- Email: [email protected]
Differential expression and regulation by 20-hydroxyecdysone of mosquito ecdysteroid receptor isoforms A and B
Molecular and Cellular Endocrinology 196 (2002) 29 /42 www.elsevier.com/locate/mce
Differential expression and regulation by 20-hydroxyecdysone of mosquito ecdysteroid receptor isoforms A and B Sheng-Fu Wang a,1, Chao Li a,2, Guoqiang Sun a,b, Jinsong Zhu b, Alexander S. Raikhel b,* a b
Program in Genetics, Michigan State University, East Lansing, MI 48824, USA Department of Entomology, University of California, Riverside, CA 92521, USA Received 14 May 2002; accepted 15 July 2002
Abstract Cloning of the AaEcR-A isoform, along with the previously cloned AaEcR-B isoform, has permitted us to evaluate the expression of AaEcR isoforms during mosquito vitellogenesis. Mosquito EcR isoform transcripts exhibited dramatically different patterns of expression after a blood meal-triggered activation of vitellogenesis in the fat body. The AaEcR-B transcript level rose sharply by 4-h post blood meal (PBM), coinciding with the small ecdysteroid peak, and then declined reaching its lowest level at 16 /24-h PBM. In contrast, the AaEcR-A transcript peaked at 16 /20-h PBM, coinciding with the large ecdysteroid peak. AaEcR-B and AaEcR-A transcripts exhibited a striking difference in sensitivity to 20-hydroxyecdysone (20E), being maximally activated at 10 8 and 10 6 M, respectively. Both ecdysteroid receptor (EcR) isoform mRNAs were transcribed in a cycloheximide-independent manner, suggesting that they are direct targets of 20E. However, AaEcR-A transcription requires continuous presence of 20E, while AaEcRB mRNA level rose for 4 h and then declined under the same conditions. These results indicate the mosquito EcR isoforms play distinct physiological functions during vitellogenesis in the mosquito fat body. # 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Nuclear receptor; Isoform; Steroid hormone; Vitellogenesis; Ecdysteroid
1. Introduction Ecdysteroids function in a variety of biological processes, including development, metamorphosis and reproduction (Hagedorn, 1989; Riddiford, 1993; Dhadialla and Raikhel, 1994). The molecular basis of 20hydroxyecdysone (20E) action has been studied in detail during metamorphosis in Drosophila melanogaster (reviewed by Thummel, 1996, 1997). Based on studies of the effect of 20E on puffing of Drosophila polytene chromosomes, Ashburner et al. have proposed a model * Corresponding author. Tel.: /1-909-787-2129; fax: /1-909-7872130 E-mail address: [email protected] (A.S. Raikhel). 1 Present address: Wayne State University School of Medicine, 540 East Canfield, Detroit, MI 48201, USA. 2 Present address: Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.
of the ecdysteroid-triggered gene hierarchy (Ashburner et al., 1974). Subsequent molecular studies have confirmed and extended the Ashburner model. 20E manifests its effects through a receptor that is a heterodimer of two members of the nuclear receptor gene family, the ecdysteroid receptor (EcR) and a homolog of the retinoid X receptor, ultraspiracle (USP) (Yao et al., 1992, 1993; Thomas et al., 1993). The EcR/USP heterodimer binds to a sequence-specific DNA motif, called the ecdysteroid-responsive element (EcRE) and directly induces several primary-responsive genes, including E74, E75 and BR-C. In turn, products of these primary or early genes activate late-target genes. Resembling vertebrate steroid receptors, EcR/USP DNA binding activity requires activation by a chaperone heterocomplex (Arbeitman and Hogness, 2000). Although distinct from molting and metamorphosis, insect reproduction appears to utilize a similar ecdysteroid gene regulatory hierarchy (Raikhel et al., 1999; Pierceall et al., 1999;
0303-7207/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 3 0 3 - 7 2 0 7 ( 0 2 ) 0 0 2 2 5 - 3
30
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Kapitskaya et al., 2000; Li et al., 2000; Wang et al., 2000a; Sun et al., 2002). EcR and USP have been cloned from a variety of arthropods (Henrich and Brown, 1995). Protein sequences deduced from EcR and USP cDNA sequences display a structural organization containing five domains characteristic of members of the nuclear receptor family: A/B, C, D, E and F (Henrich and Brown, 1995). The 66-aa C domain, or DNA binding domain (DBD), harbors two C2C2 zinc finger modules conferring sequence-specific DNA binding activity. The DBD is a highly conserved region among nuclear receptors. Domain E, the ligand-binding domain (LBD), is responsible for specific ligand binding. It also contains motifs for dimerization and transactivation (AF-2). Another transactivation domain (AF-1) is located in the domain A/B. There is little conservation among different subclasses of nuclear receptors within domains A/B, D and F. The pleiotropic roles of 20E in development and reproduction are mediated, at least in part, by the multiple isoforms of EcR and USP. EcR isoforms have been first identified in Drosophila (Talbot et al., 1993) and then in lepidopreran insects, including Manduca sexta (Fujiwara et al., 1995; Jindra et al., 1996), Bombyx mori (Swevers et al., 1995; Kamimura et al., 1996, 1997) and Choristoneura fumiferana (Perera et al., 1999). In Drosophila , three EcR isoforms (EcR-A, EcR-B1 and EcR-B2) differ in the N-terminal A/B domain because of utilization of different transcription start sites and alternative splicing (Talbot et al., 1993). Unlike EcR, only a single USP form has been identified in Drosophila . However, two USP cDNA isoforms have been cloned from Aedes (AaUSP-A and AaUSP-B, Kapitskaya et al., 1996), Manduca (MsUSP-1 and MsUSP-2, Jindra et al., 1997), and Chironomus tentans (Vogtli et al., 1999). In all three insects, these USP isoforms differ only in their N-termini and A/B domains, suggesting that they are encoded by the same gene. In mosquitoes, 20E plays a key role in regulating activation and maintaining a blood meal-triggered vitellogenesis. Ecdysteroid release stimulates the fat body to produce several yolk protein precursors, vitellogenin (Vg), vitellogenic carboxypeptidase (VCP) and vitellogenic cathepsin B (Hays and Raikhel, 1990; Cho et al., 1991, 1999). In the mosquito, only one EcR isoform has been cloned and characterized, which is most homologous to the Drosophila B1 isoform (Cho et al., 1995). Mosquito EcR has been shown to be capable of heterodimerization with either AaUSP-A or AaUSPB, and both heterodimers bind a variety of potential EcREs arranged as either inverted repeats or direct repeats (Wang et al., 1998, 2000a). However, AaEcR-B/ AaUSP-B heterodimer displays stronger DNA binding and transactivation activities than the AaEcR-B/
AaUSP-A heterodimer (Wang et al., 2000a). Even more striking is the effect of 20E on expression of mosquito USP isoforms: while the AaUSP-B transcript is strongly activated by 20E, AaUSP-A is inhibited by the hormone (Wang et al., 2000a). Expression pattern of AaUSP-B isoform transcript, along with other data, suggests that it likely functions as a heterodimeric partner for AaEcR during activation and maintenance of 20E-regulated genes during mosquito vitellogenesis. We report here the cloning and functional characterization of a new mosquito EcR isoform that is designated as AaEcR-A due to the fact that the isoform specific region is homologous to EcR-A in other species. The original Aedes aegypti EcR has been renamed as AaEcR-B because of its homology with Drosophila EcR-B1 isoform. Data presented in this paper suggest that both EcR isoforms are involved in vitellogenesis in the mosquito fat body. However, their expression and regulation by 20E are strikingly different.
2. Materials and methods 2.1. Animals Mosquitoes, A. aegypti, were reared as described by Hays and Raikhel (1990). Vitellogenesis was initiated in 3 /5 day old adult female mosquitoes by blood feeding them on white rats. 2.2. Cloning of EcR-A cDNA To amplify an EcR-A specific region, three primers were used: two degenerate primers, A-16 [GG(A/ C)AGCTA(T/C)G(A/G)TCC(T/G)TACAG] and A-256 [GGI(T/A)(C/G)ITA(C/T)(G/G)(G/A)ICCITA(C/T)(T/ A)(C/G)ICC], as well as a reverse primer from the AaEcR-B hinge region, GSP-4 [CGTCCTGGTACCAGATGAG]. Three cDNA libraries, prepared from whole bodies of previtellogenic female mosquitoes, female fat bodies, and ovaries dissected at different times of vitellogenic period, were used as templates for PCR amplification with Taq polymerase. The PCR amplification was conducted with an initial denaturation at 94 8C for 2 min, followed by 35 cycles of annealing at 60 8C for 30 s, elongation at 72 8C for 50 s and denaturation at 94 8C for 30 s. A rapid amplification of cDNA ends (RACE) strategy was used to clone the ends of the cDNA. In the first RACE, an isoform-A specific reverse primer, A-Rev1 [CACGACCCATTTTTCCATTTGG] with 6 bases from the common region and 16 bases from isoform-A specific region was used. For the second round of PCR amplification, a ZAP-T7 primer [CGACTCACTATAGGGCGAATT] derived from the cDNA library vector was used as a forward primer and the previtello-
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
genic whole body library was used as the template. For confirmation of this new clone, another forward primer A-For1 [TGACGGCCATTCCGGCTTC] from upstream of the new clone and GSP-4 primer were used for PCR followed by Southern blot analysis. For the second RACE reaction, total RNA isolated from ovaries of 1-h post blood meal (PBM) females was primed with random hexamer for reverse transcription. After tailing the cDNA fragments with dCTP, AaEcR-A was initially amplified with a primer pair, A-Rev1, and AAP (5? RACE Abridged Anchor Primer, Gibco BRL). The amplified fragment was column-purified as recommended by the manufacturer, and a second PCR reaction was conducted with the initial product as the template and A-Rev2 and AAP as primers. The secondary PCR product was fractionated on the agarose gel to remove potential short amplified fragments (B/ 400 bp). The gel-purified secondary PCR product was subjected to a third round of PCR amplification with ARev2 and AAP as primers. Multiple bands with sizes ranging from 500 bp to 1.6 kb were detected, the longest of which, 1.6 kb in length, was subcloned into pGEM-T vector and sequenced. To amplify the entire AaEcR-A open reading frame (ORF), a new primer pair was designed, a forward primer A-For2 [ATCAGTGTATTCGTCATCACAATTG] from the 5?-end of the 1.6-kb fragment, and GSP2 [5?-CGTGCCCTACACTAGCTATACCTG3?], which contains the stop codon in the EcR Cterminal common region. The cDNA was synthesized using total RNA from vitellogenic females 24-h PBM, primed with random hexamer. This cDNA product was subjected to PCR amplification with the Pfu polymerase (Promega) using A-Rev2 and GSP2, with 30 cycles of 30 s at 94 8C, 30 s at 60 8C, and 8 min at 728. A 3.1-kb fragment of the expected size (initially called EcR-A5) was subcloned into pPCR-Script Amp (Stratagene) and sequenced. 2.3. Sequencing and sequence analysis Sequencing was performed at the Michigan State University DNA Sequencing Facility utilizing dye terminator and dye primers. A-For1, A-For2, A-For3, A-Rev1, A-Rev2 and A-Rev3 as well as primers from pGEM-T and pPCR-Script vectors were used to sequence the two strands. Unless otherwise indicated, sequence analyses were performed using DNAstar or a web based GCG (Genetics Computer Group, Inc.) software. 2.4. Northern blot analysis Messenger RNA was isolated from 100 female mosquitoes 3 /5 days post-eclosion or 24-h PBM using the QuickPrep Micro mRNA Purification Kit (Amer-
31
sham Pharmacia Biotech). Northern blots were performed essentially as described before (Cho et al., 1995). Probes were prepared by PCR reaction with specific primers using plasmids containing corresponding cDNA clone as templates. A 1082-bp EcR-A specific fragment was generated with the primer pair A5-For and A5-Rev. A 437-bp EcR-B specific fragment was generated with the primer pair EcR-For2 (AGCATGCTGAATCGGTCGGAG), EcR-Rev2 (CCGTGAAGCCACCATTGTTGG). A 314-bp fragment (Wang et al., 2000a) derived from the LBD region was used as an EcR common probe. Probes were labeled with a Random Primer kit (Gibco BRL). 2.5. RT-PCR and Southern blot analyses Reverse transcription PCR and Southern blot were performed as described before (Wang et al., 2000a). Total RNA was isolated from fat bodies and ovaries dissected from 20 to 50 female mosquitoes 3 /5 days post-eclosion or different time points, from 4/48-h PBM, followed by reverse transcription with Superscript II reverse transcriptase (Gibco BRL). This cDNA product was subjected to PCR amplification with 20 cycles of 45 s at 94 8C, 45 s at 60 8C, and 1 min at 72 8C. Southern blot probes were generated by PCR with the same primer pair using plasmid DNA containing the corresponding cDNA clone as the template, followed by labeling with Random Primer Kit (Gibco BRL). EcR-A probe was generated as described above. A 463-bp long DNA fragment encoding the yolk protein precursor protein, VCP and a 424-bp DNA fragment actin were amplified with primer pairs described before (Pierceall et al., 1999; Wang et al., 2000a). For mRNA developmental profiles, actin was used for normalization. First, cDNA templates from each time point were PCR amplified with actin primers followed by a Southern blot with actin as a probe and phosphorimager quantification. Then, cDNA templates from each time point equivalent to 1 pg of actin were used for PCR with EcR-A, EcR-B, and VCP primers followed the Southern blot and phosphorimager quantification. 2.6. In vitro fat body culture Previtellogenic female mosquito fat bodies were dissected and cultured as described before (Deitsch et al., 1995). Fat bodies were incubated in the absence of hormone or in the presence of 106 M of the hormone with or without cycloheximide (Chx). One mM Chx was used in the treatments. This concentration of Chx reversibly inhibits over 98% of protein synthesis in in vitro cultured fat body (Deitsch et al., 1995). Total RNA was isolated from these fat bodies and subjected to reverse transcription, PCR amplification, Southern blot and phosphorimager quantification.
