Differential regulation of EP receptor isoforms during chondrogenesis and chondrocyte maturation

BBRC Biochemical and Biophysical Research Communications 328 (2005) 764–776 www.elsevier.com/locate/ybbrc

Differential regulation of EP receptor isoforms during chondrogenesis and chondrocyte maturation Christine A. Clark, Edward M. Schwarz, Xinping Zhang, Navid M. Ziran, Hicham Drissi, Regis J. OÕKeefe*, Michael J. Zuscik Center for Musculoskeletal Research, University of Rochester, School of Medicine and Dentistry, Rochester, NY 14642, USA Received 16 November 2004 Available online 25 November 2004

Abstract Regulation of chondrogenesis and chondrocyte maturation by prostaglandins has been a topic of interest during recent years. Particular focus on this area derives from the realization that inhibition of prostaglandin synthesis with non-steroidal anti-inflammatory drugs could impact these cartilage-related processes which are important in skeletal development and are recapitulated during bone healing either post-trauma or post-surgery. In addition to reviewing the relevant literature focused on prostaglandin synthesis and signaling through the G-protein coupled EP receptors, we present novel findings that establish the expression profile of EP receptors in chondroprogenitors and chondrocytes. Further, we begin to examine the signaling that may be involved with the transduction of PGE2 effects in these cells. Our findings suggest that EP2 and EP4 receptor activation of cAMP metabolism may represent a central axis of events that facilitate the impact of PGE2 on the processes of mesenchymal stem cell commitment to chondrogenesis and ultimate chondrocyte maturation.
2004 Elsevier Inc. All rights reserved.

Introduction Gene expression during chondrogenesis and chondrocyte maturation Commitment of mesenchymal stem cells to the chondrogenic program and the process of chondrocyte maturation and hypertrophy is a tightly regulated and genetically conserved cascade of events. During limb bud formation mesenchymal cells proliferate, condense, and express early chondrocyte markers, such as Sox-5, Sox-9, type II collagen (col2), and aggrecan [1–3]. Chondrocytes subsequently organize into a limb rudiment surrounded by a circumferential layer of pluripotent mesenchymal cells called the perichondrium [4]. The

*

Corresponding author. Fax: +1 585 756 4727. E-mail address: [email protected] (R.J. OÕKeefe).

0006-291X/$ - see front matter
2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.11.074

perichondrium serves as a source of additional chondrocytes during lateral expansion of the skeletal element [4]. In the central region of the cartilage rudiment, chondrocytes undergo maturation. This process is associated with vascular invasion, calcification, and subsequent bone formation on the calcified cartilaginous template [5]. As development progresses, the chondrocyte maturation zones move to opposite ends of the long bone and longitudinal growth continues throughout adolescence in growth plates in a process called endochondral ossification. During endochondral ossification, chondrocytes complete a differentiation process that involves (i) proliferation; (ii) maturation and hypertrophy; and (iii) terminal differentiation. The transition from pre-hypertrophic, proliferating chondrocytes to hypertrophy is characterized by a 5- to 10-fold increase in cell volume and the expression of specific genes that include indian hedgehog (Ihh), type X collagen (colX), matrix

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

metalloproteinase-13 (MMP13), and alkaline phosphatase (AP) [6–10]. As colX expression peaks, terminal differentiation is initiated and is marked by the expression of genes associated with calcification of the matrix, such as vascular endothelial growth factor (VEGF) and osteocalcin (OC). OC expression has been demonstrated in terminally differentiated chondrocytes in vivo in chick and murine growth plates [11–13]. Similarly, VEGF is absent in the resting and proliferating zones, but chondrocytes in the hypertrophic zone are VEGF-positive with maximum expression in the lower hypertrophic and mineralized regions of the cartilage in both human and mouse fetal tissues [12,14–16]. Terminally differentiated chondrocytes ultimately undergo apoptosis and the remaining calcified cartilage serves as a template for primary bone formation [17].

