Differential effects of activin-A and FSH on growth, viability and messenger RNA expression in cultured bovine preantral follicles

Livestock Science 160 (2014) 199–207

Contents lists available at ScienceDirect

Livestock Science journal homepage: www.elsevier.com/locate/livsci

Differential effects of activin-A and FSH on growth, viability and messenger RNA expression in cultured bovine preantral follicles A.W.B. Silva a, F.T.G. Bezerra a, J.J.N. Costa a, R.O.D.S. Rossi a, M.J. Passos a, G.L. Vasconcelos a, R. Rossetto a, M.A.M. Donato c, D.M. Magalhães-Padilha b, C.C. Campello b, M.V.A. Saraiva a, J.R. Figueiredo b, C.A. Peixoto c, R. Van den Hurk d, J.R.V. Silva a,n a

Biotechnology Nucleus of Sobral—NUBIS, Federal University of Ceara, Sobral, CE, Brazil Faculty of Veterinary Medicine, Laboratory of Manipulation of Oocytes and Preantral Follicles—LAMOFOPA, State University of Ceara, Fortaleza, CE, Brazil c Laboratory of Ultrastructure, CPqAM/FIOCRUZ, Federal University of Pernambuco, Recife-PE, Brazil d Department of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80, 163 Utrecht, The Netherlands b

a r t i c l e i n f o

abstract

Article history: Received 8 March 2013 Received in revised form 23 October 2013 Accepted 3 December 2013

This study evaluated the effect of follicle stimulating hormone (FSH) alone or in combination with activin-A on survival, growth and expression of mRNA for follicle stimulating hormone receptor (FSH-R), proliferating cell nuclear antigen (PCNA), activin receptor type I B (ActR-IB), activin receptor type II B (ActR-IIB), hyaluronan synthase-1 (HAS 1) and hyaluronan synthase-2 (HAS 2) in bovine secondary follicles cultured in vitro for 18 days. Preantral follicles (
0.2 mm) were isolated and individually cultured in absence (α-minimum essential medium (α-MEM þ ): control) or presence of activin-A, FSH in increasing concentrations or both activin-A and FSH. An increase in follicular diameter was observed after 6 days of culture in all culture treatments compared to control medium; after 12 days in treatment with FSH alone or the mixture of FSH and activin-A (P o 0.05); and, after 18 days only in the presence of FSH alone (Po 0.05). However, in combination with activin-A, FSH-stimulated follicle growth after 18 days was blocked (P o 0.05) and, had significantly lower (P o0.05) levels of mRNA for ActR-IB, ActR-IIB, when compared to α-MEM þ , and for FSH-R and PCNA, when compared to α-MEM þ supplemented with activin-A only. Moreover, follicles cultured in presence of FSH alone had greater (P o 0.05) levels of mRNA for HAS 1 and HAS 2 than those cultured in medium supplemented with both activin-A and FSH. Morphological, immunofluorescence and ultrastructural analysis confirmed the integrity of follicles cultured in FSH after 18 days. In conclusion, activin-A exerts a stimulatory effect on in vitro early follicular development for up to 6 days, has no effect after 12 days of culture and blocks the stimulatory growth effect of FSH after 18 days. The reduced mRNA levels in follicles cultured with both activin-A and FSH suggest a decreased sensitivity of follicles for activin-A and FSH and inhibited follicular cell proliferation after long-term in vitro culture of isolated preantral follicles. & 2013 Elsevier B.V. All rights reserved.

Keywords: Preantral follicles Activin-A FSH Bovine Ultrastructure Messenger RNA expression

n Correspondence to: Biotechnology Nucleus of Sobral—NUBIS, Federal University of Ceara, Avenida Comandante Maurocélio Rocha Ponte 100, CEP 62041-040 Sobral, CE, Brazil. Tel./fax: þ 55 88 36118000. E-mail address: [email protected] (J.R.V. Silva).

1871-1413/$ - see front matter & 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.livsci.2013.12.003