32
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
2.7. In vitro gene expression and electrophoresis gel mobility assay pPCRScript-EcRA plasmid was linearized with Not 1 at their 3?-ends, allowing efficient in vitro transcription/ translation (TNT, Promega) with T7 promoter. pCDNA3.1/Zeo(/)-EcRB, pCDNA3.1/Zeo(/)-USPA and pCDNA3.1/Zeo(/)-USPB (Wang et al., 1998, 2000b) were used to express EcR-B, USP-A and USPB with T7 polymerase, respectively. Electrophoresis gel mobility assay (EMSA) was performed as described before (Wang et al., 2000b). DmUSP monoclonal antibody was a generous gift from Dr F.C. Kafatos, EMBL, Heidelberg, Germany (Christiansen et al., 1992).
3. Results 3.1. Cloning and analysis of the mosquito EcR isoform A Cloning of A. aegypti cDNA encoding AaEcR-A was accomplished by a RT-PCR-based approach. To amplify an EcR-A specific region, two degenerate primers A-16 and A-256 were paired with a reverse primer from the AaEcR-B hinge region, GSP-4 (see Figs. 1/3 for primer design). Three cDNA libraries, prepared from whole bodies of previtellogenic female mosquitoes, female fat bodies, and ovaries dissected at different times of vitellogenic period, were used as templates for PCR amplification. A strong band of predicted size 622 bp was obtained from the previtellogenic whole body library with the primer pair A-16 and GSP-4, whereas only weak bands were obtained from fat body and ovarian libraries with these primers. No band was amplified with A-256/GSP-4 primers. After sequencing, we confirmed this 622 bp band was a fragment of EcR as it contained the common region including the DBD,
hinge region and part of the A/B domain different from that of AaEcR-B. This 622-bp fragment was designated as a putative EcR-A. A RACE strategy was used to clone the ends of the cDNA. In the first RACE, we designed an isoform-A specific reverse primer, with 6 bases from the common region and 16 bases from isoform-A specific region. A 340-bp AaEcR-A fragment was amplified, subcloned and sequenced. The deduced amino acid from this region was highly identical to DmEcR-A (Figs. 1 and 2). To confirm that this new clone was a true EcR isoform, a new forward primer A-For1 from upstream of the new clone (Figs. 1 and 3, single-underlined) and GSP-4 were used for PCR followed by Southern blot analysis. Total RNA from the fat body and ovaries of 3h PBM females was reverse-transcribed with random primers. These reverse transcription products were PCR amplified with the primer pair A-For and GSP-4. A parallel PCR amplification was conducted with the previtellogenic whole body library as the template. A predicted 870-bp fragment was amplified from these PCR reactions, which hybridized with a labeled probe containing the AaEcR common region (data not shown), indicating that the new clone was a real EcR isoform. For the second RACE reaction, total RNA isolated from ovaries of 1-h PBM females was primed with random hexamer for reverse transcription. After tailing the cDNA fragments with dCTP, AaEcR-A was initially amplified with a primer pair, A-Rev1 (Fig. 2, doubleunderlined), and AAP. The purified amplified fragment was subjected to a second PCR reaction with A-Rev2 (Fig. 2) and AAP as primers. The gel-purified secondary PCR product was subjected to a third round of PCR amplification with A-Rev2 and AAP as primers. Multiple bands with sizes ranging from 500 bp to 1.6 kb were
Fig. 1. Schematic diagram of AaEcR isoform mRNA structures and primers used for serial amplification of EcR-A. These isoforms share identical domains B /F (blank boxes), but display unique sequences in their 5?-UTR and N-terminal coding region (designated domain A). The EcR-B specific region is shown with upward diagonal bars and EcR-A specific regions with downward diagonal bars, respectively. The first PCR reaction with GSP4 and degenerate primer A-16 led to the identification of a 17-bp EcR-A specific region, based on which A-Rev1 was designed. A-Rev1 and an anchor primer ZAP-T7 yielded a 320 bp EcR-A1 region. Another RACE reaction using A-Rev2 and another anchor primer AAP led to amplification of a 1.6 kb fragment. A-For2, designed from the 5?-end of this 1.6 kb fragment, and GSP2 amplified the entire ORF of EcR-A.
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
33
Fig. 2. Nucleotide and deduced amino acid sequences of mosquito EcR-A isoform specific region. At the 3? ends, nucleotides common to EcR-A, and EcR-B are in lower case. Primers used in PCR cloning and sequencing are single-underlined (forward primers) or double-underlined (reverse primers).
detected, the longest of which, 1.6-kb in length, was subcloned and sequenced. To amplify the entire AaEcR-A ORF, a new primer pair was designed, a forward primer A-For2 from the 5?end of the 1.6-kb fragment, and GSP2, which contains the stop codon in the EcR C-terminal common region. The cDNA was synthesized using total RNA from vitellogenic females 24-h PBM, primed with random hexamer. This cDNA product was subjected to PCR amplification. A 3.1-kb fragment of the expected size was subcloned and sequenced. The AaEcR-A clone contained 1576-bp isoform specific region. Conceptual translation of AaEcR-A cDNA revealed a 255 amino acids domain A as isoform specific. The rest of the clone (domains B /F) was identical to the previously reported EcR-B (domain B /F) (Figs. 1 and 2). The 255aa AaEcR-A N-terminal was 32.8% identical to the 197aa counterpart in DmEcR. Domains A in BmEcR-A and MsEcR-A were 93.8% identical, each
being 79.2% identical to CfEcR-A, indicating that lepidopteran EcR-A isoforms exhibited much higher identity than dipteran ones (Fig. 3). EcR-A of the beetle, Tenebrio molitor is even more distantly related (data not shown). To evaluate the size of AaEcR-A and AaEcR-B transcripts, we conducted a Northern blot analysis using mRNA prepared from 100 female mosquitoes at 24-h PBM (Fig. 4). In mRNA samples, AaEcR-A specific probe hybridized to 5.6- and 9-kb transcripts, AaEcR-B specific probe hybridized with a major 4.2-kb transcript as well as with the 9-kb band. The entire AaEcR-A clone was 2821 bp and the total length would be 3139 bp if the 3?-UTR of AaEcR-B was included. This was still much shorter than the 5.6 kb band detected in the Northern blot, indicating the entire full-length cDNA sequence of AaEcR-A was not cloned. The identity of the 9-kb band remains to be clarified. Next, we used coupled in vitro transcription/translation to synthesize 35S-labeled EcR isoforms and resolved
34
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Fig. 3. Mosquito EcR-A is homologous to EcR-A from other insect species. Amino acid sequences homologous among species are boxed. Sequences used in this alignment are EcR-A from Bombyx mori (BmEcR-A, Kamimura et al., 1997), Manduca sexta (MsEcR-A, Jindra et al., 1996), CfEcR-A (Perera et al., 1999), A. aegypti (AaEcR-A, this study), and Drosophila melanogaster (DmEcR-A, Talbot et al., 1993). Tenebrio molitor (Mouillet et al., 1997) and Amblyomma americanum (Guo et al., 1997) EcR-As are not included in this alignment due to their low identity with these EcR-A sequences. Multiple sequence alignment was done with ClustalW 1.8 http://searchlauncher.bcm.tmc.edu/multi-align/multi-align.html. Box shading was done with http://www.ch.embnet.org/software/BOX_form.html.
them by SDS-PAGE. AaEcR-A and AaEcR-B expression plasmids yielded proteins of expected sizes, 98 and 75 kd, respectively (not shown). 3.2. AaEcR-A has similar DNA binding properties and ligand responsiveness to those of AaEcR-B We utilized in vitro TNT expressed EcR proteins and hsp27 EcRE to investigate DNA binding properties of the newly cloned mosquito EcR isoform. AaEcR-A alone (without USP) displayed no binding activity to the EcRE (data not shown). The AaEcR-A/AaUSP-B heterodimer exhibited very weak binding that was dramatically increased by addition of 20E (Fig. 5A, lanes 1 and 2). The specificity of the binding complex was confirmed by a supershift using the anti-DmUSP antibodies (Fig. 5A, lane 3). In agreement with our previous results (Wang et al., 1998), AaEcR-B/AaUSPB heterodimers displayed negligible binding activity to the EcRE in the absence of the hormone (Fig. 5A, lane 4). Addition of 20E drastically increased DNA binding activity (Fig. 5A, lane 5) and the binding specificity was
further verified with the antibody super-shift assays (Fig. 5A, lane 6). The intensity of binding for both heterodimers was similar, indicating that AaEcR-A formed a heterodimer with USP-B with a binding affinity, comparable to that of AaEcR-B. Likewise, AaEcR-A formed a heterodimer with AaUSP-A that bound to the EcRE as strongly as the AaEcR-B/ AaUSP-A heterodimer (not shown). As we reported earlier, the commonly believed 20E precursor ecdysone also enhances mosquito AaEcR-B/ USP DNA binding activity (Wang et al., 2000b). We tested whether or not this hormone could exert similar effect on the AaEcR-A isoform. In control, AaEcR-B AaUSP-B DNA binding activity was enhanced by both 20E and ecdysone (Fig. 5B, lanes 5/7), being consistent with our previous results (Wang et al., 2000b). Similarly, AaEcR-A/AaUSP-B heterodimer binding to EcRE was enhanced by 20E and ecdysone (Fig. 5B lanes 1 /3). The binding specificity was validated using competition assay with unlabeled cold EcRE (Fig. 5B, lanes 4 and 8). Similar results were obtained with AaUSP-A (data not shown). These data indicated that the mosquito EcR
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Fig. 4. Northern blot analysis of EcR isoform transcripts. mRNA isolated from 100 mosquito females at 24-h post-blood feeding was subjected to the Northern blot analysis using sequential hybridization of isoform specific probes to EcR-A (lane 1) and EcR-B (lane 2) as well as a probe to a common EcR region, EcR-Com (lane 3).
isoforms possessed virtually identical DNA binding activities as well as similar responsiveness to ligand activation. Finally, we used EMSA to evaluate binding properties of AaEcR-A USP heterodimers to EcREs other than
35
Fig. 6. Competitive EMSA analysis of EcR-A binding properties to various EcREs. Heterodimers of USP-B-EcR-A (A) or USP-B-EcR-B (B) bound to the hsp27 EcRE were competed by 50- or 500-fold excess of unlabeled probes: HSP27, ER-6, DR-1 as well as the native Vg EcRE1. (C) Sequences of EcREs used in these experiments.
hsp27. In the first series of experiments, we used a competitive EMSA (Fig. 6). Heterodimers of AaEcR-A/ AaUSP-B or AaEcR-B/AaUSP-B bound to the hsp27
Fig. 5. EMSA analysis of EcR-A binding properties and responsiveness to ligands. (A). In vitro-expressed USP-B paired with either EcR-A (lanes 1 / 3) or EcR-B (lanes 4 /6) isoforms and tested for binding to the hsp27 EcRE (for sequence see Fig. 6) without addition of 20E (lanes 1 and 4) or with 20E (lanes 2 and 5). Lanes 3 and 6 are as lanes 2 and 5 with addition of monoclonal anti-DmUSP antibodies. (B) Enhancement by ecdysone of USPB heterodimers with either EcR-A (lanes 1 /4) or EcR-B (lanes 5 /8) isoforms binding to the hsp27 EcRE (lanes 2 and 6). Lanes 1 and 5, control incubations without any ligand; lanes 3 and 7, control incubations with 20E; lanes 4 and 8, specificity competition control with a 100-fold excess of the unlabeled hsp27 EcRE probe.
