Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors

G Model ANIREP-5319; No. of Pages 8

ARTICLE IN PRESS Animal Reproduction Science xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors Yi Fang a,1 , Xiaosheng Zhang b,1 , Jinlong Zhang b,1 , Rongzhen Zhong a,1 , Daowei Zhou a,∗,1 a b

Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun, Jilin 130102, P.R. China Animal Husbandry and Veterinary Research Institute of Tianjin, Tianjin 300412, China

a r t i c l e

i n f o

Article history: Received 7 July 2015 Received in revised form 24 November 2015 Accepted 25 November 2015 Available online xxx Keywords: Sheep Methylation Oocyte Embryo Puberty

a b s t r a c t The developmental capacity of in vitro-matured oocytes and in vitro-fertilized embryos from pre-pubertal sheep is less than that of adult counterparts, and epigenetic mechanisms are thought to be involved. In the present study, germinal vesicle stage oocytes were collected by follicular aspiration from superovulated 4-week-old lambs and 2.5-year-old ewes. There were evaluations of the developmental potential of oocytes and embryos by in vitro culture and fertilization, global DNA methylation and hydroxymethylation patterns by immunofluorescence staining, and relative abundance of enzyme mRNA by quantitative real-time polymerase chain reaction analysis in pre-pubertal and adult sheep donors. The results showed that the rates of maturation and cleavage of oocytes as well as pregnancy and lambing rates from the transfer of 2-cell embryos collected from lambs were less than those from adults (P < 0.05). The global DNA methylation and hydroxymethylation and relative abundance of Dnmt1, Dnmt3a, and Tet3 mRNA were less at all stages of oocytes, zygotes, and two-cell embryos from lambs compared with those from adults (P < 0.05) with no difference in relative abundance of Dnmt3b mRNA. Thus, younger donor age was associated with disturbed DNA methylation processes due to insufficient methyltransferases during gametogenesis and early embryonic development, and this may be responsible for the lesser developmental potential of oocytes and early developing embryos when oocytes are collected from lambs. © 2015 Published by Elsevier B.V.

1. Introduction The genetic and economic advantages of using juvenile domestic animals in breeding programs provide ample justification for considering pre-pubertal animals as

∗ Corresponding author. Tel.: +86 431 85542231; fax: +86 431 85542206. E-mail address: [email protected] (D. Zhou). 1 Yi Fang and Xiaosheng Zhang contributed equally to this study.

potential oocyte donors. Despite the ability to select for genetic background and optimize gonadotropin stimulation in pre-pubertal females, embryos, and fetal derived pre-pubertal oocytes frequently fail to develop. Prepubertal oocytes fail to mature in vitro, but the reasons for this failure remain unclear. Most previous studies reported incomplete or deficient cytoplasmic maturation, altered protein synthesis (Kochhar et al., 2002), reduced oocyte size (Kauffold et al., 2005), and impaired metabolism (O’Brien et al., 1996) in pre-pubertal oocytes, suggesting that these deficiencies are plausible reasons for the reduced

http://dx.doi.org/10.1016/j.anireprosci.2015.11.022 0378-4320/© 2015 Published by Elsevier B.V.

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model ANIREP-5319; No. of Pages 8

