeding and non-breeding seasons in the methylation levels of genes recovered from matured oocytes were analyzed using a 2 treatments (seasons) × 5 replicates experimental design. The effect of seasons (breeding vs. non-breeding) and embryo types (SCNT vs. IVF) on the methylation levels were compared using a two-way ANOVA in a 2 × 2 × 5 factorial design. 2.6.4. Experiment 4 The expression levels of each gene were analyzed by the 2 × 2 × 5 factorial design to determine whether differences in levels of mRNA expression were significant for embryos generated by embryo types (SCNT vs. IVF) and seasons (breeding vs. non-breeding). 2.7. Statistical analysis All statistical analyses were performed with SPSS version 10.0 and data are shown as mean ± standard error of mean (SEM). The data were arcsine square-root-transformed, wherever necessary, for homogeneity of variance. A probability level of P ≤ 0.05 was considered significant. Each experiment was repeated five times.
3. Results 3.1. Oocyte collection and maturation The total number of oocytes recovered per ovary was not significantly different between the breeding and nonbreeding seasons (3.61 ± 0.22 vs. 3.33 ± 0.43, P > 0.05), but the percentage of acceptable oocytes was significantly higher in the breeding season (56.4 ± 5.4% vs. 44.2 ± 4.3%, P < 0.05) and these oocytes had a higher maturation rates (66.4 ± 8.8% vs. 41.9 ± 10.5%, P < 0.05) (Table 3). 3.2. Development of embryos The SCNT and IVF embryos were cultured in the same conditions during breeding and non-breeding seasons (Table 4). The cleavage rate of SCNT embryos in breeding season was markedly higher than that in non-breeding season (61.2 ± 4.6% vs. 53.1 ± 3.8%, P < 0.05), but no significant difference of cleavage rare in IVF embryos between breeding and non-breeding seasons (overall mean 82.5 ± 6.1%)
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
393
Table 2 Primer sequences used for RT-qPCR of blastocysts produced by in vitro fertilization (IVF) or somatic cell nuclear transfer (SCNT) using in vitro matured oocytes recovered from Small Tail Han sheep. Gene
Sequencing primers (5 –3 )
Position on the full-gene sequence
Tm (◦ C)
OCT4 (Accession No. HM118848)
Left: GATTTGGATGAGTTTTTAAGGGTT Right: ACTCCAACTTCTCCTTATCCAACTT
23–220
54.5
SOX2 (Accession No. X96997)
Left: AGCCAAATCAGAACCAGG Right: GCCAGAGTAATCTAAACACCC
2687–2860
55.0
LIN28 (Accession No. GQ131421)
Left: TAAATTAGTAGTTTGTAGGTGGTTG Right: ACAACTTACTCTAATACACAAAAAC
332–547
56.5
GNAS (Accession No. AY376066) (Thurston et al., 2008)
Left: AGCGACCAGGATCTGCTCCGCT Right: CTGACGGTAGTAGAAGCACCA
465–631
57.0
IGF2 (Accession No. M89789)
Left: GCCGGCTTCCAGACATCAAT Right: CCTCTTCGACCGTGCTTCC
920–1224
55.0
IGF2R (Accession No. AF353513)
Left: GATGAGTGTCTCATCAACTCT Right: CCTTTGTCGCGAAGCTGGAC
1078–1239
57.0
GAPDH (Accession No. AF030943) (Yu et al., 2009)
Left: CTGCTGACGCTCCCATGTTTGT Right: TAAGTCCCTCCACGATGCCAAA
562–450
60.0
Table 3 Oocytes recovered post-mortem from Small Tail Han sheep and their in vitro maturation rate in the breeding and non-breeding seasons. Source
Breeding season
Number of ovaries Number of oocytes Number of oocytes per ovary Percentage of acceptable oocytes Maturation rate
262 994 3.61 ± 0.22a 56.4 ± 5.4%a 66.4 ± 8.7%a
Non-breeding season
P-value
320 1066 3.33 ± 0.43a 44.2 ± 4.3%b 41.8 ± 10.5%b
>0.05 <0.05 <0.05
Different lower-case letters indicate significant differences (P < 0.05).
was observed. From the 8-cell stage to the blastocyst stage, the development rates of embryos produced from oocytes recovered during the breeding season were significantly higher (P < 0.05) than those from non-breeding season irrespective of the method of embryo production. Furthermore, the development rates of IVF embryos at various stages were markedly higher compared with SCNT embryos in the same season. The number of blastomeres per embryo produced in the breeding season was significantly higher than in the non-breeding season both for SCNT embryos (58.7 ± 5.6 vs. 42.0 ± 4.1, P < 0.01, Fig. 1, Table 4) and IVF embryos (85.4 ± 4.1 vs. 71.4 ± 4.2, P < 0.01); and the number of cells per blastocyst was significantly higher (P < 0.05) for IVF than SCNT embryos in both seasons.
3.3. Methylation levels of pluripotent and imprinted genes The results showed that the methylation patterns of promoter regions of the three pluripotent genes in matured oocytes were not significantly different between the breeding and non-breeding seasons; and for the three imprinted genes, the methylation patterns of exons were similar between breeding and non-breeding seasons (Fig. 2). No statistically significant interactions between embryo type and breeding season were observed in respect of methylation levels for any of the genes studied. Consequently, only the overall main effect means are presented in Fig. 3.
Table 4 Development rate of Small Tail Han sheep embryos produced by in vitro fertilization (IVF) or by somatic cell nuclear transfer (SCNT) during the breeding or non-breeding season. Development stage
IVF
SCNT
Breeding 2-Cell embryos 8-Cell embryos 16-Cell embryos Blastocysts Cell number of blastocysts
84.2 73.9 57.8 46.6 85.4
± ± ± ± ±
5.5a 4.6a 3.4a 3.5a 4.1a
Non-breeding 80.7 61.7 46.7 30.5 71.4
± ± ± ± ±
7.8a 5.6b 3.4b 2.6b 4.2b
P-value
Breeding 61.2 53.5 38.6 20.2 58.7
± ± ± ± ±
4.6b 5.2c 2.1c 1.2c 5.6c
Non-breeding 53.1 40.5 32.3 13.7 42.0
± ± ± ± ±
3.8c 3.7d 2.5d 1.7d 4.1d
Season
Embryo type
Season × embryo type
<0.05 <0.05 <0.01 <0.01 <0.01
<0.05 <0.05 <0.05 <0.05 <0.05
>0.05 >0.05 >0.05 >0.05 >0.05
Development rates (%) are based on the number of presumptive zygotes for IVF or the number of putative embryos after SCNT on Day 0 of culture; values are mean ± SEM. Values within a row with different superscripts are significantly different (P < 0.05).
394
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
Fig. 1. Representative photographs of Small Tail Han sheep blastocysts produced by somatic cell nuclear transfer. (A) Somatic cell nuclear transfer blastocysts produced in non-breeding season; (B) somatic cell nuclear transfer blastocysts produced in breeding season; (C) somatic cell nuclear transfer blastocysts derived from the non-breeding season stained with Hoechst33342; (D) somatic cell nuclear transfer blastocysts derived from the breeding season stained with Hechst33342.