36
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
EcRE in the presence of 20E were competed by 50- or 500-fold excess of unlabeled probes: Hsp27, everted repeat (ER-6), DR-1 as well as the native Vg EcRE1, which is a composite element consisting of an ER-6 and a DR-1 sequence (Fig. 6C, Martin et al., 2001). These experiments showed that the binding properties of AaEcR-A with respect to its recognition of various EcREs and binding affinities were similar to those of AaEcR-B. Direct EMSA demonstrated that AaEcR-A/ USP heterodimers were capable of binding to the radiolabeled native Vg EcRE1 with the similar strength as heterodimers of AaEcR-B (not shown). 3.3. Expression of EcR isoform transcripts in the mosquito fat body during vitellogenesis Having mosquito EcR-A and EcR-B-specific probes, we were able to undertake RT-PCR/Southern blot analysis to examine mRNA profiles of the EcR isoforms in the fat body during mosquito vitellogenesis. Both isoforms exhibited elevated levels of transcription after the onset of vitellogenesis triggered by a blood feeding. However, the profiles of expression for AaEcR-A and AaEcR-B transcripts were entirely different. The level of AaEcR-A transcript elevated only slightly during first 4 h following a blood meal, but rose rapidly between 4 and 16-h PBM. The transcript reached its plateau at 16/ 20-h PBM with a 6-fold induction compared to its mRNA at the previtellogenic stage, then it started to decline at 24-h PBM, reaching its previtellogenic level at 48-h PBM (Fig. 7A). In contrast, AaEcR-B mRNA level increased dramatically at 4-h PBM with more than 6-fold induction, then started to decline and returned to its previtellogenic level at 24-h PBM (Fig. 7B). Interestingly, AaEcR-B mRNA displayed smaller peak (4-fold of induction) at 36-h PBM. Thus, these results demonstrated that mosquito EcR isoforms exhibited distinct transcriptional profiles during vitellogenesis. As a positive control, the mRNA level of one of the major 20E-regulated target genes in the mosquito fat body, VCP (Cho et al., 1991; Deitsch et al., 1995), was tested in the same total RNA, which exhibited robust activation (nearly 400-fold induction) with a peak at 20 /24-h PBM (Fig. 7C). 3.4. In vitro effect of 20E on EcR isoform transcripts Using an EcR common probe, we have previously demonstrated that 20E directly induces EcR transcription (Wang et al., 2000a). The availability of EcR isoform-specific probes permitted us to address the question of how each isoform was regulated by the hormone. These experiments were conducted using an in vitro fat body culture system, which has been well established (Raikhel et al., 1997). The mosquito fat body
Fig. 7. RT-PCR analysis of the mRNA developmental profile of EcR isoforms. Total RNA isolated from 20 previtellogenic (FB-PV) or different time points (4 /48 h, FB-4-FB-48) PBM female mosquito fat bodies was subjected to reverse transcription followed by PCR amplification with primer pairs unique to EcR-A (A), EcR-B (B), VCP (C) or actin (not shown). PCR product was analyzed by Southern blot and quantified by phosphorimager. Relative amounts of mRNA were normalized with actin. The hormone 20E titer and the yolk protein Vg profile is shown in panel D. Each point represents an average of three independent experiments 9/SD.
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
is a relatively homogeneous tissue consisting of predominantly one cell type, trophocytes (Raikhel, 1992), making interpretation of results easier. Abdominal walls with adhering fat bodies, isolated from previtellogenic female mosquitoes (3 /5 days after eclosion) were incubated in culture medium either in the absence of hormone or in the presence of increasing amounts of 20E ranging from 10 8 /105 M (Fig. 8). After 4-h incubation, these fat bodies were subjected to RNA isolation, RT-PCR and Southern blotting analyses with isoform-specific probes. Both AaEcR-A and AaEcR-B were activated by 20E in a dose-dependent manner. The AaEcR-B transcript level was maximally induced at extremely low concentration of 20E of 10 8 M (Fig. 8). In contrast, the AaEcR-A mRNA was induced by this concentration of 20E only slightly and reached its maximal levels at 106 M 20E (Fig. 8). As a positive control, we monitored the 20E dose response of VCP mRNA. This 20E-responsive gene exhibited a peak induction level at 106 M 20E (Fig. 8). Next, we investigated the time course of 20E effects on the expression of EcR isoforms. In these experiments, dissected previtellogenic fat bodies were incubated in culture media in the presence or absence of 10 6 M 20E (Fig. 9). At 4-h intervals after incubation, EcR transcripts were analyzed as described above. The effect of 20E on expression of the two mosquito EcR isoforms in
37
cultured previtellogenic fat bodies was entirely different. Transcription of AaEcR-A required continuous presence of 20E in the culture medium; its transcript levels steadily increased at 8-, 12- and 16-h of incubation with 20E (Fig. 9A, closed squares). Withdrawal of 20E from the medium after 4-h of incubation resulted in decline of AaEcR-A transcript level (Fig. 9A, open squares). In contrast, under the same conditions, AaEcR-B transcript exhibited an initial rise at 4-h postincubation and then declined (Fig. 9B, closed squares). However, when fat bodies were incubated for 4 h in the presence of 20E and then transferred into a hormone-free medium, the level of the AaEcR-B continued to rise (Fig. 9B, open squares). As a positive control, we monitored the effect of 20E on VCP. Previtellogenic fat bodies incubated in hormone-free media did not show any detectable level of VCP gene expression (Fig. 9C). This is consistent with results we have reported before (Deitsch et al., 1995; Wang et al., 2000a). Continuous incubation in the presence of 20E resulted in the robust activation of VCP gene expression: the level of VCP mRNA doubled every 4 h during the 16-h incubation period (Fig. 9C, closed squares). Hormone withdrawal after a 4-h induction period reversed VCP gene activation, and the VCP mRNA levels returned to an undetectable level by 16-h of incubation (Fig. 9C, open squares).
3.5. Effect of Chx on EcR transcription
Fig. 8. Dose response of EcR-A, EcR-B and VCP to 20E in in vitro the fat body organ culture. Fat bodies dissected from nine previtellogenic female mosquitoes were cultured for 4 h in vitro either in the absence of hormone or in the presence of increasing concentrations of 20E ranging from 10 8 to 10 5 M. Total RNA was isolated from these fat bodies and subjected to RT-PCR with specific primers to EcR-A, EcR-B and VCP, respectively. The PCR products were resolved by the agarose gel electrophoresis, followed by Southern blotting and autoradiography, and were quantified by the phosphorimaging analysis. The intensity of bands from Southern blots was quantified by phosphorimaging. For EcR-A and EcR-B, the level of amplified transcript detected from previtellogenic fat bodies prior to any treatment was defined as 1 unit. For the VCP mRNA, the level of amplified transcript detected from previtellogenic fat body treated only with 10 6 M 20E for 4 h was defined as 100 units.
To assess whether or not mosquito EcR isoforms were under direct or indirect control of 20E, we utilized a protein synthesis inhibitor Chx in the in vitro fat body culture experiments (Fig. 10). Previtellogenic fat bodies were pretreated with culture media containing 1 mM Chx, followed by further incubation with or without 106 M 20E. Fat bodies cultured continuously in the presence of 1 mM Chx and 20E exhibited AaEcR-A transcription at much higher levels than after continuous incubations with 20E alone (Fig. 10A, closed squares), clearly demonstrating the direct control of 20E on the AaEcR-A transcription. When the 20Ewithdrawal experiment was performed in the presence of Chx, no super-induction was observed (Fig. 10A, open squares). The effect of Chx on the 20E induction of AaEcR-B was very dramatic: it eliminated the inhibition of AaEcR-B transcription occurring after incubation in the presence of 20E alone. Instead, this incubation resulted in super-induction of AaEcR-B mRNA (Fig. 10B, closed squares), indicating that AaEcR-B was also directly controlled by 20E. Interestingly, 20E-withdrawal from Chx-containing media led to considerably reduced, but still elevated levels of AaEcR-B transcript (Fig. 10B, open squares).
38
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Fig. 9. Effect of 20E on the transcription of EcR-A (upper panel), EcR-B (middle panel), and VCP (lower panel) in the previtellogenic fat bodies. Previtellogenic fat bodies dissected from female mosquitoes (3 /5 day after eclosion) were incubated in culture media only (open triangles), with a 4-h pulse treatment of 10 6 M 20E (open squares), or with continuous 20E treatment (closed squares) for 16 h. At every 4-h interval, a group of 9 fat bodies were collected and subjected to RNA isolation, RT-PCR amplification and Southern blot analysis. The intensity of bands from Southern blots was quantified by phosphorimaging. For EcR-A and EcR-B, the level of amplified transcript detected from previtellogenic fat bodies prior to any treatment was defined as 1 unit. For the VCP mRNA, the level of amplified transcript detected from previtellogenic fat body treated only with 20E for 16 h was defined as 100 units.
As a control, the level of VCP transcription was also monitored in these fat bodies. Addition of Chx to the culture medium resulted in complete inhibition of VCP
mRNA irrespective of the presence or absence of 20E (Fig. 10C).
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
39
Fig. 10. Effect of 20E and Chx on the transcription of EcR-A (upper panel), EcR-B (middle panel), and VCP (lower panel) in the previtellogenic fat bodies. Previtellogenic fat bodies dissected from female mosquitoes (3 /5 day after eclosion) were incubated in culture media with 1 mM Chx (open triangles), with 1 mM Chx and a 4-h pulse 20E treatment (open squares) or with 1 mM Chx and continuous 20E treatment (closed squares) for 16 h. At every 4-h interval, a group of 9 fat bodies were collected and subjected to RNA isolation, RT-PCR amplification and Southern blot analysis. The intensity of bands from Southern blots was quantified by phosphorimaging as described in Figure. For comparison, respective mRNA profiles of fat bodies treated with 20E continuously were plotted in each panels (dotted curve with closed squares).
4. Discussion In this work, we have identified second mosquito EcR isoform with a distinct N-terminus, which has been designated as AaEcR-A. The AaEcR-A specific region
exhibits 32% identity with that of DmEcR-A, whereas the same region among Lepidoptera displays 80% or even higher identity. Dipteran EcR isoform B-specific region is also less conserved with identity ranging from 36 to 51% in its various portions, while the same region
40
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
in Lepidoptera shares overall identity close to 80% (Wang, 1999). These results indicate that EcR-A isoform and EcR-B -specific regions are under similar selection pressure during evolution in this group of insects. In addition to their N-terminal coding regions, mosquito EcR-A and EcR-B isoforms are entirely different in their 5?-UTRs, suggesting that their respective transcription units likely utilize alternative promoters. This is reminiscent of the Drosophila EcR gene structure, in which DmEcR-A and DmEcR-B1 use their unique 5?-upstream alternative promoters; while DmEcR-B1 and DmEcRB2 are derived by alternative splicing of transcripts initiated by the same promoter (Talbot et al., 1993). Despite dramatic differences in their N-termini, our EMSA analysis showed that binding properties of AaEcR-A are similar to those of AaEcR-B. Like heterodimers of AaEcR-B, those of AaEcR-A recognized various EcREs with similar affinities. Likewise, the two EcR isoforms in C. fumiferana heterodimerize with USP to bind various EcREs with equal binding affinities (Perera et al., 1999). Moreover, ecdysone and 20E were effective ligands for heterodimers containing either AaEcR-A or AaEcR-B. Importantly, competitive and direct EMSAs have demonstrated that EcR-A USP heterodimers are capable of binding to the native Vg EcRE1 with the same strength as heterodimers of EcRB. Expression of EcR isoforms has been investigated for several insects including detailed studies of dipteran Drosophila and lepidopteran Manduca (Talbot et al., 1993; Bender et al. 1997; Jindra, et al., 1996, 1997; Kamimura et al., 1997; Mouillet et al., 1997; Perera et al., 1999). However, all these studies have dealt with EcR transcripts responses to 20E during metamorphosis. Our study is the first report concerning vitellogenic responses of EcR isoforms in the fat body, the major target of 20E regulation during reproduction. The onset of vitellogenesis and activation of ecdysteroid-responsive genes in this mosquito tissue are under strict control of blood feeding. Thus, this insect represents an outstanding model for studying the regulation of expression of EcR-A and EcR-B during vitellogenesis. Using a common probe to the mosquito EcR, we have previously showed that its expression encompasses the entire vitellogenic period. In this study, utilization of AaEcR-A and AaEcR-B-specific probes has allowed us to reveal details concerning their respective expression during vitellogenesis. Surprisingly, AaEcR-B is highly expressed at the onset of vitellogenesis and reaches its peak at 4-h PBM, the time of a small ecdysteroid peak (Hagedorn et al., 1975). Its expression pattern resembles the first peak of the transcription of the early gene E75 (Pierceall et al., 1999). However, AaEcR-B has a striking sensitivity to 20E being maximally activated at
108 M of the hormone, while AaUSP-B and AaE75 isoforms only at 10 7 M (Pierceall et al., 1999; Wang et al., 2000a). What are the functional implications of such high sensitivity of AaEcR-B to 20E? EcR-B is presumably the first transcript responding to a very low 20E titer. Its early expression is likely crucial for activation of early genes of the ecdysteroid regulatory hierarchy governing vitellogenic responses in the mosquito fat body. In vitro fat body culture experiments have shown that AaEcR-B transcript behaves as an early gene, being down regulated under the continuous exposure to 20E and up-regulated with the hormone withdrawal. Its super-induction in the presence of Chx clearly indicates that AaEcR-B is directly regulated by 20E and it is likely a subject of auto-regulated repression in the presence of the hormone. However, other direct 20E-induced transcription factors could be involved in its repression as well. Taken together with the pattern of its expression, these data imply that at the onset of vitellogenesis in the mosquito fat body AaEcR-B plays a primary role in activation of 20E-regulated genes, such as Vg and VCP . This suggestion is further supported by our preliminary experiments with cell transfection assay showing that AaEcR-B is a much more potent transactivator than AaEcR-A (S.F. Wang and A.S. Raikhel, unpublished observation). Yet our in vitro binding studies showed similar binding properties for the two EcR isoforms. In further support of the proposed role of AaEcR-B, in Drosophila mutants, the activation of ecdysteroid-induced genes is eliminated with the loss of EcR-B1, which is a homolog of AaEcR-B (Bender et al., 1997). The expression profile of the AaEcR-A transcript is strikingly different from that of AaEcR-B, having a peak at 16/20-h PBM, when the level of the AaEcR-B transcript is at its lowest. It corresponds to the large PBM peak of ecdysteroids (Hagedorn et al., 1975). Two early genes, AaE75 and AaE74B, also exhibit maximal levels of expression at this time (Pierceall et al., 1999; Sun et al., 2002). Interestingly that AaUSP-B transcript encoding the heterodimeric partner of the AaEcR isoforms increases at 3 /4-h PBM but is expressed over the entire vitellogenic period (Wang et al., 2000a). Experiments with in vitro fat body culture indicated that like AaEcR-B, AaEcR-A transcription is directly induced by 20E in a protein synthesis-independent manner. However, AaEcR-A transcription requires continuous presence of the hormone and declined upon its withdrawal. Overall, these results again indicate that AaEcR-A and AaEcR-B transcripts are likely controlled via alternative promoters. Regulatory mechanisms underlying the strikingly distinct responses of EcR isoforms to 20E remain to be elucidated. Although differential expression of EcR-A and EcRB during metamorphosis has been observed in several insects, their respective roles are poorly understood
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
(Talbot et al., 1993; Bender et al. 1997; Jindra et al., 1996, 1997; Kamimura et al., 1997; Mouillet et al., 1997; Perera et al., 1999). Studies of EcR isoforms during metamorphosis of the Drosophila nervous system have shown that they can play clearly distinct functions in different cells. A high level of EcR-A expression in the ventral CNS correlates with rapid degeneration of neurons after adult emergence (Robinow et al., 1993; Truman et al., 1994). Remodeling of larval neurons at metamorphosis begins with the pruning back of larvalspecific dendrites. EcR deletion mutants lacking EcR-B1 and EcR-B2 but retaining EcR-A fail to show the pruning response (Schubiger et al., 1998; Lee et al., 2000). However, adult-specific neurons, which normally express only EcR-A, can progress in their development (Schubiger et al., 1998). This example provides a clear demonstration that it is impossible to extrapolate the functions of EcR isoforms without direct investigation of their involvement in a particular developmental event regulated by 20E. Therefore, elucidation of respective roles of AaEcR-A and AaEcR-B isoforms in mosquito vitellogenesis awaits further studies.