ARTICLE IN PRESS Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

2

developmental potential (Palmerini et al., 2014). However, a nuclear transfer study revealed that the nucleus of the pre-pubertal oocyte is primarily responsible for its developmental failure (Ptak et al., 2006). Epigenetic mechanisms, specifically DNA methylation dynamics, have been implicated in the lesser developmental capacity of prepubertal oocytes (Zaraza et al., 2010). DNA methylation, which is the process of adding methyl groups to DNA CpG islands, is an epigenetic event that has an important role in gene regulation. The somatic cell genome is, however, relatively stable undergoing increases in demethylation and remethylation during gametogenesis and early embryogenesis (Dean, 2014). A family of methyltransferases (Dnmts) mediates the establishment and maintenance of the dynamic patterns of global genomic DNA methylation. The Dnmt1 is the most abundant methyltransferase and is thought to be largely responsible for maintaining methylation patterns throughout DNA replication. The Dnmt3a and Dnmt3b are both de novo methyltransferases that transfer methyl groups to previously unmethylated CpG dinucleotides (Lee et al., 2015). In addition, 5-hydroxymethylcytosine (5hmC) is obtained through oxidation of 5-methylcytosine (5mC; Tahiliani et al., 2009). This reaction is catalyzed by a family of dioxygenases—the 10-11 translocation (Tet) proteins, which catalyze 5mC to 5hmC by hydroxylating the genome (Pastor et al., 2013). Pre-pubertal oocytes are epigenetically immature, and epigenetics has been proposed to be involved in the acquisition of full developmental competence by pre-pubertal oocytes. Previous studies have shown that DNA methylation is less in pre-pubertal sheep germinal vesicle (GV)-stage oocytes compared with that of adult counterparts (Ptak et al., 2006), and that methylation status of the BTS sequence changes are associated with donor age in cows (Mike et al., 2012). Epigenetically immature oocytes can result in epigenetic mosaicism or a loss of methylation imprinting of maternal alleles in embryos (Obata et al., 2011). Thus, the correct epigenetic modifications of the maternal genome necessary for full-term development have an important role during oocyte maturation (Katari et al., 2009). It was, therefore, hypothesized that pre-pubertal oocytes were epigenetically immature because DNA methylation dynamics did not result in methylation events during in vitro maturation so as to have adult-like oocyte methylation patterns. Thus, the present study investigated potential epigenetic mechanisms leading to the loss of oocyte development potential in lambs by determining whether global genomic methylation changes are associated with donor age. Specifically, relative abundance was determined for 5mC and 5hmC, as well as the abundance of Dnmt1, Dnmt3a, Dnmt3b, and Tet3 mRNA in various oocyte stages and during early embryonic development.

2. Materials and methods All procedures involving animals were approved by the Chinese Academy of Science Animal Care and Use

Committee. All chemicals were purchased from SigmaAldrich (St. Louis, MO, USA). 2.1. Experimental design GV-stage oocytes were collected from Small-tail Han and Dorper crossbred 4-week-old lamb donors (n = 24) and 2.5-year-old ewes (n = 34) produced by natural mating. Samples of oocytes at the GV, germinal vesicle breakdown (GVBD), metaphase I (MI), and metaphase II (MII) stages, as well as zygotes and two-cell embryos were collected during in vitro maturation (IVM) and in vitro fertilization (IVF) for immunofluorescence staining, quantitative real-time polymerase chain reaction (qRT-PCR), and the embryos were transferred to recipient ewes. A total of 1380 oocytes were obtained by superovulation in the lamb group; 286 were used to assess oocyte developmental potential, 683 were used for immunofluorescence staining (Table 1), and 411 were used to detect relative abundance of Dnmts and Tet3 mRNA. A total of 1097 oocytes were obtained by superovulation in the adult group; 204 were used to assess oocyte developmental potential, 513 were used for immunofluorescence staining (Table 1), and 380 were used to detect relative abundance of Dnmts and Tet3 mRNA. 2.2. In vivo oocyte collection All donors were subjected to a superovulation protocol. Adult donors were treated with an intravaginally controlled progesterone release device (CIDR) (Pharmacia and Upjohn Co., Rydalmere, NSW, Australia) and folliclestimulating hormone (FSH; Sansheng, Ningbo, China). The CIDR was inserted into the vagina on Day 0 (Beginning of estrus synchronization treatment). The FSH (total dose, 300 IU) was administered intramuscularly every 12 h for 4 days beginning on Day 9. The CIDR was removed on Day 12, and pregnant mare serum gonadotropin (PMSG; Sansheng) was administered intramuscularly (total dose, 360 IU). Cumulus oocyte complexes (COC) were collected 54 h after removing the CIDR. The donor lambs were treated with FSH injected intramuscularly every 12 for 2 days (total dose, 250 IU). The PMSG (total dose, 250 IU) was administered intramuscularly at the time of the last FSH treatment. The COC were collected 14 h after the PMSG administration. These are standard hormone doses to superovulate healthy adult and lamb donors. The COC were collected by follicular aspiration from ovaries. Briefly, the donors were anaesthetized with acepromazine maleate (0.05 mg/kg body weight) and sodium pentothal (10 mg/kg body weight). The ovaries were exposed after opening the abdominal cavity. The COC were aspirated from visible follicles (2–5 mm) using a 10 ml syringe equipped with an 18 gauge needle and seeded in M199 medium supplemented with 25 mM HEPES, 10 ␮g/mL heparin, and 0.4% fatty acid-free bovine serum albumin (BSA). The reproductive organs were washed extensively with saline after puncturing the follicles to avoid adhesions.