Fig. 3.1 shows that SCNT blastocysts had significantly higher methylation levels for OCT4 (P < 0.05), SOX2 (P < 0.01) and IGF2 (P < 0.01), and significantly lower methylation levels for GNAS (P < 0.01) and IGF2R (P < 0.01) than IVF blastocysts. The methylation levels for LIN28 did not differ between embryo types. Blastocysts produced in the breeding season had significantly lower methylation levels for OCT4 (P < 0.05) and IGF2 (P < 0.01), and significantly higher levels for IGF2R
(P < 0.01). The differences in methylation levels between seasons were not significant for SOX2, LIN28 and GNAS (Fig. 3.2). 3.4. Expression of pluripotent and imprinted genes No statistically significant interactions between embryo type and breeding season were observed in respect of the expression of any of the pluripotent and imprinted genes
Fig. 2. Methylation levels (%) of pluripotent and imprinted genes in vitro matured oocytes recovered in the breeding or non-breeding season of Small Tail Han sheep. Within a gene, columns with different superscripts are significantly different; P < 0.05.
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
395
Fig. 3. Methylation levels (%) of pluripotent and imprinted genes in blastocysts produced by different methods (in vitro fertilization, IVF vs. somatic cell nuclear transfer, SCNT; 3.1) using in vitro matured oocytes recovered in different seasons (breeding vs. non-breeding season; 3.2) from Small Tail Han sheep. The level of statistical significance for the difference between treatments within a gene is indicated by asterisks viz. *P < 0.05, **P < 0.01.
studied. Consequently, only the overall main effect means of the comparative expression levels relative to the internal control using the ddCt method are presented in Fig. 4. IVF blastocysts had a significantly higher expression level for OCT4 (P < 0.01), SOX2 (P < 0.01) and LIN28 (P < 0.05) genes, and a significantly lower expression level for the IGF2R gene (P < 0.01) than SCNT blastocysts (Fig. 4.1). Blastocysts produced in the breeding season had a significantly higher (P < 0.01) expression levels for OCT4 and SOX2 genes and a significantly lower (P < 0.05) transcript level for the IGF2R gene than those produced in the nonbreeding season (Fig. 4.2). No expression of IGF2R or GNAS genes could be detected in IVF produced blastocysts in either season and an extremely weak signal was observed in SCNT blastocysts although RT-qPCR conditions were optimized. 4. Discussion 4.1. Oocyte maturation and embryonic development The mean number of oocytes recovered per ovary varied from 3.33 ± 0.43 (non-breeding season) to 3.61 ± 0.22 (breeding season), which was higher than the 2.17 oocytes per ovary reported by Datta et al. (1993) and 1.32 by Rao et al. (2002), but lower than the 6.3 oocytes/ovary reported by Shirazi et al. (2005). The cause of this discrepancy needs further evaluation. In addition, the extrusion of the first
polar body was observed more obviously after in vitro oocyte maturation in breeding season than in non-breeding season. It suggested that reproductive seasons influenced the development and maturation of oocytes (Smith and Clarke, 2010). The development, maturation and ovulation of sheep oocytes are regulated by series hormones such as oestrogen, progesterone, lutenizing hormone, follicle stimulating hormone and prolactin, and this control in vivo is different between breeding and non-breeding seasons (Todini et al., 2007). Previous study reported that the transition from the non-breeding season to the breeding season represented a mechanism similar to the onset and offset of puberty with biological changes including several neurosecretory factors and/or hormones (Smith and Clarke, 2010). In addition, during breeding and non-breeding seasons, hormones (such as oestradiol and luteinizing hormone) pulse frequency and amplitude are different (Goodman et al., 1982; Martin et al., 1983). This variety of reproductive hormone level may be associated with climatic conditions and nutrition (Todini et al., 2007). 4.2. Methylation patterns DNA methylation is a major epigenetic modification for SCNT embryos, and is involved in transcriptional suppression of important genes (Edwards, 2006). In this study, SCNT blastocysts had significantly higher methylation
396
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
Fig. 4. The expression of pluripotent and imprinted genes in blastocysts produced by different methods (in vitro fertilization, IVF vs. somatic cell nuclear transfer, SCNT; 4.1) using in vitro matured oocytes recovered in different seasons (breeding vs. non-breeding season; 4.2) from Small Tail Han sheep. The level of statistical significance for the difference between treatments within a gene is indicated by asterisks viz. *P < 0.05, **P < 0.01.
levels for OCT4, SOX2 and IGF2, and significantly lower methylation levels for GNAS and IGF2R than IVF blastocysts: the methylation levels for LIN28 did not differ between embryo types. These results show that the reprogramming of OCT4, SOX2, IGF2, GNAS, and IGF2R in early ovine embryos is affected by embryo type. Previous study reported that LIN28 is bound to mRNAs and regulated their stability and post-transcriptional translation (Xu et al., 2009). In this study, the methylation pattern of LIN28 was similar for both IVF and SCNT blastocysts suggesting that LIN28 was more easily reprogrammed than other genes in sheep embryos. In addition, blastocysts produced in breeding season had significantly higher methylation levels for IGF2R, and significantly lower methylation levels for OCT4 and IGF2 than blastocysts produced in non-breeding season: the methylation levels for SOX2, LIN28 and GNAS did not differ between the two seasons. Appropriate imprinting and expression of imprinted genes are important for normal embryo development. GNAS mainly regulates birth weight, obesity and hormone resistance (Weinstein et al., 2006). In addition, IGF2, an imprinted gene that is paternally expressed in embryos, is also involved in normal growth and development (Young et al., 2003). Our data show that the reproductive season has a significant effect on the reprogramming of OCT4, IGF2 and IGF2R in early ovine embryos.
4.3. Gene expression level The study on transcript levels of OCT4, SOX2, LIN28, GNAS, IGF2 and IGF2R in matured oocytes showed that the expression levels of a gene are not affected by the season (breeding or non-breeding) in which the oocytes are recovered. In contrast, the type of embryo did affect gene transcription with IVF blastocysts having significantly higher expression levels for OCT4, SOX2 and LIN28 genes, and significantly lower expression level for the IGF2R gene than SCNT blastocysts. Furthermore, season affected gene expression in blastocysts with those produced in the breeding season having significantly higher expression levels for OCT4 and SOX2 genes and a significantly lower transcript level for the IGF2R gene than for blastocysts produced in the non-breeding season. No expression of IGF2 or GNAS genes could be detected in IVF produced blastocysts in either season and an extremely weak signal was observed in SCNT blastocysts although RT-qPCR conditions were optimized. This was consistent with the previous results that no expression of IGF2 (Lee et al., 2002) and GNAS (Thurston et al., 2008) was observed in sheep blastocysts. One possible explanation for this was that imprinting and expression of GNAS and IGF2 were dynamic during the whole development, while at the blastocyst stage, both genes were not
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
expressed or the level of expression was below the detection level. Sheep parthenogenetic embryos expressing low levels of IGF2 and high levels of IGF2R were detrimental to embryonic development when compared with normal control (Feil et al., 1998; Young et al., 2003). This implies that normal expression of some genes is required for the embryonic development. Our results show that the development of embryos produced in vitro from oocytes recovered in the non-breeding season is less successful than from those recovered in the breeding season due to the differences in the methylation and expression levels of IGF2R. 5. Conclusion Small Tail Han sheep produced significantly more oocytes that had a higher maturation rate in the breeding than in the non-breeding season. Both SCNT and IVF embryos in the breeding season had lower methylation levels of IGF2 and OCT4, and higher methylation levels of IGF2R than in the non-breeding season. Blastocysts of both types produced in the breeding season had significantly higher mRNA levels of SOX2 and OCT4, and lower levels of IGF2R than in the non-breeding season. It is concluded that the season in which oocytes are collected significantly affects the number, quality and maturation rate of oocytes recovered from Small Tail Han sheep. The methylation and transcript levels of some important genes in the embryos produced from these oocytes are also significantly affected by season and these effects may be associated with the subsequent developmental potential of the embryos. Acknowledgements This work was supported by National Natural Science Foundation of China (31001008). The authors thank the editor and the reviewers for their constructive suggestions to the manuscript. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work. References Berlinguer, F., Gonzalez, R., Succu, S., del Olmo, A., Garde, J.J., Espeso, G., Gomendio, M., Ledda, S., Roldan, E.R.S., 2008. In vitro oocyte maturation, fertilization and culture after ovum pick-up in an endangered gazelle (Gazella dama mhorr). Theriogenology 69, 349–359. Chemineau, P., Guillaume, D., Migaud, M., Thiery, J.C., Pellicer-Rubio, M.T., Malpaux, B., 2008. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications. Reprod. Dom. Anim. 43, 40–47. Datta, T.K., Goswami, S.L., Das, S.K., 1993. Comparative efficiency of three oocyte recovery methods from sheep ovaries. Indian J. Anim. Sci. 63, 1178–1179. Edwards, R.G., 2006. Genetics, epigenetics and gene silencing in differentiating mammalian embryos. Reprod. BioMed. Online 13, 732–753. Feil, R., Khosla, S., Cappai, P., Loi, P., 1998. Genomic imprinting in ruminants: allele-specific gene expression in parthenogenetic sheep. Mamm. Genome 9, 831–834. Fletcher, C.J., Roberts, C.T., Hartwich, K.M., Walker, S.K., McMillen, I.C., 2007. Somatic cell nuclear transfer in the sheep induces placental defects that likely precede fetal demise. Reproduction 133, 243–255.