Acknowledgements We thank Mr G. Attardo for critical reading of the manuscript and Dr F.C. Kafatos for his kind gift of the Drosophila USP monoclonal antibody. This work was supported by NIH grant AI-36959 to A.S. Raikhel.
References Arbeitman, M.N., Hogness, D.S., 2000. Molecular chaperones activate the Drosophila ecdysone receptor, an RXR heterodimer. Cell 101, 67 /77. Ashburner, M., Chihara, C., Meltzer, P., Richards, G., 1974. Temporal control of puffing activity in polytene chromosomes. Cold Spring Harbour Symp. Quant. Biol., 36662 /38655. Bender, M., Imam, F.B., Talbot, W.S., Ganetzky, B., Hogness, D.S., 1997. Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms. Cell 91, 777 /788. Cho, W.L., Deitsch, K.W., Raikhel, A.S., 1991. An extraovarian protein accumulated in mosquito oocytes is a carboxypeptidase activated in embryos. Proc. Natl. Acad. Sci. USA 88, 10821 / 10824. Cho, W.L., Tsao, S.M., Hays, A.R., Walter, R., Chen, J.S., Snigirevskaya, E.S., Raikhel, A.S., 1999. Mosquito cathepsin Blike protease involved in embryonic degradation of vitellin is produced as a latent extraovarian precursor. J. Biol. Chem. 274, 13311 /13321. Cho, W.L., Kapitskaya, M.Z., Raikhel, A.S., 1995. Mosquito ecdysteroid receptor: analysis of the cDNA and expression during vitellogenesis. Insect. Biochem. Mol. Biol. 25, 19 /27. Christiansen, A.M.K., King, D.L., Hatzivassiliou, E., Casas, J.E., Hallenbeck, P.L., Nikodem, V.M., Mitsialis, S.A., Kafatos, F.C., 1992. DNA binding and heteromerization of the Drosphila transcription factor chorion factor 1 ultraspiracle. Proc. Natl. Acad. Sci. USA 89, 11503 /11507.
41
Deitsch, K.W., Chen, J.S., Raikhel, A.S., 1995. Indirect control of yolk protein genes by 20-hydroxyecdysone in the fat body of the mosquito, Aedes. aegypti . Insect. Biochem. Mol. Biol. 25, 449 /454. Dhadialla, T.S., Raikhel, A.S., 1994. Endocrinology of mosquito vitellogenesis. In: Davey, K.G., Peter, R.E., Tobe, S.S. (Eds.), Perspectives in Comparative Endocrinology. National Research Council, Canada, pp. 275 /281. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K., Riddiford, L.M., 1995. Cloning of an ecdysone receptor homolog from Manduca sexta and the developmental profile of its mRNA in wings. Insect. Biochem. Mol. Biol. 25, 845 /856. Guo, X., Harmon, M.A., Laudet, V., Mangelsdorf, D.J., Palmer, M.J., 1997. Isolation of a functional ecdysteroid receptor homologue from the ixodid tick Amblyomma americanum (L.). Insect. Biochem. Mol. Biol. 27, 945 /962. Hagedorn, H.H., 1989. Physiological roles of hemolymph ecdysteroids in adult insect. In: Koolman, J. (Ed.), Ecdysone, From Chemistry to Mode of Action. Thieme Medical Publishers, Inc, pp. 279 /289. Hagedorn, H.H., O’Connor, J.D., Fuchs, M.S., Sage, B., Schlaeger, D.A., Bohm, M.K., 1975. The ovary as a source of ecdysone in an adult mosquito. Proc. Natl. Acad. Sci. USA 72, 3255 /3259. Hays, A.R., Raikhel, A.S., 1990. A novel protein produced by the vitellogenic fat body and accumulated in mosquito oocytes. Roux’s Arch. Dev. Biol. 199, 114 /121. Henrich, V.C., Brown, N.E., 1995. Insect nuclear receptors: a developmental and comparative perspective. Insect. Biochem. Mol. Biol. 25, 881 /897. Jindra, M., Malone, F., Hiruma, K., Riddiford, L.M., 1996. Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta . Dev. Biol. 180, 258 /272. Jindra, M., Huang, J.Y., Malone, F., Asahina, M., Riddiford, L.M., 1997. Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta . Insect. Mol. Biol. 6, 41 /53. Kamimura, M., Tomita, S., Fujiwara, H., 1996. Molecular cloning of an ecdysone receptor (B1 isoform) homologue from the silkworm, Bombyx mori , and its mRNA expression during wing disc development. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 113, 341 /347. Kamimura, M., Tomita, S., Kiuchi, M., Fujiwara, H., 1997. Tissuespecific and stage-specific expression of two silkworm ecdysone receptor isoforms */ecdysteroid-dependent transcription in cultured anterior silk glands. Eur. J. Biochem. 248, 786 /793. Kapitskaya, M., Wang, S.F., Cress, D.E., Dhadialla, T.S., Raikhel, A.S., 1996. The mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer: cloning and characterization of isoforms expressed during vitellogenesis. Mol. Cell. Endocrinol. 121, 119 /132. Kapitskaya, M.Z., Li, C., Miura, K., Segraves, W., Raikhel, A.S., 2000. Expression of the early-late gene encoding the nuclear receptor HR3 suggests its involvement in regulating the vitellogenic response to ecdysone in the adult mosquito. Mol. Cell. Endocrinol. 160, 25 /37. Lee, T., Marticke, S., Sung, C., Robinow, S., Luo, L., 2000. Cellautonomous requirement of the USP/EcR-B ecdysone receptor for mushroom body neuronal remodeling in Drosophila . Neuron 28, 807 /818. Li, C., Kapitskaya, M.Z., Zhu, J., Miura, K., Segraves, W.A., Raikhel, A.S., 2000. Conserved molecular mechanism for the stage specificity of the mosquito vitellogenic response to ecdysone. Dev. Biol. 224, 96 /110. Martin, D., Wang, S.F., Raikhel, A.S., 2001. The vitellogenin gene of the mosquito Aedes aegypti is a direct target of ecdysteroid receptor. Mol. Cell. Endocrinol. 173, 75 /86. Mouillet, J.F., Delbecque, J.P., Quennedey, B., Delachambre, J., 1997. Cloning of two putative ecdysteroid receptor isoforms from
42
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Tenebrio molitor and their developmental expression in the epidermis during metamorphosis. Eur. J. Biochem. 248, 856 /863. Perera, S.C., Ladd, T.R., Dhadialla, T.S., Krell, P.J., Sohi, S.S., Retnakaran, A., Palli, S.R., 1999. Studies on two ecdysone receptor isoforms of the spruce budworm, Horistoneura fumiferana . Mol. Cell. Endocrinol. 152, 73 /84. Pierceall, W.E., Li, C., Biran, A., Miura, K., Raikhel, A.S., Segraves, W.A., 1999. E75 expression in mosquito ovary and fat body suggests reiterative use of ecdysone-regulated hierarchies in development and reproduction. Mol. Cell. Endocrinol. 150, 73 /89. Raikhel, A.S., 1992. Vitellogenesis in mosquitoes. Advance Disease Vector Res. 9, 1 /39. Raikhel, A.S., Deitsch, K.W., Sappington, T.W., 1997. Culture and analysis of the insect fat body. In: Crampton, J.M., Beard, C.B., Louis, C. (Eds.), The Molecular Biology of Insect Disease Vectors: A Methods Manual. Chapman & Hall, London, pp. 507 /522. Raikhel, A.S., Miura, K., Segraves, W.A., 1999. Nuclear receptors in mosquito vitellogenesis. Am. Zool. 39, 722 /735. Riddiford, L.M., 1993. In: Bate, M., Martinez Arias, A. (Eds.), Hormone and Drosophila Development in the Development of Drosophila melanogaster , vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 899 /939. Robinow, S., Talbot, W.S., Hogness, D.S., Truman, J.W., 1993. Programmed cell death in the Drosophila CNS is ecdysoneregulated and coupled with a specific ecdysone receptor isoform. Development 119, 1251 /1259. Schubiger, M., Wade, A.A., Carney, G.E., Truman, J.W., Bender, M., 1998. Drosophila EcR-B ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis. Development 125, 2053 /2062. Sun, G., Zhu, J., Li, C., Tu, Z., Raikhel, A.S., 2002. Two isoforms of the early E74 gene, an Ets transcription factor homologue, are utilized in the ecdysteroid hierarchy governing vitellogenesis of the mosquito, Aedes aegypti . Mol. Cell. Endocrinol. 190, 147 /157. Swevers, L., Drevet, J.R., Junke, M.D., Iatrou, K., 1995. The silkmoth homolog of the Drosophila ecdysone receptor (B1 isoform): cloning and analysis of expression during follicular cell differentiation. Insect. Biochem. Mol. Biol. 25, 857 /866.
Talbot, W.S., Swyryd, E.A., Hogness, D.S., 1993. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73, 1323 /1337. Thomas, H.E., Stunnenberg, H.G., Stewart, A.F., 1993. Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle . Nature 362, 471 /475. Truman, J.W., Talbot, W.S., Fahrbach, S.E., Hogness, D.S., 1994. Ecdysone receptor expression in the CNS correlates with stagespecific responses to ecdysteroids during Drosophila and Manduca development. Development 120, 219 /234. Thummel, C.S., 1996. Files on steroids */Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet. 12, 306 /310. Thummel, C.S., 1997. Dueling orphans */interacting nuclear receptors coordinate Drosophila metamorphosis. Bioessays 19, 669 /672. Vogtli, M., Imhof, M.O., Brown, N.E., Rauch, P., Spindler-Barth, M., Lezzi, M., Henrich, V.C., 1999. Functional characterization of two Ultraspiracle forms (CtUSP-1 and CtUSP-2) from Chironomus tentans . Insect. Biochem. Mol. Biol. 29, 931 /942. Wang, S.F. 1999. Characterization of the mosquito ecdysteroid receptor. Ph.D. Dissertation, Michigan State University. Wang, S.F., Miura, K., Miksicek, R.J., Segraves, W.A., Raikhel, A.S., 1998. DNA binding and transactivation characteristics of the mosquito ecdysone receptor /ultraspiracle complex. J. Biol. Chem. 273, 27531 /27540. Wang, S.F., Li, C., Zhu, J., Miura, K., Miksicek, R.J., Raikhel, A.S., 2000a. Differential expression and regulation by 20-hydroxyecdysone of mosquito ultraspiracle isoforms. Dev. Biol. 218, 99 /113. Wang, S.F., Ayer, S., Segraves, W.A., Williams, D.R., Raikhel, A.S., 2000b. Molecular determinants of differential ligand sensitivities of insect ecdysteroid receptors. Mol. Cell. Biol. 20, 3870 /3879. Yao, T.P., Segraves, W.A., Oro, A.E., Mckeown, M., Evans, R.M., 1992. Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71, 63 /72. Yao, T.P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D., McKewon, M., Cherbas, P., Evans, R.M., 1993. Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 336, 476 /479.