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model

ARTICLE IN PRESS

ANIREP-5319; No. of Pages 8

Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

3

Table 1 Number of oocytes and embryos used per group for 5mC and 5hmC immunostaining. GV

5mC 5hmC

GVBD

MI

MII

Zygote

2-Cell

Adult

Lamb

Adult

Lamb

Adult

Lamb

Adult

Lamb

Adult

Lamb

Adult

Lamb

31 29

34 25

24 21

19 17

23 23

18 21

25 20

21 26

19 23

21 18

20 17

17 19

5hmC, 5-hydroxymethylcytosine; 5mC, 5-methylcytosine.

2.3. In vitro maturation The maturation medium contained 20% (v/v) heatinactivated estrous sheep serum, 10 ␮g/mL FSH, 10 ␮g/mL luteinizing hormone, 10 ng/mL epidermal growth factor, and 1 ␮g/mL estradiol-17␤ in TCM199 medium. Each drop contained 50 ␮L in vitro maturation medium that was equilibrated in a CO2 incubator for 2 h before the COC were placed in the medium. Each group of 15 oocytes was cultured in a 50 ␮L drop of maturation medium in humidified air with 5% CO2 at 39 ◦ C for 24 h. Oocytes were collected at different times based on meiotic progression status during IVM: GV, 0 h; GVBD, 8 h; MI, 12 h; and MII, 24 h (Tang et al., 2007). After collection, the cumulus cells were removed by treatment with 0.5% (w/v) hyaluronidase in TCM-199 (Gibco/BRL, Grand Island, NY, USA). Maturation rates were recorded during the first 24 h of the culture period. 2.4. In vitro fertilization and in vitro culture The oocytes were fertilized with the same ram fresh sperm in synthetic oviduct fluid medium containing 20% (v/v) estrous sheep serum and 10 ␮g/mL heparin (in IVF medium) in the incubator. The IVF drops were prepared and equilibrated in an incubator for 2 h before insemination. The volume of each drop was 40 ␮L. Groups of up to five oocytes were transferred into the IVF drops. Sperm concentration was calculated using a hemocytometer and diluted to 1 × 106 cells/mL with IVF medium. Subsequently, there was 10 ␮L of the sperm suspension added to the 40 ␮L IVF drops. The gametes were co-incubated at 39 ◦ C in a 5% CO2 humidified air atmosphere for 22 h. At approximately 22 h following the addition of semen to the culture medium, presumptive zygotes were washed in synthetic oviductal fluid (SOF) medium to remove spermatozoa before being transferred to 50 ␮L culture droplets of SOF supplemented with 1% (v/v) Basal Medium Eagle-essential amino acids, 1% (v/v) Modified Eagle Medium-nonessential amino acids, 1 mM glutamine, and 6 mg/mL fatty acid-free BSA under mineral oil. The contents of the dishes were incubated at 39 ◦ C in a 5% CO2 , 5% O2 , 90% N2 humidified atmosphere. Cleavage rates were recorded 48 h after adding semen for IVF purposes. 2.5. Immunocytochemical staining of oocytes and embryos The oocytes and embryos used for staining were permeabilized with 1% Triton X-100 (Beyotime, Shanghai, China) in phosphate-buffered saline (PBS) for 30 min and then treated in 2 M HCl (Beyotime) for 30 min at 25 ◦ C.