397
Goodman, R.L., Bittman, E.L., Foster, D.L., Karsch, F.J., 1982. Alterations in the control of luteinizing hormone pulse frequency underlie the seasonal variation in estradiol negative feedback in the ewe. Biol. Reprod. 27, 580–589. Goodman, R.L., Jansen, H.T., Billings, H.J., Coolen, L.M., Lehman, M.N., 2010. Neural systems mediating seasonal breeding in the ewe. J. Neuroendocrinol. 22, 674–681. Hua, S., Zhang, H., Su, J.M., Zhang, T., Quan, F.S., Liu, J., Wang, Y.S., Zhang, Y., 2011. Effects of the removal of cytoplasm on the development of early cloned bovine embryos. Anim. Reprod. Sci. 126, 37–44. Hua, S., Zhang, Y., Song, K., Song, J., Zhang, Z., Zhang, L., Zhang, C., Cao, J., Ma, L.B., 2008. Development of ovine-bovine interspecies cloned embryos and mitochondria segregation in blastomeres during preimplantation. Anim. Reprod. Sci. 105, 245–257. Keramari, M., Razavi, J., Ingman, K.A., Patsch, C., Edenhofer, F., Ward, C.M., Kimber, S.J., 2010. Sox2 is essential for formation of trophectoderm in the preimplantation embryo. PLoS One 5 (11), e13952. Lachner, M., Jenuwein, T., 2002. The many faces of histone lysine methylation. Curr. Opin. Cell Biol. 14 (3), 286–298. Lee, R.S., Depree, K.M., Davey, H.W., 2002. The sheep (Ovis aries) H19 gene: genomic structure and expression patterns, from the preimplantation embryo to adulthood. Gene 301, 67–77. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct method. Methods 25, 402–408. Machado, G.M., Carvalho, J.O., Filho, E.S., Caixeta, E.S., Franco, M.M., Rumpf, R., Dode, M.A.N., 2009. Effect of Percoll volume, duration and force of centrifugation, on in vitro production and sex ratio of bovine embryos. Theriogenology 71, 1289–1297. Martin, G.B., Scaramuzzi, R.J., Henstridge, J.D., 1983. Effects of oestradiol, progesterone and androstenedione on the pulsatile secretion of luteinizing hormone in ovariectomized ewes during spring and autumn. J. Endocrinol. 96, 181–193. Pursel, V.G., Wall, R.J., Rexroad, C.E., Hammer, R.E., Brinster, R.L., 1985. A rapid whole-mount staining procedure for nuclei of mammalian embryos. Theriogenology 24, 687–691. Rao, B.S., Naidu, K.S., Amarnath, D., Vagdevi, R., Rao, A.S., Brahmaiah, K.V., Rao, V.H., 2002. In vitro maturation of sheep oocytes in different media during breeding and non-breeding seasons. Small Ruminant Res. 43, 31–36. Rideout, W.M., Eggan, K., Jaenisch, R., 2001. Nuclear cloning and epigenetic reprogramming of the genome. Science 293, 1093–1098. Ruddock, N.T., Wilson, K.J., Cooney, M.A., Korfiatis, N.A., Tecirlioglu, R.T., French, A.J., 2004. Analysis of imprinted messenger RNA expression during bovine preimplantation development. Biol. Reprod. 70, 1131–1135. Shirazi, A., Shams-Esfandabadi, N., Hosseini, S.M., 2005. A comparison of two recovery methods of ovine oocytes for in vitro maturation. Small Ruminant Res. 58, 283–286. Smith, J.T., Clarke, I.J., 2010. Seasonal breeding as a neuroendocrine model for puberty in sheep. Mol. Cell. Endocrinol. 324, 102–109. Thurston, A., Taylor, J., Gardner, J., Sinclair, K.D., Young, L.E., 2008. Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage. Reproduction 135, 29–40. Todini, L., Malfatti, A., Valbonesi, A., Trabalza-Marrinucci, M., Debenedetti, A., 2007. Plasma total T3 and T4 concentrations in goats at different physiological stages, as affected by the energy intake. Small Ruminant Res. 68, 285–290. Wani, N.A., Wani, G.M., Khan, M.Z., Salahudin, S., 2000. Effect of oocyte harvesting technique on in vitro maturation and in vitro fertilization in sheep. Small Ruminant Res. 36, 63–67. Weinstein, L.S., Chen, M., Xie, T., Liu, J., 2006. Genetic diseases associated with heterotrimeric G proteins. Trends Pharmacol. Sci. 27, 260–266. Xu, B.S., Zhang, K.X., Huang, Y.Q., 2009. Lin28 modulates cell growth and associates with a subset of cell cycle regulator mRNAs in mouse embryonic stem cells. RNA 15, 357–361. Young, L.E., Schnieke, A.E., McCreath, K.J., Wieckowski, S., Konfortova, C., Fernandes, K., Ptak, G., Kind, A.J., Wilmut, I., Loi, P., Loi, P., Feil, R., 2003. Conservation of IGF2-H19 and IGF2R imprinting in sheep: effects of somatic cell nuclear transfer. Mech. Dev. 120, 1433–1442. Yu, Y., Song, X.M., Du, L.X., Wang, C.D., 2009. Molecular characterization of the sheep CIB1 gene. Mol. Biol. Rep. 36, 1799–1809. Zhong, X.M., Li, N., Liang, S., Huang, Q.H., Coukos, G., Zhang, L., 2010. Identification of microRNAs regulating reprogramming factor LIN28 in embryonic stem cells and cancer cells. J. Biol. Chem. 285 (53), 41961–41971.