Differential expression and regulation by 20-hydroxyecdysone of mosquito ecdysteroid receptor isoforms A and B Sheng-Fu Wang a,1, Chao Li a,2, Guoqiang Sun a,b, Jinsong Zhu b, Alexander S. Raikhel b,* a b
Program in Genetics, Michigan State University, East Lansing, MI 48824, USA Department of Entomology, University of California, Riverside, CA 92521, USA Received 14 May 2002; accepted 15 July 2002
Abstract Cloning of the AaEcR-A isoform, along with the previously cloned AaEcR-B isoform, has permitted us to evaluate the expression of AaEcR isoforms during mosquito vitellogenesis. Mosquito EcR isoform transcripts exhibited dramatically different patterns of expression after a blood meal-triggered activation of vitellogenesis in the fat body. The AaEcR-B transcript level rose sharply by 4-h post blood meal (PBM), coinciding with the small ecdysteroid peak, and then declined reaching its lowest level at 16 /24-h PBM. In contrast, the AaEcR-A transcript peaked at 16 /20-h PBM, coinciding with the large ecdysteroid peak. AaEcR-B and AaEcR-A transcripts exhibited a striking difference in sensitivity to 20-hydroxyecdysone (20E), being maximally activated at 10 8 and 10 6 M, respectively. Both ecdysteroid receptor (EcR) isoform mRNAs were transcribed in a cycloheximide-independent manner, suggesting that they are direct targets of 20E. However, AaEcR-A transcription requires continuous presence of 20E, while AaEcRB mRNA level rose for 4 h and then declined under the same conditions. These results indicate the mosquito EcR isoforms play distinct physiological functions during vitellogenesis in the mosquito fat body. # 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Nuclear receptor; Isoform; Steroid hormone; Vitellogenesis; Ecdysteroid
1. Introduction Ecdysteroids function in a variety of biological processes, including development, metamorphosis and reproduction (Hagedorn, 1989; Riddiford, 1993; Dhadialla and Raikhel, 1994). The molecular basis of 20hydroxyecdysone (20E) action has been studied in detail during metamorphosis in Drosophila melanogaster (reviewed by Thummel, 1996, 1997). Based on studies of the effect of 20E on puffing of Drosophila polytene chromosomes, Ashburner et al. have proposed a model * Corresponding author. Tel.: /1-909-787-2129; fax: /1-909-7872130 E-mail address: [email protected] (A.S. Raikhel). 1 Present address: Wayne State University School of Medicine, 540 East Canfield, Detroit, MI 48201, USA. 2 Present address: Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.
of the ecdysteroid-triggered gene hierarchy (Ashburner et al., 1974). Subsequent molecular studies have confirmed and extended the Ashburner model. 20E manifests its effects through a receptor that is a heterodimer of two members of the nuclear receptor gene family, the ecdysteroid receptor (EcR) and a homolog of the retinoid X receptor, ultraspiracle (USP) (Yao et al., 1992, 1993; Thomas et al., 1993). The EcR/USP heterodimer binds to a sequence-specific DNA motif, called the ecdysteroid-responsive element (EcRE) and directly induces several primary-responsive genes, including E74, E75 and BR-C. In turn, products of these primary or early genes activate late-target genes. Resembling vertebrate steroid receptors, EcR/USP DNA binding activity requires activation by a chaperone heterocomplex (Arbeitman and Hogness, 2000). Although distinct from molting and metamorphosis, insect reproduction appears to utilize a similar ecdysteroid gene regulatory hierarchy (Raikhel et al., 1999; Pierceall et al., 1999;
0303-7207/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 3 0 3 - 7 2 0 7 ( 0 2 ) 0 0 2 2 5 - 3
30
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Kapitskaya et al., 2000; Li et al., 2000; Wang et al., 2000a; Sun et al., 2002). EcR and USP have been cloned from a variety of arthropods (Henrich and Brown, 1995). Protein sequences deduced from EcR and USP cDNA sequences display a structural organization containing five domains characteristic of members of the nuclear receptor family: A/B, C, D, E and F (Henrich and Brown, 1995). The 66-aa C domain, or DNA binding domain (DBD), harbors two C2C2 zinc finger modules conferring sequence-specific DNA binding activity. The DBD is a highly conserved region among nuclear receptors. Domain E, the ligand-binding domain (LBD), is responsible for specific ligand binding. It also contains motifs for dimerization and transactivation (AF-2). Another transactivation domain (AF-1) is located in the domain A/B. There is little conservation among different subclasses of nuclear receptors within domains A/B, D and F. The pleiotropic roles of 20E in development and reproduction are mediated, at least in part, by the multiple isoforms of EcR and USP. EcR isoforms have been first identified in Drosophila (Talbot et al., 1993) and then in lepidopreran insects, including Manduca sexta (Fujiwara et al., 1995; Jindra et al., 1996), Bombyx mori (Swevers et al., 1995; Kamimura et al., 1996, 1997) and Choristoneura fumiferana (Perera et al., 1999). In Drosophila , three EcR isoforms (EcR-A, EcR-B1 and EcR-B2) differ in the N-terminal A/B domain because of utilization of different transcription start sites and alternative splicing (Talbot et al., 1993). Unlike EcR, only a single USP form has been identified in Drosophila . However, two USP cDNA isoforms have been cloned from Aedes (AaUSP-A and AaUSP-B, Kapitskaya et al., 1996), Manduca (MsUSP-1 and MsUSP-2, Jindra et al., 1997), and Chironomus tentans (Vogtli et al., 1999). In all three insects, these USP isoforms differ only in their N-termini and A/B domains, suggesting that they are encoded by the same gene. In mosquitoes, 20E plays a key role in regulating activation and maintaining a blood meal-triggered vitellogenesis. Ecdysteroid release stimulates the fat body to produce several yolk protein precursors, vitellogenin (Vg), vitellogenic carboxypeptidase (VCP) and vitellogenic cathepsin B (Hays and Raikhel, 1990; Cho et al., 1991, 1999). In the mosquito, only one EcR isoform has been cloned and characterized, which is most homologous to the Drosophila B1 isoform (Cho et al., 1995). Mosquito EcR has been shown to be capable of heterodimerization with either AaUSP-A or AaUSPB, and both heterodimers bind a variety of potential EcREs arranged as either inverted repeats or direct repeats (Wang et al., 1998, 2000a). However, AaEcR-B/ AaUSP-B heterodimer displays stronger DNA binding and transactivation activities than the AaEcR-B/
AaUSP-A heterodimer (Wang et al., 2000a). Even more striking is the effect of 20E on expression of mosquito USP isoforms: while the AaUSP-B transcript is strongly activated by 20E, AaUSP-A is inhibited by the hormone (Wang et al., 2000a). Expression pattern of AaUSP-B isoform transcript, along with other data, suggests that it likely functions as a heterodimeric partner for AaEcR during activation and maintenance of 20E-regulated genes during mosquito vitellogenesis. We report here the cloning and functional characterization of a new mosquito EcR isoform that is designated as AaEcR-A due to the fact that the isoform specific region is homologous to EcR-A in other species. The original Aedes aegypti EcR has been renamed as AaEcR-B because of its homology with Drosophila EcR-B1 isoform. Data presented in this paper suggest that both EcR isoforms are involved in vitellogenesis in the mosquito fat body. However, their expression and regulation by 20E are strikingly different.
2. Materials and methods 2.1. Animals Mosquitoes, A. aegypti, were reared as described by Hays and Raikhel (1990). Vitellogenesis was initiated in 3 /5 day old adult female mosquitoes by blood feeding them on white rats. 2.2. Cloning of EcR-A cDNA To amplify an EcR-A specific region, three primers were used: two degenerate primers, A-16 [GG(A/ C)AGCTA(T/C)G(A/G)TCC(T/G)TACAG] and A-256 [GGI(T/A)(C/G)ITA(C/T)(G/G)(G/A)ICCITA(C/T)(T/ A)(C/G)ICC], as well as a reverse primer from the AaEcR-B hinge region, GSP-4 [CGTCCTGGTACCAGATGAG]. Three cDNA libraries, prepared from whole bodies of previtellogenic female mosquitoes, female fat bodies, and ovaries dissected at different times of vitellogenic period, were used as templates for PCR amplification with Taq polymerase. The PCR amplification was conducted with an initial denaturation at 94 8C for 2 min, followed by 35 cycles of annealing at 60 8C for 30 s, elongation at 72 8C for 50 s and denaturation at 94 8C for 30 s. A rapid amplification of cDNA ends (RACE) strategy was used to clone the ends of the cDNA. In the first RACE, an isoform-A specific reverse primer, A-Rev1 [CACGACCCATTTTTCCATTTGG] with 6 bases from the common region and 16 bases from isoform-A specific region was used. For the second round of PCR amplification, a ZAP-T7 primer [CGACTCACTATAGGGCGAATT] derived from the cDNA library vector was used as a forward primer and the previtello-
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
genic whole body library was used as the template. For confirmation of this new clone, another forward primer A-For1 [TGACGGCCATTCCGGCTTC] from upstream of the new clone and GSP-4 primer were used for PCR followed by Southern blot analysis. For the second RACE reaction, total RNA isolated from ovaries of 1-h post blood meal (PBM) females was primed with random hexamer for reverse transcription. After tailing the cDNA fragments with dCTP, AaEcR-A was initially amplified with a primer pair, A-Rev1, and AAP (5? RACE Abridged Anchor Primer, Gibco BRL). The amplified fragment was column-purified as recommended by the manufacturer, and a second PCR reaction was conducted with the initial product as the template and A-Rev2 and AAP as primers. The secondary PCR product was fractionated on the agarose gel to remove potential short amplified fragments (B/ 400 bp). The gel-purified secondary PCR product was subjected to a third round of PCR amplification with ARev2 and AAP as primers. Multiple bands with sizes ranging from 500 bp to 1.6 kb were detected, the longest of which, 1.6 kb in length, was subcloned into pGEM-T vector and sequenced. To amplify the entire AaEcR-A open reading frame (ORF), a new primer pair was designed, a forward primer A-For2 [ATCAGTGTATTCGTCATCACAATTG] from the 5?-end of the 1.6-kb fragment, and GSP2 [5?-CGTGCCCTACACTAGCTATACCTG3?], which contains the stop codon in the EcR Cterminal common region. The cDNA was synthesized using total RNA from vitellogenic females 24-h PBM, primed with random hexamer. This cDNA product was subjected to PCR amplification with the Pfu polymerase (Promega) using A-Rev2 and GSP2, with 30 cycles of 30 s at 94 8C, 30 s at 60 8C, and 8 min at 728. A 3.1-kb fragment of the expected size (initially called EcR-A5) was subcloned into pPCR-Script Amp (Stratagene) and sequenced. 2.3. Sequencing and sequence analysis Sequencing was performed at the Michigan State University DNA Sequencing Facility utilizing dye terminator and dye primers. A-For1, A-For2, A-For3, A-Rev1, A-Rev2 and A-Rev3 as well as primers from pGEM-T and pPCR-Script vectors were used to sequence the two strands. Unless otherwise indicated, sequence analyses were performed using DNAstar or a web based GCG (Genetics Computer Group, Inc.) software. 2.4. Northern blot analysis Messenger RNA was isolated from 100 female mosquitoes 3 /5 days post-eclosion or 24-h PBM using the QuickPrep Micro mRNA Purification Kit (Amer-
31
sham Pharmacia Biotech). Northern blots were performed essentially as described before (Cho et al., 1995). Probes were prepared by PCR reaction with specific primers using plasmids containing corresponding cDNA clone as templates. A 1082-bp EcR-A specific fragment was generated with the primer pair A5-For and A5-Rev. A 437-bp EcR-B specific fragment was generated with the primer pair EcR-For2 (AGCATGCTGAATCGGTCGGAG), EcR-Rev2 (CCGTGAAGCCACCATTGTTGG). A 314-bp fragment (Wang et al., 2000a) derived from the LBD region was used as an EcR common probe. Probes were labeled with a Random Primer kit (Gibco BRL). 2.5. RT-PCR and Southern blot analyses Reverse transcription PCR and Southern blot were performed as described before (Wang et al., 2000a). Total RNA was isolated from fat bodies and ovaries dissected from 20 to 50 female mosquitoes 3 /5 days post-eclosion or different time points, from 4/48-h PBM, followed by reverse transcription with Superscript II reverse transcriptase (Gibco BRL). This cDNA product was subjected to PCR amplification with 20 cycles of 45 s at 94 8C, 45 s at 60 8C, and 1 min at 72 8C. Southern blot probes were generated by PCR with the same primer pair using plasmid DNA containing the corresponding cDNA clone as the template, followed by labeling with Random Primer Kit (Gibco BRL). EcR-A probe was generated as described above. A 463-bp long DNA fragment encoding the yolk protein precursor protein, VCP and a 424-bp DNA fragment actin were amplified with primer pairs described before (Pierceall et al., 1999; Wang et al., 2000a). For mRNA developmental profiles, actin was used for normalization. First, cDNA templates from each time point were PCR amplified with actin primers followed by a Southern blot with actin as a probe and phosphorimager quantification. Then, cDNA templates from each time point equivalent to 1 pg of actin were used for PCR with EcR-A, EcR-B, and VCP primers followed the Southern blot and phosphorimager quantification. 2.6. In vitro fat body culture Previtellogenic female mosquito fat bodies were dissected and cultured as described before (Deitsch et al., 1995). Fat bodies were incubated in the absence of hormone or in the presence of 106 M of the hormone with or without cycloheximide (Chx). One mM Chx was used in the treatments. This concentration of Chx reversibly inhibits over 98% of protein synthesis in in vitro cultured fat body (Deitsch et al., 1995). Total RNA was isolated from these fat bodies and subjected to reverse transcription, PCR amplification, Southern blot and phosphorimager quantification.