Non-specific binding was inhibited with 0.1% BSA (Beyotime) for 30 min at room temperature, and the oocytes and embryos were incubated with anti-5meC antibodies (1:500; Epigentek Group Inc., Farmingdale, NY, USA) at 4 ◦ C overnight. The oocytes and embryos were washed extensively and probed with fluorescein isothiocyanateconjugated anti-mouse IgG (1:100; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) for 1.5 h at 37 ◦ C. DNA was visualized by counterstaining with 10 ␮g/mL propidium iodide for 10 min. After extensive washing, the oocytes were incubated in PBS containing 10% triethylenediamine. The oocytes were then mounted on slides, and fluorescence was detected with an Olympus BX40 spectral confocal scanning microscope (Olympus Corp., Tokyo, Japan) at excitation wavelengths of 488 nm and 543 nm. The system settings were held constant for all examinations. Fluorescence intensity was quantified using FV10-ASW 3.0 Free Viewer software (Olympus), as described by Aoki (Aoki et al., 1997) with minor modifications. In brief, the fluorescence pixel value within a defined area was measured from 10 different chromosomal and cytoplasmic regions, and the mean cytoplasmic value was subtracted from the mean chromosomal value. The 5hmC detection method was the same as that for 5mC, except anti-5hmC (Active Motif, Carlsbad, CA, USA) was used instead of anti-5mC. 2.6. RNA purification and qRT-PCR Oocytes and embryos were washed twice with Dulbecco’s Phosphate-Buffered Saline solution and stored at −80 ◦ C until RNA was extracted. Total RNA was extracted from 50 GV-stage oocytes, 50 MII-stage oocytes, 30 zygotes, or 25 two-cell embryos using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and RNase-free DNase was used to remove genomic DNA. The RNA integrity and concentration were determined by measuring absorbance at 260 nm. Total RNA (1.0 ␮g) from each sample was re-suspended in a 20 ␮L final volume of reaction buffer, containing 25 mM Tris-HCl, 37.5 mM KCl, 10 mM dithiothreitol, 1.5 mM MgCl2 , 10 mM of each dNTP, and 0.5 mg oligo(dT)15 primers to synthesize the cDNA. After the reaction mixture reached 42 ◦ C, 20 units of reverse transcriptase was added to each tube, and the sample was incubated for 1 h at 42 ◦ C. Reverse transcription was stopped by denaturing the enzyme at 95 ◦ C. The final PCR mixture contained 2.5 ␮L cDNA, 1× PCR buffer, 1.5 mM MgCl2 , 200 ␮M dNTP mixture, 1 U of Taq DNA polymerase, 1 ␮M sense and antisense primers, and 5.0 ␮L sterile water. qRT-PCR was conducted using the CFX96TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) under standard conditions. Transcripts were quantified in triplicate for each

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model ANIREP-5319; No. of Pages 8

ARTICLE IN PRESS Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

4 Table 2 Primer sequences and conditions. Gene symbol

Primers sequences

T annealing (◦ C), Number of cycles

Fragment size (bp)

Gene bank accession no.

Globin Dnmt1 Dnmt3a Dnmt3b Tet3

5 GCAGCCACGGTGGCGAGTAT3 GTGGGACAGGAGCTTGAAAT 5 CGCATGGGCTACCAGTGCACCTT3 GGGCTCCCCGTTGTATGAAATCT 5 CAACGGAGAAGCCTAAGGTCAA3 TTGAGGCTCCCACAAGAGATG 5 GACTCATTGGAGGACCAGCTGAAGC3 CAGCACCTCCAGGCACTCCACACAG 5 CCCACAAGGACCAACATAAC3 CCTCGCTGCCAAACTCAT

60 × 35 58 × 35 60 × 35 59 × 35 58 × 35

257 158 244 130 194

OCAGL1 XM 012177594.1 XM 012166041.1 XM 012189048.1 XM 012175987.1

sample, and globin was used as the reference gene. Relative abundance was calculated using the comparative Ct (2−ddCt ) method (Livak and Schmittgen, 2001). The primers used are listed in Table 2.

signal intensities increased during oocyte maturation in both lambs and adults and were less at all stages in lambs than with adults (P < 0.05; Fig. 1B and D). 3.3. Dnmt1, Dnmt3a, Dnmt3b, and Tet3 mRNA