200

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

1. Introduction

2. Materials and methods

Gonadotropins are the primary regulators of ovarian follicular growth, but it has become quite apparent that locally produced factors are involved in modulating the response of developing follicles to FSH. Activin is a dimeric glycoprotein composed of two β subunits of inhibin A or B, and exists as homo- or hetero-dimers. The dimerization of activin subunits gives rise to three forms of activin, which are classified as, activin-A (βA– βA), activin-B (βB–βB) and activin-AB (βA–βB) (Pangas and Woodruff, 2000). There is convincing evidence showing that activin signaling is important for ovarian follicle development in mammals, but some studies emphasizing the role of activin-A on preantral follicles have shown conflicting results. In ovine species, activin-A was found to promote preantral follicle and oocyte growth in vitro, but not to accelerate follicle differentiation over a 6-days culture period (Thomas et al., 2003). Addition of activin-A to culture medium maintained the morphology and integrity of oocytes retrieved from isolated bovine secondary follicles after 8 days (Mclaughlin et al., 2010), while activin-A in the presence of FSH, stimulated antral cavity formation and proliferation of granulosa cells in in vitro cultured murine follicles (rat: Zhao et al., 2001; mouse: Choi et al., 2008). Expression of FSH-R was identified in granulosa cells of bovine preantral follicles (El-Hefnawy and Zeleznik, 2001; Wandji et al., 1992) demonstrated that activin interacts positively with FSH in rat granulosa cells by increasing the levels of FSH receptor mRNA, as well as those of cyclin D2 and proliferating cell nuclear antigen (PCNA) of which the proteins play an important role in cell cycle progression. On the other hand, Mizunuma et al. (1999) have demonstrated that activin-A blocks the stimulatory effect of FSH during in vitro growth of mice preantral follicles. In addition, when activin-A was injected into the ovarian bursa caused both atresia and inhibition of follicular development caused by pregnant mare serum gonadotropin treatment (rat: Woodruff et al., 1990). Thus, it is important to understand the role of activin-A and its interaction with FSH on bovine preantral follicles in vitro. During follicle development, bovine granulosa cells express hyaluronan synthases (HAS) and synthesize hyaluronan that is strongly hydrophilic and highly negatively charged, thus exerting strong osmotic activity that contributes to antrum formation and follicle growth (Clarke et al., 2006). Despite advances, the events that coordinate the actions of activin-A and FSH in bovine preantral follicles are not yet fully elucidated and little is known about the effects of activin-A, either alone or in combination with FSH, on the development of bovine secondary follicles after their long term culture (18 days) and on the messenger RNA expression of FSH-R, ActR-IB, ActR-IIB, PCNA and HAS 1/2 therein. Therefore, the aim of this study was to evaluate the effect of FSH, activin-A and a mixture of FSH and activin-A on the viability, ultrastructure and growth of bovine secondary follicles cultured in vitro for 18 days, as well as on the follicular expression of mRNA for FSH-R, PCNA, ActR-IB, ActR-IIB and HAS 1/2.

2.1. Source of chemicals and ovaries Unless indicated otherwise, culture media and other chemicals used in this study were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Bovine ovaries (n ¼40) were collected from locally abattoir-slaughtered cows (n¼20). Immediately post-mortem, ovaries were washed in 70% alcohol, followed by two rinses in minimum essential medium (α-MEM) supplemented with 100 mg/ mL penicillin and 100 mg/mL streptomycin. Ovaries were transported within 1 h to the laboratory in α-MEM at 4 1C (goat: Chaves et al., 2008). In the laboratory, under laminar flow conditions, fat tissue and ligaments were stripped from the ovaries. 2.2. Isolation and selection of bovine preantral follicles In the laboratory, ovarian cortical slices (1–2 mm thick) were cut from the ovarian surface using a surgical blade under sterile conditions. The ovarian cortex was subsequently placed in fragmentation medium, consisting of α-MEM supplemented with 100 mg/mL penicillin and 100 mg/mL streptomycin. Preantral follicles (
0.2 mm) were then visualized under a stereo-microscope (SMZ 645 Nikon, Tokyo, Japan) and manually microdissected, using 26 gauge (26 G) needles, attached to 1 mL syringes. An average of 12 follicles was isolated from each animal. After isolation, follicles were transferred to 100 μL drops, containing fresh medium to evaluate the follicular quality further. Follicles with a visible oocyte, surrounded by two or more layers of granulosa cells, an intact basement membrane and without antral cavity were selected for culture. 2.3. In-vitro culture of bovine secondary follicles For in vitro studies, 229 selected follicles were randomly distributed between treatments and individually cultured in 100 μL drops of culture medium in Petri dishes (60  15 mm; Corning, USA) under mineral oil. The basic culture medium consisted of α-MEM (pH 7.2–7.4) supplemented with 3.0 mg/mL bovine serum albumin; 10 μg/mL insulin, 5.5 μg/mL transferrin, and 5 ng/mL selenium; 2 mM glutamine; 2 mM hypoxanthine; and 50 μg/mL ascorbic acid (α-MEM þ ). Preantral follicles were distributed into treatments as follows: (1) α-MEM þ alone (control medium, n ¼58); (2) α-MEM þ supplemented with activinA (100 ng/mL, n ¼60, R&D Systems, Minneapolis, USA); (3) α-MEM þ supplemented with sequential FSH (50 ng/mL from day 0 to day 6, 100 ng/mL from day 7 to day 12 and 200 ng/mL from day 13 to day 18) (n¼50) (ovine FSH, Sigma, St. Louis, MO, USA); (4) α-MEM þ supplemented with 100 ng/mL of activin-A associated with sequential FSH (n¼ 61). These concentrations of FSH and activin-A were those that promoted the highest growth rates in-vitro cultured preantral follicles in previous studies (Mclaughlin et al., 2010; Saraiva et al., 2010a). Incubation was done at 39 1C, 5% CO2 in air for 18 days. Every other day, 60 μL of the culture media were replaced with fresh medium, except at days 6 and 12, in which total medium