765

mechanism. PGE2 induces adenylate cyclase activity and stimulates cAMP production and PKA signaling through its EP2 and EP4 receptors [36,37]. Inhibition of chondrogenesis by indomethacin is reversed by either PGE2 or dibutyryl cAMP [30]. Addition of phosphodiesterase inhibitors enhances PGE2 effects on chondrogenesis [33,37]. Finally, the ability of various prostaglandins to stimulate chondrogenesis is associated with their effects on cAMP [33,37]. Altogether, the data support the hypothesis that PGE2, through its effects on the adenylate cyclase-cAMP system, plays an important role in the formation of cartilage. Other factors, such as BMPs, TGF-bs, and Wnts, induce chondrogenesis, but potential interaction with PGE2 generated signals is unknown [38–40]. Prostaglandins and the growth plate

Cyclooxygenase-1 and -2, and prostaglandin synthesis Prostaglandin synthesis is controlled by three different enzymes: phospholipase A2 which releases arachidonic acid (AA) from the cell membrane, the cyclooxygenase (COX-1 and COX-2) genes which catalyze the oxygenation and further reduction of AA to form PGH2, and isomerases which convert PGH2 into individual prostaglandins [18]. Prostaglandin E synthase is the isomerase involved in the synthesis of PGE2, the most abundant prostaglandin in most tissues [19,20]. Cyclooxygenase inhibitors have been widely used as anti-inflammatory and pain relief medications in clinical practice. Non-steroidal anti-inflammatory drugs (NSAIDs) are used to treat various inflammatory bone diseases, including rheumatoid arthritis and osteoarthritis [21,22]. While traditional NSAIDs inhibit both COX-1 and COX-2 [23,24], selective inhibitors for COX-2 have been developed that are effective anti-inflammatory agents and avoid serious GI side effects [25,26]. COX-2 isoforms have recently been identified in both bone cells and chondrocytes [27,28]. Role of COX genes in chondrogenesis and chondrocyte differentiation Several studies in avian mesenchymal limb bud cells suggest an important role for cyclooxygenases during chondrogenesis. Both indomethacin [29,30] and blockade of PGE2 with the antagonist AH6809 inhibit chondrogenesis [31,32]. Addition of PGE2 to mesenchymal limb bud cultures (i) enhances chondrogenesis; and (ii) stimulates chondrogenesis in the presence of indomethacin [33]. Mesenchymal cell chondrogenesis has been associated with an increase in adenylate cyclase activity, cAMP levels, and increase in PKA signaling [34]. Dibutyryl cAMP, a cAMP analog, stimulates chondrogenesis [35]. Evidence supports that PGE2 acts through this

Prostaglandins are synthesized by growth plate chondrocytes [41] and synthesis is altered by mechanical loading [42]. Both COX isoforms are expressed in articular chondrocytes and in rat sternal resting chondrocytes as measured by RT-PCR [43]. Prostaglandins regulate chondrocyte phenotype and growth plate function, but a comprehensive understanding of their role in chondrocyte differentiation has not been achieved. Systemic injection of PGE2 results in a thinner growth plate with decreased size of hypertrophic chondrocytes and reduced limb growth [44,45]. We have shown that prostaglandins stimulate growth plate chondrocyte proliferation and sulfate incorporation [46] while inhibiting maturation [39,47]. PGE2 inhibited colX, VEGF, alkaline phosphatase, and MMP13 in chick growth plate chondrocytes and effects were mediated through both PKA and PKC signaling [47]. Others have demonstrated that endogenous prostaglandins mediate the effects of 1,25-(OH)2 D3 and 24,25-(OH)2 D3 in rat sternal chondrocytes in a metabolite-specific and cell maturation-dependent manner [43,48]. Thus, prostaglandins are clearly important regulators of growth plate chondrocytes and an understanding of their effects is vital, given the widespread use of NSAIDs in the pediatric population and among individuals undergoing endochondral bone repair. Cyclooxygenases and endochondral ossification during bone repair NSAIDs are widely advocated as an analgesic in patients with fractures, including pediatric patients [49,50], elderly nursing home patients [51,52], those with stress fractures [53], and adult traumatic fractures resulting from participation in sports [54]. Furthermore, NSAIDs are recommended for the relief of pain following spinal fusion [55]. Because of the wide use of NSAIDs during conditions associated with reparative bone formation,