2.7. Estrous synchronization and embryo transfer Time of estrus was synchronized in 81 mature Small-tail Han and Dorper crossbred ewes using the CIDR. The CIDR was removed after 13 days, and the ewes were injected with 400 IU PMSG. Two-cell embryos were surgically transferred to recipient ewes 96 h after removing the CIDR. Pregnancy status was determined by ultrasonography (7.5 MHz highresolution linear probe; Aloka Co. Ltd., Tokyo, Japan) 40 days after the transfer. Lambing rates were determined with spontaneous delivery of surviving offspring at full term (140–160 d). 2.8. Statistical analyses All values (except those in Table 3) are presented as mean ± standard error and were analyzed using one-way analysis of variance and the least significant difference test. Values in Table 3 were analyzed using the chi-square test. A P < 0.05 was considered significant. 3. Results 3.1. Oocyte maturation and embryonic development The rates of maturation and cleavage in oocytes collected from lambs (77.97% and 59.19%, respectively) were less (P < 0.05) than those collected from adults (Table 3; 92.16% and 82.98%, respectively). Furthermore, the pregnancy (P < 0.05) and lambing (P < 0.01) rates following implantation of embryos from donor lambs (19.87% and 6.82%, respectively) were less than those when oocytes from adult sheep donors were used for embryo development (41.03% and 24.24%, respectively). 3.2. Global DNA 5mC and 5hmC The 5mC fluorescence signal intensity increased progressively with maturation from GV-stage oocytes to the two-cell embryo stage in both lambs and adults sheep. However, 5mC signal intensities were less at all oocyte stages and in early developmental embryos when oocytes were collected from lambs compared with those in adults (P < 0.05; Fig. 1A and C). Similarly, 5hmC fluorescence

The qRT-PCR results revealed that relative abundance of Dnmt1, Dnmt3a, and Tet3 in GV- and MII-stage oocytes, zygotes, and two-cell embryos when oocytes from lambs were used were less (P < 0.05) than when oocytes from adults were used (Fig. 2A, C, and D). In contrast, the relative abundance of Dnmt3b was not different when oocytes from lambs and adults were used at any maturation stage (Fig. 2B). 4. Discussion The DNA methylation changes dynamically before and after fertilization in various species, including sheep (Fulka et al., 2006; Kang et al., 2001). Maintaining optimal DNA methylation during oocyte maturation is essential for viability of the embryos (Barton et al., 2001). Thus, an indepth understanding of DNA methylation and related gene expression dynamics in pre-pubertal oocytes and embryos is important in explaining the lesser developmental potential. Results of the present study indicate that sheep donor age affected the ability of oocytes to synthesize and store sufficient quantities of maternal factors, such as Dnmt1, Dnmt3a, and Tet3 mRNA, during in vitro maturation, which may have perturbed global methylation and demethylation during oocyte maturation and early embryonic development. Consistent with previous reports (Kelly et al., 2005; Palmerini et al., 2014), in the present study a reduction was observed in the developmental potential of oocytes (maturation and cleavage rates) in vitro and embryos (implantation and lambing) in vivo when oocytes were collected from lambs compared with those collected from adults. In general, the development of a mammalian embryo depends on proper epigenetic modifications and resources provided by the oocyte (Messerschmidt et al., 2014). Epigenetic mechanisms, specifically DNA methylation dynamics, have been implicated in the lesser developmental capacity of oocytes. If DNA methylation defects occur in oocytes, deficiencies may occur in the resulting pregnancy (Liang et al., 2012). In the present study, lamb oocytes and early developing embryos derived in vitro with use of lamb oocytes had a lesser relative abundance of 5mC and 5hmC. Results from the present study further confirm those of a

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model ANIREP-5319; No. of Pages 8

ARTICLE IN PRESS Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

5

Fig. 1. Relative abundance of 5-Methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) in sheep oocytes and early developing embryos collected from adults and lambs; (A and B) Representative immunofluorescence images of 5mC (A) and 5hmC (B) in germinal vesicle (GV), germinal vesicle breakdown (GVBD), metaphase I (MI), and MII oocyte stages, as well as in zygotes, two-cell embryos (green), and propidium iodide-stained nuclei (red). Scale bars, 20 ␮m. (C and D) Mean global 5mC (C) and 5hmC DNA (D) in GV, GVBD, MI, and MII stage oocytes and in zygotes and 2-cell embryos from adults and lambs are presented as mean ± standard error and were analyzed by one-way analysis of variance; Mean fluorescent intensity of GV-stage oocytes from the adult group was set to 1; Numbers in bars indicate the number of oocytes or embryos used;* P < 0.05, adults compared with lambs (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model