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

(100 μL) replenishment was performed because of the different treatments tested. Fresh medium was prepared and incubated for 1 h prior to use. 2.4. Morphological evaluation of follicular development The ovarian follicles were classified as normal or degenerated, based on their morphological characteristics. The latter includes irregularities in the contour of the basal membrane, or the darkening of the oocyte and/or surrounding granulosa cells. On days 0, 6, 12 and 18, the normal follicles were measured using a software Motic Images Plus 2.0 ML. Two perpendicular measurements were performed. In addition, the percentages of secondary follicles that reached antrum formation in vitro were determined. Once a translucent cavity was visible between the granulosa cells, the antrum was considered to be formed. 2.5. Levels of expression of mRNA for ActR-IB, ActR-IIB, FSH-R, PCNA, and HAS 1/2 in bovine preantral follicles cultured in vitro After 18 days of culture, follicles cultured in different treatments (α-MEM þ : n ¼29; activin-A: n ¼34; FSH: n ¼32; activin-Aþ FSH: n¼29) were stored in microcentrifuge tubes at 80 1C, until RNA extraction. Total RNA was extracted using the TRIzols reagent (Invitrogen, São Paulo, Brazil). According to the manufacturer's instructions, 1 mL of Trizol solution was added to each frozen samples and the lysate was aspirated through a 20-gauge needle before centrifugation at 10,000g for 3 min at room temperature. Thereafter, all lysates were diluted 1:1 with 70% ethanol and subjected to a mini-column. After binding of the RNA to the column, DNA digestion was performed using RNAse-free DNAse (340 Kunitz units/mL) for 15 min at room temperature. After washing the column three times, the RNA was eluted with 30 mL RNAse-free water.

201

The RNA concentration was estimated by reading the absorbance at 260 nm and was checked for purity at 280 nm in a spectrophotometer (Amersham, Biosciences Cambridge, England). Before the reverse transcription reaction, samples of RNA were incubated for 5 min at 70 1C and then cooled in ice. Reverse transcription was performed in a total volume of 20 μL composed of 10 μL of sample containing 2 mg of RNA, 4 μL reverse transcriptase buffer (Invitrogen, São Paulo, Brazil), 8 units RNAsin, 150 units of reverse transcriptase Superscript III, 0.036 U random primers, 10 mM DTT and 0.5 mM of each dNTP (Invitrogen, São Paulo, Brazil). The mixture was incubated at 42 1C for 1 h, subsequently at 80 1C for 5 min, and finally stored at  20 1C. The negative control was prepared under the same conditions, but without addition of reverse transcriptase. Quantification of the mRNA for ActR-IB, ActR-IIB, FSH-R, PCNA, and HAS 1/2 was performed by using SYBR Green. Each reaction in real time (20 μL) contained 10 μL of SYBR Green Master Mixs (Applied Biosystems, Warrington, UK), 7.3 μL of ultrapure water, 1 μL of cDNA and 5 mM of each primer. Real-time PCR was performed in a thermocycler (Mastercyclers ep Realplex, Eppendorf, Germany). The primers designed to perform amplification of mRNA for FSH-R, PCNA, ActR-IB, ActR-IIB and HAS 1/2 are shown in Table 1. This table also shows ubiquitin-C (UBC) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), which were used as endogenous controls for normalization of messenger RNA expression. These genes have shown highest stability in bovine follicles (Rebouças et al., 2013) and, thus, were used to normalize expression of target genes. The specificity of each primer pair was confirmed by melting curve analysis of PCR products. The thermal cycling profile for the first round of PCR was initial denaturation and activation of the polymerase for 10 min at 95 1C, followed by 50 cycles of 15 s at 95 1C, 30 s at 58 1C, and 30 s at 72 1C. The final extension was for 10 min at 72 1C. Primer efficiency was determined using

Table 1 Primer pairs used in real-time PCR for quantification of messenger RNA in cultured bovine follicles. Target gene

Primer sequence (50 -30 )

Sense (s), anti-sense (As)

Position

GenBank accession no.

GAPDH

TGTTTGTGATGGGCGTGAACCA ATGGCGTGGACAGTGGTCATAA GAAGATGGCCGCACTCTTCTGAT ATCCTGGATCTTGGCCTTCACGTT

S As S As

288–309 419–440 607–631 756–780

GI: 27525390

PCNA

TGCCGAGATCTCAGTCACAT TATGGCAACAGCTTCCTCCT

S As

566–586 695–715

GI: 77735938

HAS 1

TACTGGGTGGCCTTCAATGT AACTGCTGCAGGAGGTTGTT

S As

1636–1656 1722–1742

GI: 297485936

HAS 2

ACTCCTGGGTGGTGTGATTT TTCTTCCGCCTGCCACATTT

S As

2005–2025 2149–2169

GI: 31342885

ActR-IB

ACAGGAAATTATTGGCAAGGGCCG TCTCATGGCGAAGCATGACTGTCT

S As

540–564 691–715

GI: 194667070

ActR-IIB

TGCCCACAGGGACTTTAAGAGCAA AGAAAGGCGTCTCTCTGGAAGTTG

S As

1109–1133 1279–1303

GI: 31341841

FSH-R

AGGCAAATGTGTTCTCCAACCTGC TGGAAGGCATCAGGGTCGATGTAT

S As

250–274 316–340

GI: 95768228

UBC

GI: 57163956

202

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

serial dilutions of the target cDNA. All reactions were performed in triplicate in a real time PCR Mastercyclers Realplex (Eppendorf, Germany). The negative control was prepared under the same conditions but without addition of cDNA. The delta–delta-CT method was used to transform CT values into normalized relative messenger RNA expression levels (Livak and Schmittgen, 2001).

cut, stained with toluidine blue and analyzed by light microscopy at a 400  magnification. Ultra-thin sections (70 nm) were obtained from bovine preantral follicles classified as morphologically normal in semi-thin sections. Subsequently, ultra-thin sections were counterstained with uranyl acetate and lead citrate, and examined under a Morgani-FEI transmission electron microscope.