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Differences in DNA methylation and mRNA levels between the breeding and non-breeding seasons of in vitro produced IVF and SCNT sheep embryos Song Hua 1 , Yongsheng Wang 1 , Hao Wu, Fusheng Quan, Hui Zhang, Yong Zhang ∗ College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi Province 712100, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 24 April 2012 Received in revised form 26 March 2013 Accepted 12 April 2013 Available online 8 May 2013
Keywords: Sheep IVF SCNT Season DNA methylation Embryo development
a b s t r a c t In this study, Small Tail Han sheep embryos were produced in the breeding and nonbreeding seasons by in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT). Oocyte recovery and maturation rate, embryo development and blastocyst cell number were evaluated in a series of four experiments using either a 2 treatment (breeding vs. non-breeding season) × 5 replicates or a 2 seasons × 2 embryo types (IVF vs. SCNT) × 5 replicates design. In addition, methylation levels of pluripotent genes (OCT4, SOX2 and LIN28) and imprinted genes (IGF2, IGF2R and GNAS) in matured oocytes and blastocysts, and the expression of these genes in blastocysts were assessed. The number (mean ± SEM) of oocytes recovered per ovary was not significantly different between breeding seasons (3.61 ± 0.22) and non-breeding season (3.33 ± 0.43, P > 0.05); but the percentage of acceptable oocytes and oocyte maturation rate in breeding season (56.4 ± 5.4%, 66.4 ± 8.7%) were significantly higher than those in non-breeding season (44.2 ± 4.3%, 41.8 ± 10.5%, P < 0.05), and the blastocyst formation rates and the cell numbers of blastocyst were significantly higher in breeding season than those in non-breeding season (P < 0.05). Methylation levels of the genes studied were not significantly different between seasons in matured oocytes. SCNT produced blastocysts had significantly higher (P < 0.05 to P < 0.01) methylation levels for OCT4, SOX2 and IGF2, and significantly lower (P < 0.01) methylation levels for GNAS and IGF2R than IVF embryos. Methylation levels for LIN28 did not differ between embryo types. Blastocysts produced in the breeding season had significantly lower methylation levels for OCT4 (P < 0.05) and IGF2 (P < 0.01), and significantly higher levels for IGF2R (P < 0.01). Differences in methylation levels between embryo types were not significant for SOX2, LIN28 and GNAS. IVF blastocysts had a significantly higher (P < 0.05 to P < 0.01) expression levels for OCT4, SOX2 and LIN28 genes, and a significantly lower expression level for the IGF2R gene (P < 0.01) than SCNT blastocysts. Blastocysts produced in the breeding season had significantly higher (P < 0.01) expression levels for OCT4 and SOX2 genes and a significantly lower (P < 0.05) transcript level for the IGF2R gene than in the non-breeding season. No expression of IGF2R or GNAS genes was detected in IVF produced blastocysts and an extremely weak signal was observed in SCNT blastocysts. It is concluded that the season in which oocytes are collected from Small Tail Han sheep significantly affects the number recovered, their quality, maturation rate and development to blastocysts. Season also significantly affects the methylation and transcript levels of some important genes in embryos produced from these oocytes. These effects may be associated with the subsequent developmental potential of the embryos. © 2013 Elsevier B.V. All rights reserved.
∗ Corresponding author. Tel.: +86 29 87080092; fax: +86 29 87080085. E-mail address: [email protected] (Y. Zhang). 1 These authors contributed equally to the paper. 0921-4488/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.smallrumres.2013.04.005
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
391
1. Introduction
2. Materials and methods
Sheep characterized by seasonal reproduction show seasonal variations in their ovulation frequency (ovulation or anovulation), sperm production (from moderate decrease to complete absence), gamete quality (marked by fertilization rates and embryo survival), and also sexual behaviour (Chemineau et al., 2008). Most sheep breeds show distinct seasonal patterns in ovarian function, with ovulatory cycles occurring in the autumn and winter (the breeding season) and anovulation in the spring and summer (non-breeding season or anoestrous season). This ensures that all ewes become pregnant in the late summer or early autumn, and insure that births occur at the optimal time of the year, the early spring or late winter, which allows the lambs to grow under favourable conditions of temperature and feed availability, and maximize their chances of survival (Goodman et al., 2010). In northwest China (longitude 75–110◦ E, latitude 34–45◦ N) the normal breeding season in sheep is from September to March, and the period April to August is the out-of-breeding season during which the sheep do not exhibit oestrus (seasonal anoestrus). Recipient oocytes are critical for the reprogramming of SCNT embryos and embryonic development. DNA methylation plays a key role in reprogramming, and can result in gene silencing and heterochromatin formation (Rideout et al., 2001; Lachner and Jenuwein, 2002), precise DNA methylation patterns are crucial in the early development, especially for some pluripotent genes such as OCT4, SOX2 and LIN28, and imprinted genes such as GNAS, IGF2 and IGF2R. In preimplantation mammalian development the transcription factor SOX2 forms a complex with OCT4 and functions in maintenance of self-renewal of the pluripotent inner cell mass (ICM) (Keramari et al., 2010). LIN28 is an evolutionarily conserved RNA-binding protein, which is important to embryogenesis and may be a master regulator controlling the pluripotency of embryonic stem cells (ESC) (Zhong et al., 2010). In addition, DNA methylation is also an important regulator of imprinted genes and their expression, and improper imprints of these genes can cause developmental abnormalities (Ruddock et al., 2004). IGF2 is paternally expressed, while IGF2R is maternally expressed. Interestingly, GNAS is maternally expressed in the foetus, but then paternally expressed in the chorioallantois (Thurston et al., 2008). Assisted reproduction technologies (ART) such as IVF and SCNT have been used to increase sheep reproductive rate, and improve the varieties and breeds (Fletcher et al., 2007), as well as to overcome seasonal limitations. The outcome of ART may differ between seasons in animals that exhibit seasonal patterns of reproduction. The effects of reproductive seasons on the embryonic development are not well understood in respect of ART in ovine. To investigate the potential differences in embryo development during the breeding and non-breeding seasons, oocytes from Small Tail Han sheep were collected and matured in vitro, and were used to construct SCNT and IVF embryos, the resultant embryo development, methylation patterns as well as expression levels of representative genes were compared and analyzed.