ARTICLE IN PRESS

ANIREP-5319; No. of Pages 8

Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

6

Table 3 Maturation, fertilization, conception, and lambing rates using oocytes derived from lambs and adult donors. Oocyte source (No of donors)

No. of oocytes

Maturation rate (%)

Cleavage rate (%)

Pregnancy rate (%)

Lambing rate (%)

Adult (n = 24)

204

Lamb (n = 34)

286

(188/204) 92.16a (223/286) 77.97b

(156/188) 82.98a (132/223) 59.19b

(16/39) 41.03a (8/33) 24.24b

(31/156) 19.87a (9/132) 6.82b

Values with different superscripts within columns are different (P < 0.05). Lambing rate: number of lambs/number of embryos (%).

Fig. 2. Relative abundance of Dnmt1 (A), Dnmt3a (B), Dnmt3b (C), and Tet3 (D) mRNA in adult and lamb germinal vesicle (GV) and metaphase II (MII) stage oocytes, zygotes, and two-cell embryos; Data are presented as mean ± standard error and were analyzed using one-way analysis of variance. Mean relative abundance in two-cell embryos from the lamb group was set to 1; * P < 0.05, adults compared with lambs.

previous investigation where less genome-wide methylation in lamb GV-stage oocytes that resulted in a greater frequency of developmental arrest in pre-pubertalderived fetuses (Ptak et al., 2006). Accordingly, the lack of incorporation of 5mC cytosine in lamb oocytes suggests an epigenetically immature phase that may inhibit gamete maturation processes, leading to failure to initiate developmental program mechanisms. The reduced 5hmC fluorescence of lamb oocytes and early developing embryos derived from in vitro use of lamb oocytes compared with use of oocytes from adult sheep in the present study may have delayed demethylation. The abnormal global methylation and demethylation demonstrated in the present study suggests that gene regulation that relies on DNA

methylation is not properly established in pre-pubertal oocytes. The loss of methylation corresponding to the loss of allele-specific expression of certain imprinted genes by the oocyte is resistant to the reprogramming process during early embryo developmental stages (Reik, 2007) and causes fetal death, with few live-born offspring (Howell et al., 2001). Hence, results of the present study provide evidence that oocytes of pre-pubertal lambs have altered DNA methylation and demethylation, which may be responsible for reducing oocyte and developmental potential during the early embryonic stages if oocytes are from lambs as compared with adult ewes. Genes involved in reprogramming and chromatin modifications are thought to have an important role during

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model ANIREP-5319; No. of Pages 8

ARTICLE IN PRESS Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

oocyte maturation (Oliveri et al., 2007). In the present study, the relative abundances of Dnmt1, Dnmt3a, and Tet3 were reduced in pre-pubertal donors compared with those in adults, suggesting that lamb oocytes do not have sufficient Dnmt1 and Dnmt3a mRNA until the two-cell embryo stage. Oocytes synthesize substantial amounts of mRNA during oogenesis that accumulate in the cytoplasm (Memili and First, 2000). The reduction observed in relative abundance of lamb oocyte mRNA in the present study may be due to abnormal metabolism in the cytoplasm (Kochhar et al., 2002) or nucleus or may be due to immature organelles (Palmerini et al., 2014). This type of deficiency would mainly affect cytoplasmic polyadenylation, with consequences on regulation of translation and a general suppression, or arrest, of development (Leoni et al., 2007). The Dnmt1 and Dnmt3a, rather than Dnmt3b, are apparently important in maintaining methylation in oocytes and early embryos because Dnmt3b was consistent in relative abundance from GV-stage oocytes to two-cell embryo in lambs. Different Dnmts have different temporal gene expression patterns in mammalian oocytes and early developing embryos, and relative abundance of Dnmt3b mRNA does not increase substantially until the 8-cell embryo stage (Vassena et al., 2005). Interestingly, downregulation of the Tet3 gene does not directly affect embryonic development; Tet3 is mainly required for epigenetic modifications and not for embryonic development. However, downregulation of the Tet3 gene at an early stage of embryo development has been reported to result in delayed Oct4 gene expression, which is responsible for early embryonic development and implantation (Gu et al., 2011). Loss of methylation-related mRNA, which are stored in immature and mature oocytes, and epigenetic modifications would inevitably have implications for epigenetic inheritance during early embryonic development. Thus, a decrease in mRNA abundance may disturb methylation patterns in lamb oocytes and early developing embryos derived from use of these oocytes for in vitro fertilization. The results of the present study indicate that incomplete DNA methylation and delayed demethylation might explain the lesser developmental potential of oocytes and greater rates of embryo and fetal loss when using lamb donors for oocytes. These losses were associated, at least in part, with inadequate expression of Dnmt1, Dnmt3a, and Tet3 genes in oocytes and early stages of embryo development when oocytes for in vitro procedures are collected from lambs. Acknowledgments This study was supported by the Science and Technology Development Project of Jilin Province (Grant no. 20140101025JC) and the Tianjin Academy of Agricultural Sciences Foundation (ID no. 15007). References Aoki, F., Worrad, D.M., Schultz, R.M., 1997. Regulation of transcriptional activity during the first and second cell cycles in the preimplantation mouse embryo. Dev. Biol. 181, 296–307.