2.6. Assessment of preantral follicle viability by fluorescence microscopy

2.8. Statistical analysis

To confirm the results of the morphological analyses, the viability of follicles cultured in all treatments was further analyzed using a more accurate method of assessment based on fluorescent probes. After culture, follicles (n¼10/treatment) were incubated in 100 μL droplets of α-MEM containing 4 μM calcein-AM and 2 μM ethidium homodimer-1 (Molecular Probes, Invitrogen, Karlsruhe, Germany) at 37 1C for 15 min. Afterwards, the follicles were washed three times in α-MEM and examined under a fluorescence microscope (Eclipse 80i; Nikon). The emitted fluorescent signals of calcein-AM and ethidium homodimer-1 were collected at 488 nm. Oocytes and granulosa cells were considered to be viable, if the cytoplasm was stained positively with calceinAM (green) and if the chromatin was not labeled with ethidium homodimer-1 (red) (Schotanus et al., 1997; Van Den Hurk et al., 1998). 2.7. Ultrastructural features of bovine preantral follicles In order to better examine follicular morphology, transmission electron microscopy (TEM) was performed to analyze the ultrastructure of bovine preantral follicles grown from in vitro treatments that provided the best results. Isolated follicles were fixed in Karnovsky solution (4% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer pH 7.2) for at least 4 h at room temperature (approximately 25 1C). After fixation, cultured follicles were embedded in drops of 4% low melting agarose, and kept in sodium cacodylate buffer. Specimens were post-fixed in 1% osmium tetroxide, 0.8% potassium ferricyanide and 5 mM calcium chloride in 0.1 M sodium cacodylate buffer for 1 h at room temperature, washed in sodium cacodylate buffer and counterstained with 5% uranyl acetate. The samples were then dehydrated through a gradient of acetone solutions and thereafter embedded in epoxy resin (Epoxy-Embedding Kit, Fluka ChemikaBioChemika). Afterwards, semi-thin sections (2 mm) were

In the analysis of discrete variables, i.e., number of morphologically normal follicles (follicular survival) and the formation of the antrum along the culture period, the data were grouped in “pools” for each treatment and analyzed by frequency spread by Chi-square, and the results are expressed in percentages. The results corresponding to follicular diameters were subjected to Shapiro–Wilk test and Bartlett for verification of normal distribution and homoscedasticity, respectively. Follicular diameters that did not show homogeneity of variance, even after transformation, were analyzed by Kruskal–Wallis non-parametric test (SAS Institute Inc., 2002). ANOVA using general linear model (GLM) procedure of SAS was used to test the effect of activin-A and FSH on the relative messenger RNA expression of FSH-R, PCNA, ActR-IB, ActR-IIB and HAS 1/2 on follicles submitted to culture for 18 days in α-MEM þ alone or cultured with activin-A alone, FSH alone or in association with activin-A. If an effect of treatment was significant, data were further examined by Duncan test to locate differences among treatments. The results were expressed as mean7standard deviation (SD) and differences were considered significant when Po0.05. 3. Results 3.1. Effects of activin-A and FSH in follicular growth, antrum formation and survival In all treatments, after 6 days of culture, the follicles showed a significant increase in follicular diameter compared to day 0. Follicles cultured in presence of FSH, activin-A or both had a significant increase in their diameter when compared to those cultured in α-MEM þ . After 12 days of culture, contrary to treatment with FSH or both FSH and activin-A, that with activin-A alone did not stimulate follicular growth. Neither after 6 days nor after 12 days of culture, a synergistic effect of FSH and activin-A was observed (Table 2). After 18 days, the follicles cultured in the presence of FSH showed the greatest diameter when

Table 2 Follicular diameter (mean7 S.E.M.) of preantral bovine follicles with normal morphology after 18 days of in vitro culture in the following treatments: α-MEM þ ; α-MEM þ þactivin-A; α-MEM þ þFSH; and α-MEM þ þ FSH þ activin-A.

D0 D6 D12 D18

α-MEM þ

α-MEM þ þactivin-A

α-MEM þ þFSH

α-MEM þ þactivin-AþFSH

183.86 7 36.87 Ac 210.047 47.78 Bb 226.56 7 47.67 Bab 241.177 52.10 Ca

199.017 35.99 Ab 231.647 38.56 Aa 238.487 56.12 Ba 251.81 7 80.00 Ca

188.84 736.80 Ad 245.11 755.16 Ac 297.48 791.40 Ab 349.61 7108.70 Aa

201.52 7 46.78 255.46 7 62.03 282.187 84.33 302.65 7 95.91

Distinct uppercase letters (A/B/C) represent significant differences between columns (treatments). Distinct lowercase letters (a/b/c) represent significant differences between lines (time of culture). P o0.05.