Unless otherwise stated, all chemicals were purchased from Sigma Chemical Co. USA. Disposable plastic-ware was purchased from Nunclon (Roskilde, Denmark). All procedures associated with animal were approved by Animal Care and Ethical Standards issued by Northwest A&F University. 2.1. Oocytes collection and maturation in vitro Small Tail Han Sheep ovaries were collected from a local abattoir, and transported to the laboratory within 3 h post-slaughter. Cumulus cell–oocyte complexes (COC) were aspirated from the follicles (3–6 mm in diameter) with a 9# needle attached to a plastic 10 ml syringe using PBS (phosphate buffered saline). After that, the COC were divided into three grades based on morphology in the laboratory prior to maturation culture (good, oocytes with a homogeneous cytoplasm and more than five compact layers of cumulus cells: fair, oocytes with less than or five layers cumulus cells, and with a homogeneous cytoplasm, and poor, oocytes without cumulus cells and with heterogeneous cytoplasm or with some scattered cumulus cells) (Wani et al., 2000). Only COC of acceptable quality (good and fair) was selected for in vitro maturation. In vitro oocyte culture was performed as described previously (Berlinguer et al., 2008). Those oocytes that were observed to have the first polar body were considered mature oocytes, otherwise they were referred to as immature oocytes. 2.2. Preparation of donor somatic cells and in vitro fertilization (IVF) Foetal fibroblast cells were isolated from sheep foetus (3.5 months), and the detailed procedure was carried out according to the reference (Hua et al., 2011). After two subpassages, the cells were frozen and stored in liquid nitrogen. To prepare donors for SCNT, cells were thawed and cultured in DMEM containing 10% foetal bovine serum (FBS) and 0.1% gentamicin in plastic culture dish in advance. Preparation of sperm and IVF were performed as described by Machado et al. (2009). Finally, the presumptive embryos were washed three times with culture medium and cultured under the same conditions as SCNT embryos. 2.3. Nuclear transfer, embryos culture and cell count of blastocysts Nuclear transfer was carried out according to the method described by Hua et al. (2008) with some modifications. Matured oocytes were enucleated by aspirating the first polar body and the adjacent cytoplasm containing metaphase II spindle. The successful enucleation was confirmed by Hoechst 33342 staining. Then a donor cell was transferred to the perivitelline space of the enucleated oocyte. Cell–oocyte complexes were placed into fusion medium (0.3 M mannitol, 0.1 mM Mg2+ and 0.05 M Ca2+ ) in a fusion chamber and a pulse of 1.2 kV cm−1 for 20 s was applied to induce the cells to fuse. After fusion, the couplets were activated by exposure to 5 M ionomycin in TCM199 for 5 min, followed by a 4 h incubation in 2 mM 6-dimethylaminopurine. Presumptive zygotes were cultured in groups of 50. Development rates of 2-cell, 8-cell, 16-cell and blastocysts were examined at time point of 48 h, 72 h, 108 h and 168 h, respectively. At each time point, corresponding embryos were transferred to fresh medium and cultured in groups of 30. Activated embryos were cultured at 38.5 ◦ C in an atmosphere of 5% CO2 in air, with maximum humidity. Cell number of blastocysts was determined by staining embryos with the fluorescent bisbenzimidazole Hoechst dyes, described previously by Pursel et al. (1985). 2.4. Sodium bisulfite genomic sequencing To analyze the methylation difference in the pluripotent gene promoter (OCT4, SOX2 and LIN28) and imprinted gene exon 1 (GNAS, IGF2 and IGF2R), mature oocytes and blastocysts produced by SCNT and IVF were analyzed using sodium bisulfite genomic sequencing. Five subsets of 10 oocytes or embryos per treatment were used to carry out the sodium bisulfite treatment by an EZ DNA Methylation-DirectTM Kit (Zymo Research, Los Angeles, CA, USA) according to the manufacturer instructions. Converted DNA was amplified with Zymo TaqTM DNA Polymerase (Zymo Research, Los Angeles, CA, USA) using specific primers (Table 1) designed using
392
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
Table 1 Primer sequences for sodium bisulfite genomic sequencing of in vitro matured oocytes recovered from Small Tail Han sheep and blastocysts produced by in vitro fertilization (IVF) or by somatic cell nuclear transfer (SCNT). Gene OCT4 (Accession No. HM118848) SOX2 (Accession No. X96997)
Sequencing primers (5 –3 ) Left: GATTTGGATGAGTTTTTAAGGGTT Right: ACTCCAACTTCTCCTTATCCAACTT Left: TATTAAAAGAGTAAATTTAAGATTAAGTT Right: CAAATTAATAAACAACCATCCATATAAC
Position on the full-gene sequence
Tm (◦ C)
7–122
55.5
1021–1303
55.0
LIN28 (Accession No. GQ131421)
Left: TAAATTAGTAGTTTGTAGGTGGTTG Right: ACAACTTACTCTAATACACAAAAAC
14–238
55.5
GNAS (Accession No. AY376066) (Thurston et al., 2008)
Left: GTATGTTAAGGTTTTTTGGGAGGAT Right: AATCTCAAAAATTCCAAAAATCAAA
181–411
59.0
IGF2 (Accession No. M89789)
Left: TTAATGGGGATTATAGTAGGAAAGT Right: AATAAATCTCCAACAAAACCAAATC
935–1043
55.0
IGF2R (Accession No. AF353513)
Left: TGGAATTTTTGAGGGTTTAAATATT Right: ACCCAATCTCAACAAATAATTCATT
204–382
57.0
online software (http://www.urogene.org/methprimer/). Reaction conditions were 95 ◦ C for 8 min followed by, 40 cycles of 94 ◦ C for 45 s, 56 ◦ C for 30 s, and 72 ◦ C for 30 s. PCR products were purified using ZymocleanTM Gel DNA Recovery Kit (Zymo Research, Los Angeles, CA, USA), and cloned into a pMD18-T vector (Takara Biotech, Dalian, China), followed by transforming into Escherichia coli strain DH5˛. Finally, individual clones were sequenced (Takara Biotech, Dalian, China) and methylation percentages were calculated based on the total number of cytosine molecules and the number of converted cytosine within the fragment amplified. 2.5. Expression analysis by RT-qPCR Semi-quantitative RT-qPCR was performed to determine the expression levels of the studied genes. Total mRNA was extracted from the four groups of blastocysts (breeding season IVF and SCNT, non-breeding IVF and SCNT) using a High Pure Viral RNA kit (Roche, Germany), each with five subsets of 10 intact embryos. Sheep GAPDH was used as reference gene. cDNA and positive control were prepared using the High Fidelity PrimeScriptTM RT-PCR Kit (Takara Biotech, Dalian, China), according to the manufacturer’s instructions. Negative controls contained all cDNA synthesis components but no sample RNA. QPCR reactions for the reference gene and target genes were carried out with three parallel tests (primers listed in Table 2). Each reaction was run in 25 l reaction mixtures with 12.5 l SYBR Premix Ex TaqTM (Takara Biotech, Dalian, China), 0.5 l each primer (about 0.5 m), 1.5 l distilled water, and 10 l of template cDNA (about 0.1 pm). The reaction conditions were as follows: 94 ◦ C for 40 s, followed by 45 cycles at 94 ◦ C for 30 s, 55 ◦ C for 40 s, and 72 ◦ C for 30 s. The threshold cycle was normalized to the reference gene GAPDH. RT-qPCR was performed using a SmartCycler (Cepheid, USA). The same experiments were repeated five times. The expression level was calculated using the 2−Ct method as previously described (Livak and Schmittgen, 2001). Samples for the methylation and DNA analyses were prepared by extracting the DNA and RNA from oocytes and embryos in each season and storing the samples at −80 ◦ C until the samples from both seasons could be analyzed at the same time. 2.6. Experiments and experimental designs 2.6.1. Experiment 1 The effect of season on oocyte maturation was studied in Experiment 1. There were two treatments (breeding season vs. non-breeding season) each replicated five times in this experiment. Oocytes were collected in each season and those of acceptable quality cultured in groups of 80–100 for 24 h. The experiment was concluded at the end of maturation. 2.6.2. Experiment 2 Presumptive zygotes were cultured in groups of 50. Development rates of 2-cell, 8-cell, 16-cell and blastocysts were examined at time point of 48 h, 72 h, 108 h and 168 h, respectively. At each time point, corresponding embryos were transferred to fresh medium and cultured in groups of 30. Differences in the frequencies of embryos undergoing cleavage or developing to 8-cell, 16-cell, and blastocyst stages, as well as the mean cell number of blastocyst were determined using a 2 × 2 × 5 factorial design to
decide the effect of seasons (breeding vs. non-breeding) and embryo types (SCNT vs. IVF) on embryonic development, and the raw data were arcsine square-root-transformed prior to testing for homogeneity of variance. 2.6.3. Experiment 3 Differences between breeding and non-breeding seasons in the methylation levels of genes recovered from matured oocytes were analyzed using a 2 treatments (seasons) × 5 replicates experimental design. The effect of seasons (breeding vs. non-breeding) and embryo types (SCNT vs. IVF) on the methylation levels were compared using a two-way ANOVA in a 2 × 2 × 5 factorial design. 2.6.4. Experiment 4 The expression levels of each gene were analyzed by the 2 × 2 × 5 factorial design to determine whether differences in levels of mRNA expression were significant for embryos generated by embryo types (SCNT vs. IVF) and seasons (breeding vs. non-breeding). 2.7. Statistical analysis All statistical analyses were performed with SPSS version 10.0 and data are shown as mean ± standard error of mean (SEM). The data were arcsine square-root-transformed, wherever necessary, for homogeneity of variance. A probability level of P ≤ 0.05 was considered significant. Each experiment was repeated five times.