7

Barton, S.C., Arney, K.L., Shi, W., Niveleau, A., Fundele, R., Surani, M.A., Haaf, T., 2001. Genome-wide methylation patterns in normal and uniparental early mouse embryos. Hum. Mol. Genet. 10, 2983–2987. Dean, W., 2014. DNA methylation and demethylation: a pathway to gametogenesis and development. Mol. Reprod. Dev. 81, 113–125. Fulka, J., Fulka, H., Slavik, T., Okada, K., Fulka, J.J., 2006. DNA methylation pattern in pig in vivo produced embryos. Histochem. Cell Biol. 126, 213–217. Gu, T.P., Guo, F., Yang, H., Wu, H.P., Xu, G.F., Liu, W., Xie, Z.G., Shi, L., He, X., Jin, S.G., Iqbal, K., Shi, Y.G., Deng, Z., Szabo, P.E., Pfeifer, G.P., Li, J., Xu, G.L., 2011. The role of Tet3 DNA dioxygenase in epigenetic reprogramming by oocytes. Nature 477, 606–610. Howell, C.Y., Bestor, T.H., Ding, F., Latham, K.E., Mertineit, C., Trasler, J.M., Chaillet, J.R., 2001. Genomic imprinting disrupted by a maternal effect mutation in the Dnmt1 gene. Cell 104, 829–838. Kang, Y.K., Koo, D.B., Park, J.S., Choi, Y.H., Kim, H.N., Chang, W.K., Lee, K.K., Han, Y.M., 2001. Typical demethylation events in cloned pig embryos, clues on species-specific differences in epigenetic reprogramming of a cloned donor genome. J. Biol. Chem. 276, 39980–39984. Katari, S., Turan, N., Bibikova, M., Erinle, O., Chalian, R., Foster, M., Gaughan, J.P., Coutifaris, C., Sapienza, C., 2009. DNA methylation and gene expression differences in children conceived in vitro or in vivo. Hum. Mol. Genet. 18, 3769–3778. Kauffold, J., Amer, H.A., Bergfeld, U., Weber, W., Sobiraj, A., 2005. The in vitro developmental competence of oocytes from juvenile calves is related to follicular diameter. J. Reprod. Dev. 51, 325–332. Kelly, J.M., Kleemann, D.O., Walker, S.K., 2005. Enhanced efficiency in the production of offspring from 4- to 8-week-old lambs. Theriogenology 63, 1876–1890. Kochhar, H.P., Wu, B., Morris, L.H., Buckrell, B.C., Pollard, J.W., Basrur, P.K., King, W.A., 2002. Maturation status, protein synthesis and developmental competence of oocytes derived from lambs and ewes. Reprod. Domest. Anim. 37, 19–25. Lee, J.Y., Lee, J., Yue, H., Lee, T.H., 2015. Dynamics of nucleosome assembly and effects of DNA methylation. J. Biol. Chem. 290, 4291–4303. Leoni, G.G., Bebbere, D., Succu, S., Berlinguer, F., Mossa, F., Galioto, M., Bogliolo, L., Ledda, S., Naitana, S., 2007. Relations between relative mRNA abundance and developmental competence of ovine oocytes. Mol. Reprod. Dev. 74, 249–257. Liang, X., Ma, J., Schatten, H., Sun, Q., 2012. Epigenetic changes associated with oocyte aging. Sci. Chin. Life Sci. 55, 670–676. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Memili, E., First, N.L., 2000. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared with other species. Zygote 8, 87–96. Messerschmidt, D.M., Knowles, B.B., Solter, D., 2014. DNA methylation dynamics during epigenetic reprogramming in the germline and preimplantation embryos. Genes Dev. 28, 812–828. Mike, D., Tamara, H., Julia, H., Brigitte, B., Doris, H., Patrick, A., Ulrich, B., Richard, R., Wilfried, K., Christian, W., Thomas, H., Heiner, N., 2012. DNA methylation and mRNA expression profiles in bovine oocytes derived from prepubertal and adult donors. Reproduction 144, 319–330. Obata, Y., Hiura, H., Fukuda, A., Komiyama, J., Hatada, I., Kono, T., 2011. Epigenetically immature oocytes lead to loss of imprinting during embryogenesis. J. Reprod. Dev. 57, 327–334. O’Brien, J.K., Dwarte, D., Ryan, J.P., Maxwell, W.M., Evans, G., 1996. Developmental capacity, energy metabolism and ultrastructure of mature oocytes from prepubertal and adult sheep. Reprod. Fertil. Dev. 8, 1029–1037. Oliveri, R.S., Kalisz, M., Schjerling, C.K., Andersen, C.Y., Borup, R., Byskov, A.G., 2007. Evaluation in mammalian oocytes of gene transcripts linked to epigenetic reprogramming. Reproduction 134, 549–558. Palmerini, M.G., Nottola, S.A., Leoni, G.G., Succu, S., Borshi, X., Berlinguer, F., Naitana, S., Bekmukhambetov, Y., Macchiarelli, G., 2014. In vitro maturation is slowed in prepubertal lamb oocytes: ultrastructural evidences. Reprod. Biol. Endocrinol. 12, 115. Pastor, W.A., Aravind, L., Rao, A., 2013. TETonic shift: biological roles of TET proteins in DNA demethylation and transcription. Nat. Rev. Mol. Cell Biol. 14, 341–356. Ptak, G., Matsukawa, K., Palmieri, C., Della, S.L., Scapolo, P.A., Loi, P., 2006. Developmental and functional evidence of nuclear immaturity in prepubertal oocytes. Hum. Reprod. 21, 2228–2237.