Ac Ab Aab Ba

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

the zona pellucida (ZP) and the oocyte membrane (Fig. 2A) were observed. Furthermore, the presence of a Golgi complex (G), a nucleus (N), endoplasmic reticulum (Er) and mitochondria (M) were demonstrated, the latter structures showed some swollenness and no visible cristae. Detachment of surrounding granulosa cells was observed in follicles cultured in α-MEM þ (Fig. 2B), but not in medium supplemented with FSH (Fig. 2D). After treatment with FSH, follicles had a central oocyte, a defined zona pellucida (Fig. 2C), and organized granulosa cells. These cells presented concentric circles of endoplasmic reticulum (Fig. 2D) and augmented number of mitocondriae with visible cristae and regular chromatin.

compared to the other treatments (Table 2). Follicles cultured with activin-A had similar diameters to those cultured in α-MEM þ (P40.05), and when combined with FSH, activin-A did inhibit the FSH-stimulated follicle growth (Po0.05). After 18 days of culture, follicular antrum formation was observed in all treatments, α-MEM þ : 22.22% (10/45); α-MEM þ þactivin-A: 25.00% (12/48); α-MEM þ þFSH: 31.82% (14/44); α-MEM þ þ activin-AþFSH: 33.33% (16/48), but no significant differences among treatments were observed. At the end of the culture period, the percentage of surviving follicles ranged from 83.33% for follicles, that had been cultured in medium containing both activin-A and FSH, to 100% for follicles, cultured in the presence of FSH alone. Follicles cultured with FSH alone had a survival rate equivalent to activin-A (P 40.05) and both were superior to follicles, cultured in α-MEM þ alone or supplemented with both FSH and activin-A (Po0.05) (Table 3). The viability of the follicles, that had been considered morphologically normal, was established by staining with calcein-AM after in vitro culture. In this analysis, both the oocyte and the granulosa cells were positively stained green, indicating the viability of the whole follicle (Fig. 1).

3.3. Expression of mRNA for ActR-IB, ActR-IIB, FSH-R, PCNA and HAS 1/2 in cultured follicles Analysis of levels of mRNA in follicles cultured in presence of a mixture of activin-A and FSH showed a significant reduction in levels for ActR-IB (Fig. 3A) and ActR-IIB (Fig. 3B) (P o0.05), when compared to follicles cultured in α-MEM þ . Furthermore, we found that follicles, cultured in activin-A plus FSH had lower levels of mRNA for FSH-R (Fig. 3C) and PCNA (Fig. 3D), when compared to follicles cultured in medium supplemented with only activin-A, but did not differ from control. Concerning the isoenzymes involved in the antrum formation, it was found that follicles cultured in FSH alone had greater levels of mRNA for HAS-1 (Fig. 3E) and HAS-2 (Fig. 3F) (P o0.05) than follicles cultured in medium supplemented

3.2. Ultrastructural analysis of bovine preantral follicles after 18 days of culture Regarding the ultrastructural features of the follicles evaluated in culture with α-MEM þ , irregularities in both

Table 3 Survival of bovine isolated preantral follicles cultured in vitro for 18 days in α-MEM α-MEM þ D0 D6 D12 D18

100.00% 100.00% 97.78% 88.89%

(45/45) (45/45) (44/45) (40/45)

Aa Aa ABab BCb

þ

, α-MEM þ supplemented with activin-A, FSH or both.

α-MEM þ þ activin-A

α-MEM þ þ FSH

100.00% 100.00% 100.00% 97.92%

100.00% 100.00% 100.00% 100.00%

(48/48) (48/48) (48/48) (47/48)

203

Aa Aa Aa Aa

(44/44) (44/44) (44/44) (44/44)

α-MEM þ þ activin-Aþ FSH Aa Aa Aa Aa

100.00% 100.00% 91.67% 83.33%

(48/48) (48/48) (44/48) (40/48)

Aa Aa Bb Cb

Distinct uppercase letters (A/B/C) represent significant differences between columns (treatments). Distinct lowercase letters (a/b/c) represent significant differences between lines (time of culture). Po 0.05.

Fig. 1. Viability assessment of bovine ovarian follicles after 18 days of in vitro culture. (A) Characterization of viable follicles marked by calcein-AM staining (green fluorescence); and (B) characterization of non-viable follicles marked by ethidium homodimer-1 (red fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

204

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

Fig. 2. MET photomicrographs of bovine ovarian follicles cultured for 18 days in α-MEMþ (A and B) or in the presence of FSH (C and D). G: Golgi apparatus; M: mitochondria; N: nucleus; Nu: nucleolus; O: oocyte; ZP: zona pellucida; Er: endoplasmic reticulum; *: concentric circles of endoplasmic reticulum; black arrows: changes in cell membrane; white arrows: changes in the nuclear membrane. Bars: photos (A) and (B) 10,000 nm/photos (C) and (D) 5000 nm.