3. Results 3.1. Oocyte collection and maturation The total number of oocytes recovered per ovary was not significantly different between the breeding and nonbreeding seasons (3.61 ± 0.22 vs. 3.33 ± 0.43, P > 0.05), but the percentage of acceptable oocytes was significantly higher in the breeding season (56.4 ± 5.4% vs. 44.2 ± 4.3%, P < 0.05) and these oocytes had a higher maturation rates (66.4 ± 8.8% vs. 41.9 ± 10.5%, P < 0.05) (Table 3). 3.2. Development of embryos The SCNT and IVF embryos were cultured in the same conditions during breeding and non-breeding seasons (Table 4). The cleavage rate of SCNT embryos in breeding season was markedly higher than that in non-breeding season (61.2 ± 4.6% vs. 53.1 ± 3.8%, P < 0.05), but no significant difference of cleavage rare in IVF embryos between breeding and non-breeding seasons (overall mean 82.5 ± 6.1%)
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
393
Table 2 Primer sequences used for RT-qPCR of blastocysts produced by in vitro fertilization (IVF) or somatic cell nuclear transfer (SCNT) using in vitro matured oocytes recovered from Small Tail Han sheep. Gene
Sequencing primers (5 –3 )
Position on the full-gene sequence
Tm (◦ C)
OCT4 (Accession No. HM118848)
Left: GATTTGGATGAGTTTTTAAGGGTT Right: ACTCCAACTTCTCCTTATCCAACTT
23–220
54.5
SOX2 (Accession No. X96997)
Left: AGCCAAATCAGAACCAGG Right: GCCAGAGTAATCTAAACACCC
2687–2860
55.0
LIN28 (Accession No. GQ131421)
Left: TAAATTAGTAGTTTGTAGGTGGTTG Right: ACAACTTACTCTAATACACAAAAAC
332–547
56.5
GNAS (Accession No. AY376066) (Thurston et al., 2008)
Left: AGCGACCAGGATCTGCTCCGCT Right: CTGACGGTAGTAGAAGCACCA
465–631
57.0
IGF2 (Accession No. M89789)
Left: GCCGGCTTCCAGACATCAAT Right: CCTCTTCGACCGTGCTTCC
920–1224
55.0
IGF2R (Accession No. AF353513)
Left: GATGAGTGTCTCATCAACTCT Right: CCTTTGTCGCGAAGCTGGAC
1078–1239
57.0
GAPDH (Accession No. AF030943) (Yu et al., 2009)
Left: CTGCTGACGCTCCCATGTTTGT Right: TAAGTCCCTCCACGATGCCAAA
562–450
60.0
Table 3 Oocytes recovered post-mortem from Small Tail Han sheep and their in vitro maturation rate in the breeding and non-breeding seasons. Source
Breeding season
Number of ovaries Number of oocytes Number of oocytes per ovary Percentage of acceptable oocytes Maturation rate
262 994 3.61 ± 0.22a 56.4 ± 5.4%a 66.4 ± 8.7%a
Non-breeding season
P-value
320 1066 3.33 ± 0.43a 44.2 ± 4.3%b 41.8 ± 10.5%b
>0.05 <0.05 <0.05
Different lower-case letters indicate significant differences (P < 0.05).
was observed. From the 8-cell stage to the blastocyst stage, the development rates of embryos produced from oocytes recovered during the breeding season were significantly higher (P < 0.05) than those from non-breeding season irrespective of the method of embryo production. Furthermore, the development rates of IVF embryos at various stages were markedly higher compared with SCNT embryos in the same season. The number of blastomeres per embryo produced in the breeding season was significantly higher than in the non-breeding season both for SCNT embryos (58.7 ± 5.6 vs. 42.0 ± 4.1, P < 0.01, Fig. 1, Table 4) and IVF embryos (85.4 ± 4.1 vs. 71.4 ± 4.2, P < 0.01); and the number of cells per blastocyst was significantly higher (P < 0.05) for IVF than SCNT embryos in both seasons.
3.3. Methylation levels of pluripotent and imprinted genes The results showed that the methylation patterns of promoter regions of the three pluripotent genes in matured oocytes were not significantly different between the breeding and non-breeding seasons; and for the three imprinted genes, the methylation patterns of exons were similar between breeding and non-breeding seasons (Fig. 2). No statistically significant interactions between embryo type and breeding season were observed in respect of methylation levels for any of the genes studied. Consequently, only the overall main effect means are presented in Fig. 3.
Table 4 Development rate of Small Tail Han sheep embryos produced by in vitro fertilization (IVF) or by somatic cell nuclear transfer (SCNT) during the breeding or non-breeding season. Development stage
IVF
SCNT
Breeding 2-Cell embryos 8-Cell embryos 16-Cell embryos Blastocysts Cell number of blastocysts
84.2 73.9 57.8 46.6 85.4
± ± ± ± ±
5.5a 4.6a 3.4a 3.5a 4.1a
Non-breeding 80.7 61.7 46.7 30.5 71.4
± ± ± ± ±
7.8a 5.6b 3.4b 2.6b 4.2b
P-value
Breeding 61.2 53.5 38.6 20.2 58.7
± ± ± ± ±
4.6b 5.2c 2.1c 1.2c 5.6c
Non-breeding 53.1 40.5 32.3 13.7 42.0
± ± ± ± ±
3.8c 3.7d 2.5d 1.7d 4.1d
Season
Embryo type
Season × embryo type
<0.05 <0.05 <0.01 <0.01 <0.01
<0.05 <0.05 <0.05 <0.05 <0.05
>0.05 >0.05 >0.05 >0.05 >0.05
Development rates (%) are based on the number of presumptive zygotes for IVF or the number of putative embryos after SCNT on Day 0 of culture; values are mean ± SEM. Values within a row with different superscripts are significantly different (P < 0.05).
394
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
Fig. 1. Representative photographs of Small Tail Han sheep blastocysts produced by somatic cell nuclear transfer. (A) Somatic cell nuclear transfer blastocysts produced in non-breeding season; (B) somatic cell nuclear transfer blastocysts produced in breeding season; (C) somatic cell nuclear transfer blastocysts derived from the non-breeding season stained with Hoechst33342; (D) somatic cell nuclear transfer blastocysts derived from the breeding season stained with Hechst33342.