766

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

the role of prostaglandin metabolism in this process is critically important. In animal studies the NSAIDs ibuprofen, indomethacin, and ketorolac inhibit fracture healing [56,57]. A human study included 32 patients with non-union of a fracture of the diaphysis of the femur and 67 comparable patients whose fracture had united. The groups were comparable with regard to gender, Injury Severity Score, and soft-tissue injury. No relationship was observed between the rate of union and the type of implant, mode of locking, reaming, distraction, or smoking. However, there was a marked association between non-union and the use of NSAIDs [58]. Animal and human studies also strongly suggest an inhibitory effect of NSAIDs on spine fusion [59–62]. In contrast, the administration of PGE2 increased the rate of fracture healing in several animal models [63–65]. Others and we have further defined the role of cyclooxygenases in bone repair [17] using COX-deficient mice [19]. Fracture healing is impaired in the absence of Cox2, while COX-1 ablated mice have a normal rate of fracture healing. While the delay in fracture healing involves a marked reduction and delay in osteogenesis, there was only a very slight reduction in the amount of cartilage formed in the callus. This suggests that the process of chondrogenesis is relatively normal in the absence of COX-2/PGE2. On the other hand, the cartilage formed in the COX-2 deficient animals tended to persist, suggesting a delay in terminal differentiation. These data suggest that PGE2/prostaglandins might be more important as regulators of chondrocyte maturation. This manuscript examines the effects of PGE2 during chondrogenesis and chondrocyte maturation, and defines important differences in EP receptor expression. Prostaglandin E2 receptors PGE2 binds to one of four receptor isoforms, EP1, EP2, EP3, and EP4. The EP receptors have similar affinity for the PGEs, but have markedly reduced affinity for the other prostaglandins. The EP receptors are coupled to G-proteins and display the canonical 7 transmembrane domains observed in members of this receptor superfamily. EP1 associates with Gq and stimulates IP3 signaling and calcium transients [66]. EP2 and EP4 associate with Gas, activate adenylate cyclase, and stimulate cAMP/PKA/CREB signaling [66]. In contrast, EP3 receptors associate with Gi proteins and down-regulate adenylate cyclase [66]. Multiple EP receptors are typically expressed simultaneously in cells, and thus, co-expression of EP3 with EP2 and/or EP4 can downregulate activation of the cAMP/PKA/CREB cascade [66,67]. Similarly, since Ca2+ transients have been shown to induce calcium-dependent cAMP phosphodiesterases, EP1 activation can also antagonize EP2/EP4 signaling. Thus, the relative expression of the various EP receptors

modulates the responsiveness of cells to the PGEs. Limited prior work has suggested the presence of EP-1 and 2 receptors in rat growth plate chondrocytes [68,69] and EP4 receptors have been identified in bovine articular chondrocytes [70], but a full assessment of all subtypes in chondrocytes has not been defined. Gain and loss of function of EP receptors in skeletal tissues Of the various EP receptor knockout models, EP2 / and EP4 / mice have been the most studied. EP2 / mice have accelerated dendritic cell differentiation, enhanced cancer immunity, reduced gastrointenstinal cancers, salt-sensitive hypertension, and reduced PGE2 mediated bronchodilation [71–74]. EP4 / mice die in the neonatal period due to failed closure of the ductus arteriosis [75], but by selective breeding on a mixed background, ductus arteriosis closure occurs and EP4 / mice can survive [76,77]. EP4 / mice have an impaired vasodepressor response following PGE2 infusion, reduced Langerhans cell migration to regional lymph nodes and decreased contact hypersensitivity, and reduced incidence and severity of inflammatory arthritis and bone resorption in a collagen-induced arthritis model [71,78,79]. Osteoblasts from EP4 / mice have marked reduction of RANKL following treatment with PGE2 and in vivo have reduced osteoclast numbers [80,81]. EP2 / osteoblasts also have reduced RANKL expression, but effects are smaller than those observed in EP4 / osteoblasts [80]. Additionally, in vivo bone formation is also dependent on EP receptor expression [82]. PGE2 stimulates bone formation and healing in a murine critical defect model, but the response is absent in EP4 / mice [81]. Less is known regarding the role of PGE2 or the EP receptors as regulators of chondrocytes in the growth plate or during bone repair. Here we have performed a comprehensive analysis of receptor expression profile both temporally during chondrocyte differentiation and under the influence of key factors that serve a regulatory role during these events. To perform these studies, we utilized murine limb bud mesenchymal stem cells derived from E11.5 mice, an excellent in vitro model of primary cells that undergo chondrogenic commitment and chondrocyte maturation [39]. Findings presented below provide the first insight into the interplay that occurs between the EP receptor subtypes during the chondrocyte differentiation cascade and thus will bear directly on our understanding of the role of prostaglandins in skeletal development and growth and bone repair.