with a mixture of activin-A and FSH, but did not differ from control. 4. Discussion This study shows for the first time that a mixture of activin-A and FSH does not stimulate bovine preantral follicle growth after 12 days of culture and inhibits the positive effect of FSH after 18 days. The negative effect of the interaction between activin-A and FSH can be explained by the caused decrease of the levels for HAS-1, HAS-2, FSH-R and PCNA. Furthermore, this study demonstrated the importance of the addition of FSH for the development, survival and antrum formation of bovine secondary follicles that were cultured in vitro during a long period. Activin-A stimulated follicular growth during the first 6 days of culture, but not for a longer period, which confirms that activin-A is important for initial phases of secondary follicles development (mice: Choi et al., 2008; cow: Mclaughlin et al., 2010). Previous studies have identified that activin-A promotes growth and differentiation of bovine preantral follicles after a short period (8 days) of culture (Mclaughlin et al., 2010). Compared to activin-A, FSH stimulated the follicle growth during the whole culture period of 18 days. This positive effect of FSH can possibly be associated with the stimulation of hyaluronan synthase-2 (HAS 2) expression, which is an enzyme responsible for synthesis of hyaluran, a osmotically active molecule, which is able to generate an osmotic gradient that draws in follicular fluid in cattle (Rodgers and IrvingRodgers, 2010). Thus, it would appear that synthesis of osmotically active molecules in follicles can be regulated

by endocrine and autocrine mechanisms, which in this way may result in follicular fluid formation. Additionally, in collaboration with FSH, activin-A inhibited the messenger RNA expression of activin and FSH receptors, proteins involved in antrum formation and PCNA, which may explain the low rate of follicular growth in this treatment. Mizunuma et al. (1999) previously showed that mice preantral follicles cultured in vitro significantly grew and enhanced their estrogen/inhibin secretion in response to FSH, whereas administration of activin-A blocked the effect of FSH. Withdrawal of activinA not only restored the follicular response to FSH but also enhanced the effect of FSH, indicating that the action of activin-A is to cause small preantral follicles to become dormant at the preantral stage. In addition, Woodruff et al. (1990) demonstrated that activin-A has an atretic action on follicular development in rat. Recently, Cossigny et al. (2012) demonstrated that the presence of both activin-A and FSH in culture medium increased the proportion of atretic follicles after culturing rat ovaries. In this study, follicles cultured in medium containing FSH alone or associated with activin-A, showed a significant reduction of mRNA for FSH-R, compared to activin-A alone. Studies with goat preantral follicles have shown that after 6 and 12 days of culture, the addition of increasing concentrations of FSH (from 100 to 1000 ng/ mL) to culture medium maintains the level of messenger RNA expression of its own receptor (FSH-R) similar to the control medium (Celestino et al., 2011; Saraiva et al., 2010a). In contrast, Glister et al. (2011) showed that the treatment of cultured bovine GC from antral follicles with FSH (0.33 ng/mL) promoted increase in expression of FSH-R mRNA. This information shows that the effects of

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

205

Fig. 3. Relative profile expression of mRNA in bovine ovarian follicles after 18 days of culture (means 7S.E.M.): (A) ActR-IB; (B) ActR-IIB; (C) FSH-R; (D) PCNA; (E) HAS 1; and (F) HAS 2. Distinct uppercase letters (A/B) represent significant differences between treatments (P o0.05).

FSH on the expression of its own receptors depend on the species and cell types. In regard to antrum formation in bovine follicles, there were no differences found among the applied treatments. In goats, secondary follicles also acquire an antrum spontaneously during culture of secondary follicles (Saraiva et al., 2010b; Silva et al., 2011) in culture medium similar to that used in the present experiment. However, addition of FSH did increase the percentage of antrum formation compared to the controls (Saraiva et al., 2010a). In shortly (8 days) cultured cattle follicles, activin-A alone or a mixture of this growth factor with FSH did increase the percentage of antrum formation compared to that of control follicles (Mclaughlin et al., 2010). Differences between these results and those obtained in the current study may be attributed to the distinction between the basic medium used (McCoy—(Mclaughlin et al., 2010) versus α-MEM þ ), the concentrations of the supplements tested and, especially, the manner of addition of FSH.

In this study, for example, the hormone was added in increasing concentrations throughout the culture. After 18 days of culture, all treatments applied in this study resulted in an extremely high percentage (491%) of healthy follicles, that were assessed healthy by lightmicroscopical analysis. The high quality of follicles was confirmed by our follicular viability tests in which fluorescent probes were used. These tests were performed at the end of the culture period (day 18). Previously, this fluorescence technique was successfully carried out to assess the viability of preantral follicles in cows (Schotanus et al., 1997; Van Den Hurk et al., 1998) and goats (Santos et al., 2006, 2007; Silva et al., 2010). The applied morphological and fluorescence analysis of follicles highlighted the important role of FSH as a survival factor, since all grown follicles in this treatment were morphologically intact. Although follicles cultured in α-MEM þ appeared light- and fluorescence-microscopically morphological viable, electron-microscopical examination revealed that,