Fig. 3.1 shows that SCNT blastocysts had significantly higher methylation levels for OCT4 (P < 0.05), SOX2 (P < 0.01) and IGF2 (P < 0.01), and significantly lower methylation levels for GNAS (P < 0.01) and IGF2R (P < 0.01) than IVF blastocysts. The methylation levels for LIN28 did not differ between embryo types. Blastocysts produced in the breeding season had significantly lower methylation levels for OCT4 (P < 0.05) and IGF2 (P < 0.01), and significantly higher levels for IGF2R
(P < 0.01). The differences in methylation levels between seasons were not significant for SOX2, LIN28 and GNAS (Fig. 3.2). 3.4. Expression of pluripotent and imprinted genes No statistically significant interactions between embryo type and breeding season were observed in respect of the expression of any of the pluripotent and imprinted genes
Fig. 2. Methylation levels (%) of pluripotent and imprinted genes in vitro matured oocytes recovered in the breeding or non-breeding season of Small Tail Han sheep. Within a gene, columns with different superscripts are significantly different; P < 0.05.
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
395
Fig. 3. Methylation levels (%) of pluripotent and imprinted genes in blastocysts produced by different methods (in vitro fertilization, IVF vs. somatic cell nuclear transfer, SCNT; 3.1) using in vitro matured oocytes recovered in different seasons (breeding vs. non-breeding season; 3.2) from Small Tail Han sheep. The level of statistical significance for the difference between treatments within a gene is indicated by asterisks viz. *P < 0.05, **P < 0.01.
studied. Consequently, only the overall main effect means of the comparative expression levels relative to the internal control using the ddCt method are presented in Fig. 4. IVF blastocysts had a significantly higher expression level for OCT4 (P < 0.01), SOX2 (P < 0.01) and LIN28 (P < 0.05) genes, and a significantly lower expression level for the IGF2R gene (P < 0.01) than SCNT blastocysts (Fig. 4.1). Blastocysts produced in the breeding season had a significantly higher (P < 0.01) expression levels for OCT4 and SOX2 genes and a significantly lower (P < 0.05) transcript level for the IGF2R gene than those produced in the nonbreeding season (Fig. 4.2). No expression of IGF2R or GNAS genes could be detected in IVF produced blastocysts in either season and an extremely weak signal was observed in SCNT blastocysts although RT-qPCR conditions were optimized. 4. Discussion 4.1. Oocyte maturation and embryonic development The mean number of oocytes recovered per ovary varied from 3.33 ± 0.43 (non-breeding season) to 3.61 ± 0.22 (breeding season), which was higher than the 2.17 oocytes per ovary reported by Datta et al. (1993) and 1.32 by Rao et al. (2002), but lower than the 6.3 oocytes/ovary reported by Shirazi et al. (2005). The cause of this discrepancy needs further evaluation. In addition, the extrusion of the first
polar body was observed more obviously after in vitro oocyte maturation in breeding season than in non-breeding season. It suggested that reproductive seasons influenced the development and maturation of oocytes (Smith and Clarke, 2010). The development, maturation and ovulation of sheep oocytes are regulated by series hormones such as oestrogen, progesterone, lutenizing hormone, follicle stimulating hormone and prolactin, and this control in vivo is different between breeding and non-breeding seasons (Todini et al., 2007). Previous study reported that the transition from the non-breeding season to the breeding season represented a mechanism similar to the onset and offset of puberty with biological changes including several neurosecretory factors and/or hormones (Smith and Clarke, 2010). In addition, during breeding and non-breeding seasons, hormones (such as oestradiol and luteinizing hormone) pulse frequency and amplitude are different (Goodman et al., 1982; Martin et al., 1983). This variety of reproductive hormone level may be associated with climatic conditions and nutrition (Todini et al., 2007). 4.2. Methylation patterns DNA methylation is a major epigenetic modification for SCNT embryos, and is involved in transcriptional suppression of important genes (Edwards, 2006). In this study, SCNT blastocysts had significantly higher methylation
396
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
Fig. 4. The expression of pluripotent and imprinted genes in blastocysts produced by different methods (in vitro fertilization, IVF vs. somatic cell nuclear transfer, SCNT; 4.1) using in vitro matured oocytes recovered in different seasons (breeding vs. non-breeding season; 4.2) from Small Tail Han sheep. The level of statistical significance for the difference between treatments within a gene is indicated by asterisks viz. *P < 0.05, **P < 0.01.
levels for OCT4, SOX2 and IGF2, and significantly lower methylation levels for GNAS and IGF2R than IVF blastocysts: the methylation levels for LIN28 did not differ between embryo types. These results show that the reprogramming of OCT4, SOX2, IGF2, GNAS, and IGF2R in early ovine embryos is affected by embryo type. Previous study reported that LIN28 is bound to mRNAs and regulated their stability and post-transcriptional translation (Xu et al., 2009). In this study, the methylation pattern of LIN28 was similar for both IVF and SCNT blastocysts suggesting that LIN28 was more easily reprogrammed than other genes in sheep embryos. In addition, blastocysts produced in breeding season had significantly higher methylation levels for IGF2R, and significantly lower methylation levels for OCT4 and IGF2 than blastocysts produced in non-breeding season: the methylation levels for SOX2, LIN28 and GNAS did not differ between the two seasons. Appropriate imprinting and expression of imprinted genes are important for normal embryo development. GNAS mainly regulates birth weight, obesity and hormone resistance (Weinstein et al., 2006). In addition, IGF2, an imprinted gene that is paternally expressed in embryos, is also involved in normal growth and development (Young et al., 2003). Our data show that the reproductive season has a significant effect on the reprogramming of OCT4, IGF2 and IGF2R in early ovine embryos.
4.3. Gene expression level The study on transcript levels of OCT4, SOX2, LIN28, GNAS, IGF2 and IGF2R in matured oocytes showed that the expression levels of a gene are not affected by the season (breeding or non-breeding) in which the oocytes are recovered. In contrast, the type of embryo did affect gene transcription with IVF blastocysts having significantly higher expression levels for OCT4, SOX2 and LIN28 genes, and significantly lower expression level for the IGF2R gene than SCNT blastocysts. Furthermore, season affected gene expression in blastocysts with those produced in the breeding season having significantly higher expression levels for OCT4 and SOX2 genes and a significantly lower transcript level for the IGF2R gene than for blastocysts produced in the non-breeding season. No expression of IGF2 or GNAS genes could be detected in IVF produced blastocysts in either season and an extremely weak signal was observed in SCNT blastocysts although RT-qPCR conditions were optimized. This was consistent with the previous results that no expression of IGF2 (Lee et al., 2002) and GNAS (Thurston et al., 2008) was observed in sheep blastocysts. One possible explanation for this was that imprinting and expression of GNAS and IGF2 were dynamic during the whole development, while at the blastocyst stage, both genes were not
S. Hua et al. / Small Ruminant Research 113 (2013) 390–397
expressed or the level of expression was below the detection level. Sheep parthenogenetic embryos expressing low levels of IGF2 and high levels of IGF2R were detrimental to embryonic development when compared with normal control (Feil et al., 1998; Young et al., 2003). This implies that normal expression of some genes is required for the embryonic development. Our results show that the development of embryos produced in vitro from oocytes recovered in the non-breeding season is less successful than from those recovered in the breeding season due to the differences in the methylation and expression levels of IGF2R. 5. Conclusion Small Tail Han sheep produced significantly more oocytes that had a higher maturation rate in the breeding than in the non-breeding season. Both SCNT and IVF embryos in the breeding season had lower methylation levels of IGF2 and OCT4, and higher methylation levels of IGF2R than in the non-breeding season. Blastocysts of both types produced in the breeding season had significantly higher mRNA levels of SOX2 and OCT4, and lower levels of IGF2R than in the non-breeding season. It is concluded that the season in which oocytes are collected significantly affects the number, quality and maturation rate of oocytes recovered from Small Tail Han sheep. The methylation and transcript levels of some important genes in the embryos produced from these oocytes are also significantly affected by season and these effects may be associated with the subsequent developmental potential of the embryos. Acknowledgements This work was supported by National Natural Science Foundation of China (31001008). The authors thank the editor and the reviewers for their constructive suggestions to the manuscript. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work. References Berlinguer, F., Gonzalez, R., Succu, S., del Olmo, A., Garde, J.J., Espeso, G., Gomendio, M., Ledda, S., Roldan, E.R.S., 2008. In vitro oocyte maturation, fertilization and culture after ovum pick-up in an endangered gazelle (Gazella dama mhorr). Theriogenology 69, 349–359. Chemineau, P., Guillaume, D., Migaud, M., Thiery, J.C., Pellicer-Rubio, M.T., Malpaux, B., 2008. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications. Reprod. Dom. Anim. 43, 40–47. Datta, T.K., Goswami, S.L., Das, S.K., 1993. Comparative efficiency of three oocyte recovery methods from sheep ovaries. Indian J. Anim. Sci. 63, 1178–1179. Edwards, R.G., 2006. Genetics, epigenetics and gene silencing in differentiating mammalian embryos. Reprod. BioMed. Online 13, 732–753. Feil, R., Khosla, S., Cappai, P., Loi, P., 1998. Genomic imprinting in ruminants: allele-specific gene expression in parthenogenetic sheep. Mamm. Genome 9, 831–834. Fletcher, C.J., Roberts, C.T., Hartwich, K.M., Walker, S.K., McMillen, I.C., 2007. Somatic cell nuclear transfer in the sheep induces placental defects that likely precede fetal demise. Reproduction 133, 243–255.