Materials and methods Growth factors and reagents. Prostaglandin E2 was obtained from Cayman Chemical (Ann Arbor, MI) and resuspended in a 100% eth-

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776 anol solution at a stock concentration of 1 mM. Dibutyryl cAMP was obtained from Sigma Chemicals (St. Louis, MO) and resuspended in sterile water at a concentration of 1 mM. BMP-2 was obtained from PeproTech (Rocky Hill, NJ) and resuspended in sterile PBS containing BSA at a stock concentration of 0.10 mg/ml. All-trans retinoic acid was obtained from Sigma Chemicals and resuspended in 100% ethanol solution at a concentration of 1 mM. BMP-2 was used in cell cultures at a concentration of 50 ng/ml, retinoic acid 100 nM, dibutyryl cAMP 1 mM, and PGE at 10 6 M unless otherwise indicated. Isolation and culture of mesenchymal cells from the mouse limb bud. Limb bud mesenchymal cells were isolated from developing mouse embryos at embryonic day 11.5, 12.5, 13.5 or 14.5 as previously described [39]. Pregnant CD1 mice were euthanized and embryos were removed and placed a sterile saline solution. Individual embryos were separated and with the aid of a dissecting microscope forelimb buds were removed with fine forceps and placed in a sterile PuckÕs saline solution. Mesenchymal cells were isolated by digestion with 0.1% dispase (Calbiochem, San Diego, CA) in a PuckÕs saline solution at 37 C for 45 min. Cells were filtered, rinsed 2 times, and resuspended in 40% DMEM/60% F12 mixture supplemented with 10% FBS (DMEM/ F12 + 10% FBS) (Gibco, Carlsbad, CA). Cells were plated in micromass culture in 10 ll aliquots containing 105 cells and permitted to attach to the plastic of 24-well culture plates (Nalgene Nunc International, Rochester, NY) for 1 h. The wells were subsequently flooded with 1 ml of fresh DMEM/F12 + 10% FBS and the cultures were maintained in a humidified, 5% CO2, 37 C incubator for varying amounts of time up to 21 days. PGE2 and growth factors/signaling molecules were added to the cultures at one day and fresh medium changes were performed every 2–3 days. Ethanol was added to all of the control cultures so that an identical concentration of ethanol was present in all of the culture wells. Quantitative real-time RT-PCR. Total RNA was extracted from micromass cultures at various time points using Trizol (Invitrogen, Carlsbad, CA) according to manufacturerÕs instructions. SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) was used to synthesize the cDNA from 1 lg aliquots of total RNA according to the oligo(dT) version of the protocol. Real-time RT-PCR was performed using the SYBR green PCR master mix (Applied Biosystems, Foster City, CA) along with 250 nM of specific primers and a 2 ll aliquot of a 1:5 diluted cDNA. The PCRs were carried out using a Rotogene3000 real-time RT-PCR machine (Corbett Research, Sydney, Australia) and data were analyzed with accompanying software. The following cycle parameters were used for all experiments: 20 s at 94 C, 30 s at 60 C, and 30 s at 72 C for a total of 45 cycles. The relative levels of mRNA of a specific gene were normalized to b-actin levels. Table 1 shows the sequences for all primer sets used in these experiments.

767

Alcian blue staining of micromass cultures. At the various times, cells were washed once with PBS (pH 7.4) and then fixed for 20 min with 1 ml of 10% neutral buffered formalin (VWR, Buffalo Grove, IL). The cultures were then washed 3 times with sterile distilled, deionized H2O with the last wash being left on the cells for 15 min. Subsequently, 0.5 ml of 3% alcian blue (Sigma) in glacial acetic acid was added to each well for 24 h at room temperature. After 2 washes with 70% ethanol and 3 washes with sterile distilled, deionized H2O, photomicrographs of the stained cultures were obtained. Quantification of alcian blue staining was performed using NIH Image. The threshold was standardized to detect nodule area and the area of the staining was converted from pixels to mm2. The area and intensity values were recorded and used to determine staining intensity. Alkaline phosphatase staining. Micromass cultures were washed and fixed as described for alcian blue staining. A naphthol solution containing 10 mg Naphthol AS-MX-PO4 (Sigma) dissolved in 0.4 ml N,Ndimethylformamide (Sigma) was prepared. From this stock, 66.7 ll was mixed with 16.6 ml of a 0.05 M Tris–HCl solution (pH 8.3) and 10 mg Red Violet LB Salt (Sigma). The solution was filtered and 0.5 ml was added to each culture well and incubated in the dark at 37 C for 45 min. Culture wells were washed 3 times with sterile distilled, deionized H2O and photographed with a digital camera. Transfection and luciferase assay. The PathDetect CRE-Luc cisReporting System (Stratagene, La Jolla, CA), which contains the firefly luciferase reporter under control of a CREB-responsive promoter, was used to assess CREB signaling. Transfection efficiency was determined by co-transfecting a pRL vector (Promega, Madison, WI) that constitutively drives expression of Renilla luciferase. Murine limb bud cells were transiently transfected using FuGene6 (1 lg DNA:3 ll FuGene6) prior to plating (Roche, Indianapolis, IN). Briefly, 2 lg CRE-Luc, 10 ng pRL (10 ng/ll), and 6 ll FuGene6 were added to 91 ll serum-free DMEM/F12 and this 0.1 ml transfection mixture was incubated for 15 min at room temperature. The transfection mixture was then added to 107 freshly isolated cells in 0.9 ml DMEM/F12 + 10% FBS, resulting in a final cell concentration 107cells/ml. Ten microliter aliquots of cells were placed on the center of each well and incubated for 1 h before the wells were flooded with 1 ml DMEM/F12 + 10% FBS. Twenty-four hours following transfection, cultures were treated with either ethanol (control) or varying concentrations of PGE2. Sixty hours following transfection, cell extracts were prepared and luciferase activity was recorded using Dual-Luciferase Reporter Assay Kit (Promega). Luminescence measurements were made using an Opticomp 1 luminometer (MGM Instruments, Hamden, CT). Statistical analysis. Experiments were repeated at least 3 times and for numerical data, mean values and standard errors were calculated.