32
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
2.7. In vitro gene expression and electrophoresis gel mobility assay pPCRScript-EcRA plasmid was linearized with Not 1 at their 3?-ends, allowing efficient in vitro transcription/ translation (TNT, Promega) with T7 promoter. pCDNA3.1/Zeo(/)-EcRB, pCDNA3.1/Zeo(/)-USPA and pCDNA3.1/Zeo(/)-USPB (Wang et al., 1998, 2000b) were used to express EcR-B, USP-A and USPB with T7 polymerase, respectively. Electrophoresis gel mobility assay (EMSA) was performed as described before (Wang et al., 2000b). DmUSP monoclonal antibody was a generous gift from Dr F.C. Kafatos, EMBL, Heidelberg, Germany (Christiansen et al., 1992).
3. Results 3.1. Cloning and analysis of the mosquito EcR isoform A Cloning of A. aegypti cDNA encoding AaEcR-A was accomplished by a RT-PCR-based approach. To amplify an EcR-A specific region, two degenerate primers A-16 and A-256 were paired with a reverse primer from the AaEcR-B hinge region, GSP-4 (see Figs. 1/3 for primer design). Three cDNA libraries, prepared from whole bodies of previtellogenic female mosquitoes, female fat bodies, and ovaries dissected at different times of vitellogenic period, were used as templates for PCR amplification. A strong band of predicted size 622 bp was obtained from the previtellogenic whole body library with the primer pair A-16 and GSP-4, whereas only weak bands were obtained from fat body and ovarian libraries with these primers. No band was amplified with A-256/GSP-4 primers. After sequencing, we confirmed this 622 bp band was a fragment of EcR as it contained the common region including the DBD,
hinge region and part of the A/B domain different from that of AaEcR-B. This 622-bp fragment was designated as a putative EcR-A. A RACE strategy was used to clone the ends of the cDNA. In the first RACE, we designed an isoform-A specific reverse primer, with 6 bases from the common region and 16 bases from isoform-A specific region. A 340-bp AaEcR-A fragment was amplified, subcloned and sequenced. The deduced amino acid from this region was highly identical to DmEcR-A (Figs. 1 and 2). To confirm that this new clone was a true EcR isoform, a new forward primer A-For1 from upstream of the new clone (Figs. 1 and 3, single-underlined) and GSP-4 were used for PCR followed by Southern blot analysis. Total RNA from the fat body and ovaries of 3h PBM females was reverse-transcribed with random primers. These reverse transcription products were PCR amplified with the primer pair A-For and GSP-4. A parallel PCR amplification was conducted with the previtellogenic whole body library as the template. A predicted 870-bp fragment was amplified from these PCR reactions, which hybridized with a labeled probe containing the AaEcR common region (data not shown), indicating that the new clone was a real EcR isoform. For the second RACE reaction, total RNA isolated from ovaries of 1-h PBM females was primed with random hexamer for reverse transcription. After tailing the cDNA fragments with dCTP, AaEcR-A was initially amplified with a primer pair, A-Rev1 (Fig. 2, doubleunderlined), and AAP. The purified amplified fragment was subjected to a second PCR reaction with A-Rev2 (Fig. 2) and AAP as primers. The gel-purified secondary PCR product was subjected to a third round of PCR amplification with A-Rev2 and AAP as primers. Multiple bands with sizes ranging from 500 bp to 1.6 kb were
Fig. 1. Schematic diagram of AaEcR isoform mRNA structures and primers used for serial amplification of EcR-A. These isoforms share identical domains B /F (blank boxes), but display unique sequences in their 5?-UTR and N-terminal coding region (designated domain A). The EcR-B specific region is shown with upward diagonal bars and EcR-A specific regions with downward diagonal bars, respectively. The first PCR reaction with GSP4 and degenerate primer A-16 led to the identification of a 17-bp EcR-A specific region, based on which A-Rev1 was designed. A-Rev1 and an anchor primer ZAP-T7 yielded a 320 bp EcR-A1 region. Another RACE reaction using A-Rev2 and another anchor primer AAP led to amplification of a 1.6 kb fragment. A-For2, designed from the 5?-end of this 1.6 kb fragment, and GSP2 amplified the entire ORF of EcR-A.
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
33
Fig. 2. Nucleotide and deduced amino acid sequences of mosquito EcR-A isoform specific region. At the 3? ends, nucleotides common to EcR-A, and EcR-B are in lower case. Primers used in PCR cloning and sequencing are single-underlined (forward primers) or double-underlined (reverse primers).
detected, the longest of which, 1.6-kb in length, was subcloned and sequenced. To amplify the entire AaEcR-A ORF, a new primer pair was designed, a forward primer A-For2 from the 5?end of the 1.6-kb fragment, and GSP2, which contains the stop codon in the EcR C-terminal common region. The cDNA was synthesized using total RNA from vitellogenic females 24-h PBM, primed with random hexamer. This cDNA product was subjected to PCR amplification. A 3.1-kb fragment of the expected size was subcloned and sequenced. The AaEcR-A clone contained 1576-bp isoform specific region. Conceptual translation of AaEcR-A cDNA revealed a 255 amino acids domain A as isoform specific. The rest of the clone (domains B /F) was identical to the previously reported EcR-B (domain B /F) (Figs. 1 and 2). The 255aa AaEcR-A N-terminal was 32.8% identical to the 197aa counterpart in DmEcR. Domains A in BmEcR-A and MsEcR-A were 93.8% identical, each
being 79.2% identical to CfEcR-A, indicating that lepidopteran EcR-A isoforms exhibited much higher identity than dipteran ones (Fig. 3). EcR-A of the beetle, Tenebrio molitor is even more distantly related (data not shown). To evaluate the size of AaEcR-A and AaEcR-B transcripts, we conducted a Northern blot analysis using mRNA prepared from 100 female mosquitoes at 24-h PBM (Fig. 4). In mRNA samples, AaEcR-A specific probe hybridized to 5.6- and 9-kb transcripts, AaEcR-B specific probe hybridized with a major 4.2-kb transcript as well as with the 9-kb band. The entire AaEcR-A clone was 2821 bp and the total length would be 3139 bp if the 3?-UTR of AaEcR-B was included. This was still much shorter than the 5.6 kb band detected in the Northern blot, indicating the entire full-length cDNA sequence of AaEcR-A was not cloned. The identity of the 9-kb band remains to be clarified. Next, we used coupled in vitro transcription/translation to synthesize 35S-labeled EcR isoforms and resolved
34
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Fig. 3. Mosquito EcR-A is homologous to EcR-A from other insect species. Amino acid sequences homologous among species are boxed. Sequences used in this alignment are EcR-A from Bombyx mori (BmEcR-A, Kamimura et al., 1997), Manduca sexta (MsEcR-A, Jindra et al., 1996), CfEcR-A (Perera et al., 1999), A. aegypti (AaEcR-A, this study), and Drosophila melanogaster (DmEcR-A, Talbot et al., 1993). Tenebrio molitor (Mouillet et al., 1997) and Amblyomma americanum (Guo et al., 1997) EcR-As are not included in this alignment due to their low identity with these EcR-A sequences. Multiple sequence alignment was done with ClustalW 1.8 http://searchlauncher.bcm.tmc.edu/multi-align/multi-align.html. Box shading was done with http://www.ch.embnet.org/software/BOX_form.html.
them by SDS-PAGE. AaEcR-A and AaEcR-B expression plasmids yielded proteins of expected sizes, 98 and 75 kd, respectively (not shown). 3.2. AaEcR-A has similar DNA binding properties and ligand responsiveness to those of AaEcR-B We utilized in vitro TNT expressed EcR proteins and hsp27 EcRE to investigate DNA binding properties of the newly cloned mosquito EcR isoform. AaEcR-A alone (without USP) displayed no binding activity to the EcRE (data not shown). The AaEcR-A/AaUSP-B heterodimer exhibited very weak binding that was dramatically increased by addition of 20E (Fig. 5A, lanes 1 and 2). The specificity of the binding complex was confirmed by a supershift using the anti-DmUSP antibodies (Fig. 5A, lane 3). In agreement with our previous results (Wang et al., 1998), AaEcR-B/AaUSPB heterodimers displayed negligible binding activity to the EcRE in the absence of the hormone (Fig. 5A, lane 4). Addition of 20E drastically increased DNA binding activity (Fig. 5A, lane 5) and the binding specificity was
further verified with the antibody super-shift assays (Fig. 5A, lane 6). The intensity of binding for both heterodimers was similar, indicating that AaEcR-A formed a heterodimer with USP-B with a binding affinity, comparable to that of AaEcR-B. Likewise, AaEcR-A formed a heterodimer with AaUSP-A that bound to the EcRE as strongly as the AaEcR-B/ AaUSP-A heterodimer (not shown). As we reported earlier, the commonly believed 20E precursor ecdysone also enhances mosquito AaEcR-B/ USP DNA binding activity (Wang et al., 2000b). We tested whether or not this hormone could exert similar effect on the AaEcR-A isoform. In control, AaEcR-B AaUSP-B DNA binding activity was enhanced by both 20E and ecdysone (Fig. 5B, lanes 5/7), being consistent with our previous results (Wang et al., 2000b). Similarly, AaEcR-A/AaUSP-B heterodimer binding to EcRE was enhanced by 20E and ecdysone (Fig. 5B lanes 1 /3). The binding specificity was validated using competition assay with unlabeled cold EcRE (Fig. 5B, lanes 4 and 8). Similar results were obtained with AaUSP-A (data not shown). These data indicated that the mosquito EcR
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Fig. 4. Northern blot analysis of EcR isoform transcripts. mRNA isolated from 100 mosquito females at 24-h post-blood feeding was subjected to the Northern blot analysis using sequential hybridization of isoform specific probes to EcR-A (lane 1) and EcR-B (lane 2) as well as a probe to a common EcR region, EcR-Com (lane 3).
isoforms possessed virtually identical DNA binding activities as well as similar responsiveness to ligand activation. Finally, we used EMSA to evaluate binding properties of AaEcR-A USP heterodimers to EcREs other than
35
Fig. 6. Competitive EMSA analysis of EcR-A binding properties to various EcREs. Heterodimers of USP-B-EcR-A (A) or USP-B-EcR-B (B) bound to the hsp27 EcRE were competed by 50- or 500-fold excess of unlabeled probes: HSP27, ER-6, DR-1 as well as the native Vg EcRE1. (C) Sequences of EcREs used in these experiments.
hsp27. In the first series of experiments, we used a competitive EMSA (Fig. 6). Heterodimers of AaEcR-A/ AaUSP-B or AaEcR-B/AaUSP-B bound to the hsp27
Fig. 5. EMSA analysis of EcR-A binding properties and responsiveness to ligands. (A). In vitro-expressed USP-B paired with either EcR-A (lanes 1 / 3) or EcR-B (lanes 4 /6) isoforms and tested for binding to the hsp27 EcRE (for sequence see Fig. 6) without addition of 20E (lanes 1 and 4) or with 20E (lanes 2 and 5). Lanes 3 and 6 are as lanes 2 and 5 with addition of monoclonal anti-DmUSP antibodies. (B) Enhancement by ecdysone of USPB heterodimers with either EcR-A (lanes 1 /4) or EcR-B (lanes 5 /8) isoforms binding to the hsp27 EcRE (lanes 2 and 6). Lanes 1 and 5, control incubations without any ligand; lanes 3 and 7, control incubations with 20E; lanes 4 and 8, specificity competition control with a 100-fold excess of the unlabeled hsp27 EcRE probe.