397
Goodman, R.L., Bittman, E.L., Foster, D.L., Karsch, F.J., 1982. Alterations in the control of luteinizing hormone pulse frequency underlie the seasonal variation in estradiol negative feedback in the ewe. Biol. Reprod. 27, 580–589. Goodman, R.L., Jansen, H.T., Billings, H.J., Coolen, L.M., Lehman, M.N., 2010. Neural systems mediating seasonal breeding in the ewe. J. Neuroendocrinol. 22, 674–681. Hua, S., Zhang, H., Su, J.M., Zhang, T., Quan, F.S., Liu, J., Wang, Y.S., Zhang, Y., 2011. Effects of the removal of cytoplasm on the development of early cloned bovine embryos. Anim. Reprod. Sci. 126, 37–44. Hua, S., Zhang, Y., Song, K., Song, J., Zhang, Z., Zhang, L., Zhang, C., Cao, J., Ma, L.B., 2008. Development of ovine-bovine interspecies cloned embryos and mitochondria segregation in blastomeres during preimplantation. Anim. Reprod. Sci. 105, 245–257. Keramari, M., Razavi, J., Ingman, K.A., Patsch, C., Edenhofer, F., Ward, C.M., Kimber, S.J., 2010. Sox2 is essential for formation of trophectoderm in the preimplantation embryo. PLoS One 5 (11), e13952. Lachner, M., Jenuwein, T., 2002. The many faces of histone lysine methylation. Curr. Opin. Cell Biol. 14 (3), 286–298. Lee, R.S., Depree, K.M., Davey, H.W., 2002. The sheep (Ovis aries) H19 gene: genomic structure and expression patterns, from the preimplantation embryo to adulthood. Gene 301, 67–77. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct method. Methods 25, 402–408. Machado, G.M., Carvalho, J.O., Filho, E.S., Caixeta, E.S., Franco, M.M., Rumpf, R., Dode, M.A.N., 2009. Effect of Percoll volume, duration and force of centrifugation, on in vitro production and sex ratio of bovine embryos. Theriogenology 71, 1289–1297. Martin, G.B., Scaramuzzi, R.J., Henstridge, J.D., 1983. Effects of oestradiol, progesterone and androstenedione on the pulsatile secretion of luteinizing hormone in ovariectomized ewes during spring and autumn. J. Endocrinol. 96, 181–193. Pursel, V.G., Wall, R.J., Rexroad, C.E., Hammer, R.E., Brinster, R.L., 1985. A rapid whole-mount staining procedure for nuclei of mammalian embryos. Theriogenology 24, 687–691. Rao, B.S., Naidu, K.S., Amarnath, D., Vagdevi, R., Rao, A.S., Brahmaiah, K.V., Rao, V.H., 2002. In vitro maturation of sheep oocytes in different media during breeding and non-breeding seasons. Small Ruminant Res. 43, 31–36. Rideout, W.M., Eggan, K., Jaenisch, R., 2001. Nuclear cloning and epigenetic reprogramming of the genome. Science 293, 1093–1098. Ruddock, N.T., Wilson, K.J., Cooney, M.A., Korfiatis, N.A., Tecirlioglu, R.T., French, A.J., 2004. Analysis of imprinted messenger RNA expression during bovine preimplantation development. Biol. Reprod. 70, 1131–1135. Shirazi, A., Shams-Esfandabadi, N., Hosseini, S.M., 2005. A comparison of two recovery methods of ovine oocytes for in vitro maturation. Small Ruminant Res. 58, 283–286. Smith, J.T., Clarke, I.J., 2010. Seasonal breeding as a neuroendocrine model for puberty in sheep. Mol. Cell. Endocrinol. 324, 102–109. Thurston, A., Taylor, J., Gardner, J., Sinclair, K.D., Young, L.E., 2008. Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage. Reproduction 135, 29–40. Todini, L., Malfatti, A., Valbonesi, A., Trabalza-Marrinucci, M., Debenedetti, A., 2007. Plasma total T3 and T4 concentrations in goats at different physiological stages, as affected by the energy intake. Small Ruminant Res. 68, 285–290. Wani, N.A., Wani, G.M., Khan, M.Z., Salahudin, S., 2000. Effect of oocyte harvesting technique on in vitro maturation and in vitro fertilization in sheep. Small Ruminant Res. 36, 63–67. Weinstein, L.S., Chen, M., Xie, T., Liu, J., 2006. Genetic diseases associated with heterotrimeric G proteins. Trends Pharmacol. Sci. 27, 260–266. Xu, B.S., Zhang, K.X., Huang, Y.Q., 2009. Lin28 modulates cell growth and associates with a subset of cell cycle regulator mRNAs in mouse embryonic stem cells. RNA 15, 357–361. Young, L.E., Schnieke, A.E., McCreath, K.J., Wieckowski, S., Konfortova, C., Fernandes, K., Ptak, G., Kind, A.J., Wilmut, I., Loi, P., Loi, P., Feil, R., 2003. Conservation of IGF2-H19 and IGF2R imprinting in sheep: effects of somatic cell nuclear transfer. Mech. Dev. 120, 1433–1442. Yu, Y., Song, X.M., Du, L.X., Wang, C.D., 2009. Molecular characterization of the sheep CIB1 gene. Mol. Biol. Rep. 36, 1799–1809. Zhong, X.M., Li, N., Liang, S., Huang, Q.H., Coukos, G., Zhang, L., 2010. Identification of microRNAs regulating reprogramming factor LIN28 in embryonic stem cells and cancer cells. J. Biol. Chem. 285 (53), 41961–41971.