206

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

ultrastructural damage may compromise the viability of these follicles. However, electron-microscopical analysis of the follicles cultured in FSH showed that this hormone ensures the ultrastructural integrity of granulosa cells and oocytes, preserving important structures, such as mitochondria and endoplasmatic reticulum of granulosa cells of bovine follicles grown for a long period (18 days). This observation suggests that the addition of increasing concentrations of FSH is efficient in maintaining the ultrastructure of bovine preantral follicles. In fact, FSH is considered a major factor in follicular survival, because of its direct action on follicles by stimulating the inhibition of apoptosis proteins (Markström et al., 2002), and its indirect action on follicles by stimulating the action of factors like KL, BMP-15 and GDF-9 (Joyce et al., 1999; Thomas et al., 2005), which are known to act on follicular survival (Celestino et al., 2010, 2011; Martins et al., 2010). 5. Conclusion In conclusion, activin-A is important for early follicular development (up to 6 days), but reduces the stimulatory effect of FSH on bovine preantral follicles after 18 days of culture in vitro. FSH increases follicular growth and viability, and the expression of mRNA for HAS-1 and HAS-2 during culture, but, after 18 days in vitro culture, a mixture of activin-A and FSH reduces the levels of mRNA for ActRIB, ActR-IIB, FSH-R and PCNA. Although further investigation is needed to explain why follicular growth is inhibited in medium containing both FSH and activin-A, the present findings suggest that FSH alone or in association with activin-A decreases sensitivity of follicles to activin-A. Conflict of interest statement There was no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Acknowledgments This research was supported by Grants from the National Council for Scientific and Technological Development (CNPq, Brazil, Grant number 477025/2009-9), Coordination for the Improvement of Higher Education Personnel (CAPES) and the Brazilian Innovation Agency (FINEP). Anderson Weiny Barbalho Silva is a recipient of a grant from CAPES. References Celestino, J.J.H., Bruno, J.B., Lima-Verde, I.B., Matos, M.H.T., Saraiva, M.V.A., Chaves, R.N., Martins, F.S., Almeida, A.P., Cunha, R.M.S., Lima, L.F., Name, K.O., Campello, C.C., Silva, J.R.V., Báo, S.N., Figueiredo, J.R., 2010. Steady-state level of kit ligand mRNA in goat ovaries and the role of kit ligand in preantral follicle survival and growth in vitro. Mol. Reprod. Dev. 77, 231–240. Celestino, J.J.H., Bruno, J.B., Saraiva, M.V.A., Rocha, R.M.P., Brito, I.R., Duarte, A.B.G., Araújo, V.R., Silva, C.M.G., Matos, M.H.T., Campello, C. C., Silva, J.R.V., Figueiredo, J.R., 2011. Steady-state level of epidermal growth factor (EGF) mRNA and effect of EGF on in vitro culture of caprine preantral follicles. Cell Tissue Res. 344, 539–550.