36
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
EcRE in the presence of 20E were competed by 50- or 500-fold excess of unlabeled probes: Hsp27, everted repeat (ER-6), DR-1 as well as the native Vg EcRE1, which is a composite element consisting of an ER-6 and a DR-1 sequence (Fig. 6C, Martin et al., 2001). These experiments showed that the binding properties of AaEcR-A with respect to its recognition of various EcREs and binding affinities were similar to those of AaEcR-B. Direct EMSA demonstrated that AaEcR-A/ USP heterodimers were capable of binding to the radiolabeled native Vg EcRE1 with the similar strength as heterodimers of AaEcR-B (not shown). 3.3. Expression of EcR isoform transcripts in the mosquito fat body during vitellogenesis Having mosquito EcR-A and EcR-B-specific probes, we were able to undertake RT-PCR/Southern blot analysis to examine mRNA profiles of the EcR isoforms in the fat body during mosquito vitellogenesis. Both isoforms exhibited elevated levels of transcription after the onset of vitellogenesis triggered by a blood feeding. However, the profiles of expression for AaEcR-A and AaEcR-B transcripts were entirely different. The level of AaEcR-A transcript elevated only slightly during first 4 h following a blood meal, but rose rapidly between 4 and 16-h PBM. The transcript reached its plateau at 16/ 20-h PBM with a 6-fold induction compared to its mRNA at the previtellogenic stage, then it started to decline at 24-h PBM, reaching its previtellogenic level at 48-h PBM (Fig. 7A). In contrast, AaEcR-B mRNA level increased dramatically at 4-h PBM with more than 6-fold induction, then started to decline and returned to its previtellogenic level at 24-h PBM (Fig. 7B). Interestingly, AaEcR-B mRNA displayed smaller peak (4-fold of induction) at 36-h PBM. Thus, these results demonstrated that mosquito EcR isoforms exhibited distinct transcriptional profiles during vitellogenesis. As a positive control, the mRNA level of one of the major 20E-regulated target genes in the mosquito fat body, VCP (Cho et al., 1991; Deitsch et al., 1995), was tested in the same total RNA, which exhibited robust activation (nearly 400-fold induction) with a peak at 20 /24-h PBM (Fig. 7C). 3.4. In vitro effect of 20E on EcR isoform transcripts Using an EcR common probe, we have previously demonstrated that 20E directly induces EcR transcription (Wang et al., 2000a). The availability of EcR isoform-specific probes permitted us to address the question of how each isoform was regulated by the hormone. These experiments were conducted using an in vitro fat body culture system, which has been well established (Raikhel et al., 1997). The mosquito fat body
Fig. 7. RT-PCR analysis of the mRNA developmental profile of EcR isoforms. Total RNA isolated from 20 previtellogenic (FB-PV) or different time points (4 /48 h, FB-4-FB-48) PBM female mosquito fat bodies was subjected to reverse transcription followed by PCR amplification with primer pairs unique to EcR-A (A), EcR-B (B), VCP (C) or actin (not shown). PCR product was analyzed by Southern blot and quantified by phosphorimager. Relative amounts of mRNA were normalized with actin. The hormone 20E titer and the yolk protein Vg profile is shown in panel D. Each point represents an average of three independent experiments 9/SD.
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
is a relatively homogeneous tissue consisting of predominantly one cell type, trophocytes (Raikhel, 1992), making interpretation of results easier. Abdominal walls with adhering fat bodies, isolated from previtellogenic female mosquitoes (3 /5 days after eclosion) were incubated in culture medium either in the absence of hormone or in the presence of increasing amounts of 20E ranging from 10 8 /105 M (Fig. 8). After 4-h incubation, these fat bodies were subjected to RNA isolation, RT-PCR and Southern blotting analyses with isoform-specific probes. Both AaEcR-A and AaEcR-B were activated by 20E in a dose-dependent manner. The AaEcR-B transcript level was maximally induced at extremely low concentration of 20E of 10 8 M (Fig. 8). In contrast, the AaEcR-A mRNA was induced by this concentration of 20E only slightly and reached its maximal levels at 106 M 20E (Fig. 8). As a positive control, we monitored the 20E dose response of VCP mRNA. This 20E-responsive gene exhibited a peak induction level at 106 M 20E (Fig. 8). Next, we investigated the time course of 20E effects on the expression of EcR isoforms. In these experiments, dissected previtellogenic fat bodies were incubated in culture media in the presence or absence of 10 6 M 20E (Fig. 9). At 4-h intervals after incubation, EcR transcripts were analyzed as described above. The effect of 20E on expression of the two mosquito EcR isoforms in
37
cultured previtellogenic fat bodies was entirely different. Transcription of AaEcR-A required continuous presence of 20E in the culture medium; its transcript levels steadily increased at 8-, 12- and 16-h of incubation with 20E (Fig. 9A, closed squares). Withdrawal of 20E from the medium after 4-h of incubation resulted in decline of AaEcR-A transcript level (Fig. 9A, open squares). In contrast, under the same conditions, AaEcR-B transcript exhibited an initial rise at 4-h postincubation and then declined (Fig. 9B, closed squares). However, when fat bodies were incubated for 4 h in the presence of 20E and then transferred into a hormone-free medium, the level of the AaEcR-B continued to rise (Fig. 9B, open squares). As a positive control, we monitored the effect of 20E on VCP. Previtellogenic fat bodies incubated in hormone-free media did not show any detectable level of VCP gene expression (Fig. 9C). This is consistent with results we have reported before (Deitsch et al., 1995; Wang et al., 2000a). Continuous incubation in the presence of 20E resulted in the robust activation of VCP gene expression: the level of VCP mRNA doubled every 4 h during the 16-h incubation period (Fig. 9C, closed squares). Hormone withdrawal after a 4-h induction period reversed VCP gene activation, and the VCP mRNA levels returned to an undetectable level by 16-h of incubation (Fig. 9C, open squares).
3.5. Effect of Chx on EcR transcription
Fig. 8. Dose response of EcR-A, EcR-B and VCP to 20E in in vitro the fat body organ culture. Fat bodies dissected from nine previtellogenic female mosquitoes were cultured for 4 h in vitro either in the absence of hormone or in the presence of increasing concentrations of 20E ranging from 10 8 to 10 5 M. Total RNA was isolated from these fat bodies and subjected to RT-PCR with specific primers to EcR-A, EcR-B and VCP, respectively. The PCR products were resolved by the agarose gel electrophoresis, followed by Southern blotting and autoradiography, and were quantified by the phosphorimaging analysis. The intensity of bands from Southern blots was quantified by phosphorimaging. For EcR-A and EcR-B, the level of amplified transcript detected from previtellogenic fat bodies prior to any treatment was defined as 1 unit. For the VCP mRNA, the level of amplified transcript detected from previtellogenic fat body treated only with 10 6 M 20E for 4 h was defined as 100 units.
To assess whether or not mosquito EcR isoforms were under direct or indirect control of 20E, we utilized a protein synthesis inhibitor Chx in the in vitro fat body culture experiments (Fig. 10). Previtellogenic fat bodies were pretreated with culture media containing 1 mM Chx, followed by further incubation with or without 106 M 20E. Fat bodies cultured continuously in the presence of 1 mM Chx and 20E exhibited AaEcR-A transcription at much higher levels than after continuous incubations with 20E alone (Fig. 10A, closed squares), clearly demonstrating the direct control of 20E on the AaEcR-A transcription. When the 20Ewithdrawal experiment was performed in the presence of Chx, no super-induction was observed (Fig. 10A, open squares). The effect of Chx on the 20E induction of AaEcR-B was very dramatic: it eliminated the inhibition of AaEcR-B transcription occurring after incubation in the presence of 20E alone. Instead, this incubation resulted in super-induction of AaEcR-B mRNA (Fig. 10B, closed squares), indicating that AaEcR-B was also directly controlled by 20E. Interestingly, 20E-withdrawal from Chx-containing media led to considerably reduced, but still elevated levels of AaEcR-B transcript (Fig. 10B, open squares).
38
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Fig. 9. Effect of 20E on the transcription of EcR-A (upper panel), EcR-B (middle panel), and VCP (lower panel) in the previtellogenic fat bodies. Previtellogenic fat bodies dissected from female mosquitoes (3 /5 day after eclosion) were incubated in culture media only (open triangles), with a 4-h pulse treatment of 10 6 M 20E (open squares), or with continuous 20E treatment (closed squares) for 16 h. At every 4-h interval, a group of 9 fat bodies were collected and subjected to RNA isolation, RT-PCR amplification and Southern blot analysis. The intensity of bands from Southern blots was quantified by phosphorimaging. For EcR-A and EcR-B, the level of amplified transcript detected from previtellogenic fat bodies prior to any treatment was defined as 1 unit. For the VCP mRNA, the level of amplified transcript detected from previtellogenic fat body treated only with 20E for 16 h was defined as 100 units.
As a control, the level of VCP transcription was also monitored in these fat bodies. Addition of Chx to the culture medium resulted in complete inhibition of VCP
mRNA irrespective of the presence or absence of 20E (Fig. 10C).
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
39
Fig. 10. Effect of 20E and Chx on the transcription of EcR-A (upper panel), EcR-B (middle panel), and VCP (lower panel) in the previtellogenic fat bodies. Previtellogenic fat bodies dissected from female mosquitoes (3 /5 day after eclosion) were incubated in culture media with 1 mM Chx (open triangles), with 1 mM Chx and a 4-h pulse 20E treatment (open squares) or with 1 mM Chx and continuous 20E treatment (closed squares) for 16 h. At every 4-h interval, a group of 9 fat bodies were collected and subjected to RNA isolation, RT-PCR amplification and Southern blot analysis. The intensity of bands from Southern blots was quantified by phosphorimaging as described in Figure. For comparison, respective mRNA profiles of fat bodies treated with 20E continuously were plotted in each panels (dotted curve with closed squares).
4. Discussion In this work, we have identified second mosquito EcR isoform with a distinct N-terminus, which has been designated as AaEcR-A. The AaEcR-A specific region
exhibits 32% identity with that of DmEcR-A, whereas the same region among Lepidoptera displays 80% or even higher identity. Dipteran EcR isoform B-specific region is also less conserved with identity ranging from 36 to 51% in its various portions, while the same region
40
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
in Lepidoptera shares overall identity close to 80% (Wang, 1999). These results indicate that EcR-A isoform and EcR-B -specific regions are under similar selection pressure during evolution in this group of insects. In addition to their N-terminal coding regions, mosquito EcR-A and EcR-B isoforms are entirely different in their 5?-UTRs, suggesting that their respective transcription units likely utilize alternative promoters. This is reminiscent of the Drosophila EcR gene structure, in which DmEcR-A and DmEcR-B1 use their unique 5?-upstream alternative promoters; while DmEcR-B1 and DmEcRB2 are derived by alternative splicing of transcripts initiated by the same promoter (Talbot et al., 1993). Despite dramatic differences in their N-termini, our EMSA analysis showed that binding properties of AaEcR-A are similar to those of AaEcR-B. Like heterodimers of AaEcR-B, those of AaEcR-A recognized various EcREs with similar affinities. Likewise, the two EcR isoforms in C. fumiferana heterodimerize with USP to bind various EcREs with equal binding affinities (Perera et al., 1999). Moreover, ecdysone and 20E were effective ligands for heterodimers containing either AaEcR-A or AaEcR-B. Importantly, competitive and direct EMSAs have demonstrated that EcR-A USP heterodimers are capable of binding to the native Vg EcRE1 with the same strength as heterodimers of EcRB. Expression of EcR isoforms has been investigated for several insects including detailed studies of dipteran Drosophila and lepidopteran Manduca (Talbot et al., 1993; Bender et al. 1997; Jindra, et al., 1996, 1997; Kamimura et al., 1997; Mouillet et al., 1997; Perera et al., 1999). However, all these studies have dealt with EcR transcripts responses to 20E during metamorphosis. Our study is the first report concerning vitellogenic responses of EcR isoforms in the fat body, the major target of 20E regulation during reproduction. The onset of vitellogenesis and activation of ecdysteroid-responsive genes in this mosquito tissue are under strict control of blood feeding. Thus, this insect represents an outstanding model for studying the regulation of expression of EcR-A and EcR-B during vitellogenesis. Using a common probe to the mosquito EcR, we have previously showed that its expression encompasses the entire vitellogenic period. In this study, utilization of AaEcR-A and AaEcR-B-specific probes has allowed us to reveal details concerning their respective expression during vitellogenesis. Surprisingly, AaEcR-B is highly expressed at the onset of vitellogenesis and reaches its peak at 4-h PBM, the time of a small ecdysteroid peak (Hagedorn et al., 1975). Its expression pattern resembles the first peak of the transcription of the early gene E75 (Pierceall et al., 1999). However, AaEcR-B has a striking sensitivity to 20E being maximally activated at
108 M of the hormone, while AaUSP-B and AaE75 isoforms only at 10 7 M (Pierceall et al., 1999; Wang et al., 2000a). What are the functional implications of such high sensitivity of AaEcR-B to 20E? EcR-B is presumably the first transcript responding to a very low 20E titer. Its early expression is likely crucial for activation of early genes of the ecdysteroid regulatory hierarchy governing vitellogenic responses in the mosquito fat body. In vitro fat body culture experiments have shown that AaEcR-B transcript behaves as an early gene, being down regulated under the continuous exposure to 20E and up-regulated with the hormone withdrawal. Its super-induction in the presence of Chx clearly indicates that AaEcR-B is directly regulated by 20E and it is likely a subject of auto-regulated repression in the presence of the hormone. However, other direct 20E-induced transcription factors could be involved in its repression as well. Taken together with the pattern of its expression, these data imply that at the onset of vitellogenesis in the mosquito fat body AaEcR-B plays a primary role in activation of 20E-regulated genes, such as Vg and VCP . This suggestion is further supported by our preliminary experiments with cell transfection assay showing that AaEcR-B is a much more potent transactivator than AaEcR-A (S.F. Wang and A.S. Raikhel, unpublished observation). Yet our in vitro binding studies showed similar binding properties for the two EcR isoforms. In further support of the proposed role of AaEcR-B, in Drosophila mutants, the activation of ecdysteroid-induced genes is eliminated with the loss of EcR-B1, which is a homolog of AaEcR-B (Bender et al., 1997). The expression profile of the AaEcR-A transcript is strikingly different from that of AaEcR-B, having a peak at 16/20-h PBM, when the level of the AaEcR-B transcript is at its lowest. It corresponds to the large PBM peak of ecdysteroids (Hagedorn et al., 1975). Two early genes, AaE75 and AaE74B, also exhibit maximal levels of expression at this time (Pierceall et al., 1999; Sun et al., 2002). Interestingly that AaUSP-B transcript encoding the heterodimeric partner of the AaEcR isoforms increases at 3 /4-h PBM but is expressed over the entire vitellogenic period (Wang et al., 2000a). Experiments with in vitro fat body culture indicated that like AaEcR-B, AaEcR-A transcription is directly induced by 20E in a protein synthesis-independent manner. However, AaEcR-A transcription requires continuous presence of the hormone and declined upon its withdrawal. Overall, these results again indicate that AaEcR-A and AaEcR-B transcripts are likely controlled via alternative promoters. Regulatory mechanisms underlying the strikingly distinct responses of EcR isoforms to 20E remain to be elucidated. Although differential expression of EcR-A and EcRB during metamorphosis has been observed in several insects, their respective roles are poorly understood
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
(Talbot et al., 1993; Bender et al. 1997; Jindra et al., 1996, 1997; Kamimura et al., 1997; Mouillet et al., 1997; Perera et al., 1999). Studies of EcR isoforms during metamorphosis of the Drosophila nervous system have shown that they can play clearly distinct functions in different cells. A high level of EcR-A expression in the ventral CNS correlates with rapid degeneration of neurons after adult emergence (Robinow et al., 1993; Truman et al., 1994). Remodeling of larval neurons at metamorphosis begins with the pruning back of larvalspecific dendrites. EcR deletion mutants lacking EcR-B1 and EcR-B2 but retaining EcR-A fail to show the pruning response (Schubiger et al., 1998; Lee et al., 2000). However, adult-specific neurons, which normally express only EcR-A, can progress in their development (Schubiger et al., 1998). This example provides a clear demonstration that it is impossible to extrapolate the functions of EcR isoforms without direct investigation of their involvement in a particular developmental event regulated by 20E. Therefore, elucidation of respective roles of AaEcR-A and AaEcR-B isoforms in mosquito vitellogenesis awaits further studies.