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022

G Model ANIREP-5319; No. of Pages 8

8

ARTICLE IN PRESS Y. Fang et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Reik, W., 2007. Stability and flexibility of epigenetic gene regulation in mammalian development. Nature 447, 425–432. Tahiliani, M., Koh, K.P., Shen, Y., Pastor, W.A., Bandukwala, H., Brudno, Y., Agarwal, S., Iyer, L.M., Liu, D.R., Aravind, L., Rao, A., 2009. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324, 930–935. Tang, L.S., Wang, Q., Xiong, B., Hou, Y., Zhang, Y.Z., Sun, Q.Y., Wang, S.Y., 2007. Dynamic changes in histone acetylation during sheep oocyte maturation. J. Reprod. Dev. 53, 555–561.

Vassena, R., Dee, S.R., Latham, K.E., 2005. Species-dependent expression patterns of DNA methyltransferase genes in mammalian oocytes and preimplantation embryos. Mol. Reprod. Dev. 72, 430–436. Zaraza, J., Oropeza, A., Velazquez, M.A., Korsawe, K., Herrmann, D., Carnwath, J.W., Niemann, H., 2010. Developmental competence and mRNA expression of preimplantation in vitro-produced embryos from prepubertal and postpubertal cattle and their relationship with apoptosis after intraovarian administration of IGF-1. Theriogenology 74, 75–89.

Please cite this article in press as: Fang, Y., et al., Global DNA methylation and related mRNA profiles in sheep oocytes and early embryos derived from pre-pubertal and adult donors. Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.11.022