Clarke, H.G., Hope, S.A., Byers, S., Rodgers, R.J., 2006. Formation of ovarian follicular fluid may be due to the osmotic potential of large glycosaminoglycans and proteoglycans. Reproduction 132, 119–131. Chaves, R.N., Martins, D.F.S., Saraiva, M.V.A., Celestino, J.J.H., Lopes, C.A.P., Correia, J.C., Lima-Verde, I.B., Matos, M.H.T., Báo, S.N., Name, K.P.O., Campello, C.C., Silva, J.R.V., Figueiredo, J.R., 2008. Chilling ovarian fragments during transportation improves viability and growth of goat preantral follicles cultured in vitro. Reprod. Fertil. Dev. 20, 640–647. Choi, J., Lee, B., Lee, E., Yoon, B.K., Choi, D., 2008. Effect of activin A and insulin-like growth factor-I on in vitro development of preantral follicles isolated from cryopreserved ovarian tissues in the mouse. Cryobiology 57 (3), 209–215. Cossigny, D.A., Findlay, J.K., Drummond, A.E., 2012. The effects of FSH and activin A on follicle development in vitro. Reproduction 143 (2), 221–229. El-Hefnawy, T., Zeleznik, A.J., 2001. Antigen (PCNA) and Cyclin D2 expression in rat granulosa cells synergism between FSH and activin in the regulation of proliferating cell nuclear. Endocrinology 142 (10), 4357–4362. Glister, C., Satchell, L., Knight, P.G., 2011. Granulosal and thecal expression of bone morphogenetic protein and activin-binding protein mRNA transcripts during bovine follicle development and factors modulating their expression in vitro. Reproduction 142 (4), 581–591. Joyce, I.M., Pendola, F.L., Wigglesworth, K., Eppig, J.J., 1999. Oocyte regulation of kit ligand expression in mouse ovarian follicles. Dev. Biol. 214, 342–353. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the  2ΔΔCT method. Methods 25, 402–408. Markström, E., Svensson, E.C., Shao, R., Svanberg, B., Billig, H., 2002. Survival factors regulating ovarian apoptosis: dependence on follicle differentiation. Reproduction 123, 23–30. Martins, F.S., Celestino, J.J., Saraiva, M.V.A., Chaves, R.N., Rossetto, R., Silva, C.M., Lima-Verde, I.B., Lopes, C.A., Campello, C.C., Figueiredo, J.R., 2010. Interaction between growth differentiation factor 9, insulin-like growth factor I and growth hormone on the in vitro development and survival of goat preantral follicles. Braz. J. Med. Biol. Res. 43, 728–736. Mclaughlin, M., Bromfield, J.J., Albertini, D.F., Telfer, E.E., 2010. Activin promotes follicular integrity and oogenesis in cultured preantral bovine follicles. Mol. Hum. Reprod. 16 (9), 644–653. Mizunuma, H., Liu, X., Andoh, K., Abe, Y., Kobayashi, J., Yamada, K., Yokota, H., Ibuki, Y., Hasegawa, Y., 1999. Activin from secondary follicles causes small preantral follicles to remain dormant at the resting stage. Endocrinology 140 (1), 37–42. Pangas, S.A., Woodruff, T.K., 2000. Activin signal transduction pathways. Trends Endocrinol. Metab. 11 (8), 1043–2760. Rebouças, E.L., Costa, J.J., Passos, M.J., Silva, A.W., Rossi, R.O., van den Hurk, R., Silva, J.R., 2013. Expression levels of mRNA for insulin-like growth factors 1 and 2, IGF receptors and IGF binding proteins in in vivo and in vitro grown bovine follicles. Zygote 9, 1–12. (doi.org/10.1017/ S0967199413000166). Rodgers, R.J., Irving-Rodgers, H.F., 2010. The morphological classification of bovine ovarian follicles. Reproduction 139, 309–318. Santos, R.R., Tharasanit, T., Van Haeften, T., Figueiredo, J.R., Silva, J.R.V., Van Den Hurk, R., 2007. Vitrification of goat preantral follicles enclosed in ovarian tissue by using conventional and solid-surface vitrification methods. Cell Tissue Res. 327, 167–176. Santos, R.R., Tharasanit, T., Figueiredo, J.R., Van Haeften, T., Van Den Hurk, R., 2006. Preservation of caprinepreantral follicle viability after cryopreservation in sucrose and ethylene glycol. Cell Tissue Res. 325, 523–531. Saraiva, M.V.A., Celestino, J.J.H., Araújo, V.R., Chaves, R.N., Almeida, A.P., Lima-Verde, I.B., Duarte, A.B.G., Silva, G.M., Martins, F.S., Bruno, J.B., Matos, M.H.T., Campello, C.C., Silva, J.R.V., Figueiredo, J.R., 2010a. Expression of follicle-stimulating hormone receptor (FSHR) in goat ovarian follicles and the impact of sequential culture medium on in vitro development of caprine preantral follicles. Zygote 21, 1–10. Saraiva, M.V.A., Rossetto, R., Brito, I.R., Celestino, J.J., Silva, C.M., Faustino, L.R., Almeida, A.P., Bruno, J.B., Magalhães, D.M., Matos, M.H., Campello, C.C., Figueiredo, J.R., 2010b. Dynamic medium produces caprine embryo from preantral follicles grown in vitro. Reprod. Sci. 17, 1135–1143. SAS Institute Inc., 2002. Statistical Analysis System User's Guide. Version 9.13. SAS Institute, Cary, USA. Schotanus, K., Hage, W.J., Vanderstichele, H., Van Den Hurk, R., 1997. Effects of conditioned media from murine granulosa cell lines on the growth of isolated bovine preantral follicles. Theriogenology 48, 471–483.

A.W.B. Silva et al. / Livestock Science 160 (2014) 199–207

Silva, C.M.G., Castro, S.V., Faustino, L.R., Rodrigues, G.Q., Brito, I.R., Saraiva, M.V.A., Rossetto, R., Silva, T.F.P., Campello, C.C., Figueiredo, J.R., 2011. Moment of addition of LH to the culture medium improves in vitro survival and development of secondary goat preantral follicles. Reprod. Domest. Anim. 46, 579–584. Silva, C.M.G., Matos, M.H.T., Rodrigues, G.Q., Faustino, L.R., Pinto, L.C., Chaves, R.N., Araújo, V.R., Campello, C.C., Figueiredo, J.R., 2010. In vitro survival and development of goat preantral follicles in two different oxygen tensions. Anim. Reprod. Sci. 117, 83–89. Thomas, F.H., Armstrong, D.G., Telfer, E.E., 2003. Activin promotes oocyte development in ovine preantral follicles in vitro. Reprod. Biol. Endocrinol. 1, 76–82. Thomas, F.H., Ethier, J.F., Shimasaki, S., Vanderhyden, B.C., 2005. Follicle stimulating hormone regulates oocyte growth by modulation of expression of oocyte and granulosa cell factors. Endocrinology 146, 941–949.

207

Van Den Hurk, R., Spek, E.R., Hage, W.J., Fair, T., Ralph, J.H., Schotanus, K., 1998. Ultrastructure and viability of isolated bovine preantral follicles. Hum. Reprod. 4, 833–841. Wandji, S.A., Pelletier, G., Sirard, M.A., 1992. Ontogeny and cellular localization of 125I-labeled basic fibroblast growth factor and 125Ilabeled epidermal growth factor binding sites in ovaries from bovine fetuses and neonatal calves. Biol. Reprod. 47, 807–813. Woodruff, T.K., Lyon, R.J., Hansen, S.E., Rice, G.C., Mather, J.P., 1990. Inhibin and activin locally regulate rat ovarian folliculogenesis. Endocrinology 127, 3196–3205. Zhao, J., Taverne, M.A., Van Der Weijden, G.C., Bevers, M.M., Van Den Hurk, R., 2001. Effect of activin A on in vitro development of rat preantral follicles and localization of activin A and activin receptor II. Biol. Reprod. 65, 967–977.