Acknowledgements We thank Mr G. Attardo for critical reading of the manuscript and Dr F.C. Kafatos for his kind gift of the Drosophila USP monoclonal antibody. This work was supported by NIH grant AI-36959 to A.S. Raikhel.
References Arbeitman, M.N., Hogness, D.S., 2000. Molecular chaperones activate the Drosophila ecdysone receptor, an RXR heterodimer. Cell 101, 67 /77. Ashburner, M., Chihara, C., Meltzer, P., Richards, G., 1974. Temporal control of puffing activity in polytene chromosomes. Cold Spring Harbour Symp. Quant. Biol., 36662 /38655. Bender, M., Imam, F.B., Talbot, W.S., Ganetzky, B., Hogness, D.S., 1997. Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms. Cell 91, 777 /788. Cho, W.L., Deitsch, K.W., Raikhel, A.S., 1991. An extraovarian protein accumulated in mosquito oocytes is a carboxypeptidase activated in embryos. Proc. Natl. Acad. Sci. USA 88, 10821 / 10824. Cho, W.L., Tsao, S.M., Hays, A.R., Walter, R., Chen, J.S., Snigirevskaya, E.S., Raikhel, A.S., 1999. Mosquito cathepsin Blike protease involved in embryonic degradation of vitellin is produced as a latent extraovarian precursor. J. Biol. Chem. 274, 13311 /13321. Cho, W.L., Kapitskaya, M.Z., Raikhel, A.S., 1995. Mosquito ecdysteroid receptor: analysis of the cDNA and expression during vitellogenesis. Insect. Biochem. Mol. Biol. 25, 19 /27. Christiansen, A.M.K., King, D.L., Hatzivassiliou, E., Casas, J.E., Hallenbeck, P.L., Nikodem, V.M., Mitsialis, S.A., Kafatos, F.C., 1992. DNA binding and heteromerization of the Drosphila transcription factor chorion factor 1 ultraspiracle. Proc. Natl. Acad. Sci. USA 89, 11503 /11507.
41
Deitsch, K.W., Chen, J.S., Raikhel, A.S., 1995. Indirect control of yolk protein genes by 20-hydroxyecdysone in the fat body of the mosquito, Aedes. aegypti . Insect. Biochem. Mol. Biol. 25, 449 /454. Dhadialla, T.S., Raikhel, A.S., 1994. Endocrinology of mosquito vitellogenesis. In: Davey, K.G., Peter, R.E., Tobe, S.S. (Eds.), Perspectives in Comparative Endocrinology. National Research Council, Canada, pp. 275 /281. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K., Riddiford, L.M., 1995. Cloning of an ecdysone receptor homolog from Manduca sexta and the developmental profile of its mRNA in wings. Insect. Biochem. Mol. Biol. 25, 845 /856. Guo, X., Harmon, M.A., Laudet, V., Mangelsdorf, D.J., Palmer, M.J., 1997. Isolation of a functional ecdysteroid receptor homologue from the ixodid tick Amblyomma americanum (L.). Insect. Biochem. Mol. Biol. 27, 945 /962. Hagedorn, H.H., 1989. Physiological roles of hemolymph ecdysteroids in adult insect. In: Koolman, J. (Ed.), Ecdysone, From Chemistry to Mode of Action. Thieme Medical Publishers, Inc, pp. 279 /289. Hagedorn, H.H., O’Connor, J.D., Fuchs, M.S., Sage, B., Schlaeger, D.A., Bohm, M.K., 1975. The ovary as a source of ecdysone in an adult mosquito. Proc. Natl. Acad. Sci. USA 72, 3255 /3259. Hays, A.R., Raikhel, A.S., 1990. A novel protein produced by the vitellogenic fat body and accumulated in mosquito oocytes. Roux’s Arch. Dev. Biol. 199, 114 /121. Henrich, V.C., Brown, N.E., 1995. Insect nuclear receptors: a developmental and comparative perspective. Insect. Biochem. Mol. Biol. 25, 881 /897. Jindra, M., Malone, F., Hiruma, K., Riddiford, L.M., 1996. Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta . Dev. Biol. 180, 258 /272. Jindra, M., Huang, J.Y., Malone, F., Asahina, M., Riddiford, L.M., 1997. Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta . Insect. Mol. Biol. 6, 41 /53. Kamimura, M., Tomita, S., Fujiwara, H., 1996. Molecular cloning of an ecdysone receptor (B1 isoform) homologue from the silkworm, Bombyx mori , and its mRNA expression during wing disc development. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 113, 341 /347. Kamimura, M., Tomita, S., Kiuchi, M., Fujiwara, H., 1997. Tissuespecific and stage-specific expression of two silkworm ecdysone receptor isoforms */ecdysteroid-dependent transcription in cultured anterior silk glands. Eur. J. Biochem. 248, 786 /793. Kapitskaya, M., Wang, S.F., Cress, D.E., Dhadialla, T.S., Raikhel, A.S., 1996. The mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer: cloning and characterization of isoforms expressed during vitellogenesis. Mol. Cell. Endocrinol. 121, 119 /132. Kapitskaya, M.Z., Li, C., Miura, K., Segraves, W., Raikhel, A.S., 2000. Expression of the early-late gene encoding the nuclear receptor HR3 suggests its involvement in regulating the vitellogenic response to ecdysone in the adult mosquito. Mol. Cell. Endocrinol. 160, 25 /37. Lee, T., Marticke, S., Sung, C., Robinow, S., Luo, L., 2000. Cellautonomous requirement of the USP/EcR-B ecdysone receptor for mushroom body neuronal remodeling in Drosophila . Neuron 28, 807 /818. Li, C., Kapitskaya, M.Z., Zhu, J., Miura, K., Segraves, W.A., Raikhel, A.S., 2000. Conserved molecular mechanism for the stage specificity of the mosquito vitellogenic response to ecdysone. Dev. Biol. 224, 96 /110. Martin, D., Wang, S.F., Raikhel, A.S., 2001. The vitellogenin gene of the mosquito Aedes aegypti is a direct target of ecdysteroid receptor. Mol. Cell. Endocrinol. 173, 75 /86. Mouillet, J.F., Delbecque, J.P., Quennedey, B., Delachambre, J., 1997. Cloning of two putative ecdysteroid receptor isoforms from
42
S.-F. Wang et al. / Molecular and Cellular Endocrinology 196 (2002) 29 /42
Tenebrio molitor and their developmental expression in the epidermis during metamorphosis. Eur. J. Biochem. 248, 856 /863. Perera, S.C., Ladd, T.R., Dhadialla, T.S., Krell, P.J., Sohi, S.S., Retnakaran, A., Palli, S.R., 1999. Studies on two ecdysone receptor isoforms of the spruce budworm, Horistoneura fumiferana . Mol. Cell. Endocrinol. 152, 73 /84. Pierceall, W.E., Li, C., Biran, A., Miura, K., Raikhel, A.S., Segraves, W.A., 1999. E75 expression in mosquito ovary and fat body suggests reiterative use of ecdysone-regulated hierarchies in development and reproduction. Mol. Cell. Endocrinol. 150, 73 /89. Raikhel, A.S., 1992. Vitellogenesis in mosquitoes. Advance Disease Vector Res. 9, 1 /39. Raikhel, A.S., Deitsch, K.W., Sappington, T.W., 1997. Culture and analysis of the insect fat body. In: Crampton, J.M., Beard, C.B., Louis, C. (Eds.), The Molecular Biology of Insect Disease Vectors: A Methods Manual. Chapman & Hall, London, pp. 507 /522. Raikhel, A.S., Miura, K., Segraves, W.A., 1999. Nuclear receptors in mosquito vitellogenesis. Am. Zool. 39, 722 /735. Riddiford, L.M., 1993. In: Bate, M., Martinez Arias, A. (Eds.), Hormone and Drosophila Development in the Development of Drosophila melanogaster , vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 899 /939. Robinow, S., Talbot, W.S., Hogness, D.S., Truman, J.W., 1993. Programmed cell death in the Drosophila CNS is ecdysoneregulated and coupled with a specific ecdysone receptor isoform. Development 119, 1251 /1259. Schubiger, M., Wade, A.A., Carney, G.E., Truman, J.W., Bender, M., 1998. Drosophila EcR-B ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis. Development 125, 2053 /2062. Sun, G., Zhu, J., Li, C., Tu, Z., Raikhel, A.S., 2002. Two isoforms of the early E74 gene, an Ets transcription factor homologue, are utilized in the ecdysteroid hierarchy governing vitellogenesis of the mosquito, Aedes aegypti . Mol. Cell. Endocrinol. 190, 147 /157. Swevers, L., Drevet, J.R., Junke, M.D., Iatrou, K., 1995. The silkmoth homolog of the Drosophila ecdysone receptor (B1 isoform): cloning and analysis of expression during follicular cell differentiation. Insect. Biochem. Mol. Biol. 25, 857 /866.
Talbot, W.S., Swyryd, E.A., Hogness, D.S., 1993. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73, 1323 /1337. Thomas, H.E., Stunnenberg, H.G., Stewart, A.F., 1993. Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle . Nature 362, 471 /475. Truman, J.W., Talbot, W.S., Fahrbach, S.E., Hogness, D.S., 1994. Ecdysone receptor expression in the CNS correlates with stagespecific responses to ecdysteroids during Drosophila and Manduca development. Development 120, 219 /234. Thummel, C.S., 1996. Files on steroids */Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet. 12, 306 /310. Thummel, C.S., 1997. Dueling orphans */interacting nuclear receptors coordinate Drosophila metamorphosis. Bioessays 19, 669 /672. Vogtli, M., Imhof, M.O., Brown, N.E., Rauch, P., Spindler-Barth, M., Lezzi, M., Henrich, V.C., 1999. Functional characterization of two Ultraspiracle forms (CtUSP-1 and CtUSP-2) from Chironomus tentans . Insect. Biochem. Mol. Biol. 29, 931 /942. Wang, S.F. 1999. Characterization of the mosquito ecdysteroid receptor. Ph.D. Dissertation, Michigan State University. Wang, S.F., Miura, K., Miksicek, R.J., Segraves, W.A., Raikhel, A.S., 1998. DNA binding and transactivation characteristics of the mosquito ecdysone receptor /ultraspiracle complex. J. Biol. Chem. 273, 27531 /27540. Wang, S.F., Li, C., Zhu, J., Miura, K., Miksicek, R.J., Raikhel, A.S., 2000a. Differential expression and regulation by 20-hydroxyecdysone of mosquito ultraspiracle isoforms. Dev. Biol. 218, 99 /113. Wang, S.F., Ayer, S., Segraves, W.A., Williams, D.R., Raikhel, A.S., 2000b. Molecular determinants of differential ligand sensitivities of insect ecdysteroid receptors. Mol. Cell. Biol. 20, 3870 /3879. Yao, T.P., Segraves, W.A., Oro, A.E., Mckeown, M., Evans, R.M., 1992. Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71, 63 /72. Yao, T.P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D., McKewon, M., Cherbas, P., Evans, R.M., 1993. Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 336, 476 /479.