Table 1 Sequences for primer sets used to asses gene expression via real-time RT-PCR Gene

Forward primer

Reverse primer

b-Actin Sox9 Col2 EP1R EP1R-2a EP2R EP2R-2a EP3R EP3R-2a EP4R EP4R-2a

agatgtggatcagcaagcag agctcaccagaccctgagaa actggtaagtggggcaagac tacatgggatgctcgaaaca ctgcctcatccatcacttca atgctcctgctgcttatcgt ccttgctcttctgttccctg ggatcatgtgtgtgctgtcc tacctgtttccctgggtctg ccatcgccacatacatgaag tggctgtcactgaccttctg

gcgcaagttaggttttgtca tcccagcaatcgttaccttc ccacaccaaattcctgttca ttttaagcccgtgtgggtag gagttagagttccagccccc taatggccaggagaatgagc agggcctcttaggctactgc aactggagacagcgtttgct caaaggttctgaggctggag tgcatagatggcgaagagtg tgcatagatggcgaagagtg

a It should be noted that two primer sets were generated for analysis of each EP receptor gene. Both primer sets for each of these genes functioned with equal efficiency and were used interchangeably in real-time RT-PCR experiments.

768

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

Statistical significance between groups was determined using a standard t test. Data with P < 0.05 were considered statistically significant.

Results Impact of gestational age on cartilage nodule formation by limb bud mesenchymal cells To determine the ability of limb bud mesenchymal stem cells to form cartilage nodules in micromass culture, and to define an optimal gestational age for further experiments, cells were prepared from the limb buds of mice at various gestational ages (E11.5, E12.5, E13.5, and E14.5). Cells were placed in high-density micromass cultures and alcian blue staining was performed at 2, 3, 4, 5, and 6 days (Figs. 1A, 2· magnification; and B, 20· magnification). Cells isolated from E11.5 are initially spindle shaped, but clusters of cells become cuboidal and begin to resemble chondrocytes after 2 days in culture. By 3 days, E11.5 cells form discrete alcian blue staining nodules, and the size and intensity of the alcian blue staining increased through 6 days in culture. Mes-

Fig. 1. Impact of gestational age on cartilage nodule formation by limb bud mesenchymal stem cells. Limb bud mesenchymal stem cells were isolated from embryos at various gestational time points between E11.5 and E14.5, and plated in micromass cultures with DMEM/ F12 + 10% FBS. After 2, 3, 4, 5 or 6 days in culture, cultures were stained with alcian blue and photographed using either 2· (A) or 20· (B) magnification. The staining that is shown is representative of the phenotype seen in three separate experiments.

enchymal cells isolated from E12.5, E13.5, and E14.5 limb buds also formed cuboidal cell populations with alcian blue staining. As the gestational age increased, there was a general trend towards earlier expression of an alcian blue positive matrix and a more generalized cartilage appearance of the cultures. Thus, in stage E14.5 cell cultures distinct cartilage nodules were absent and a uniform staining pattern was present consistent with a more homogeneous chondrocyte cell population. Cells extracted at this time point possessed a rounded, cartilage-like appearance immediately following plating. Thus, stage E11.5 cells represent a more primitive undifferentiated cell population, while E14.5 cells have an enriched early chondrocyte population. PGE2 is a weak stimulator of chondrogenesis in E11.5 limb bud cultures PGE2 has previously been shown to induce chondrogenesis in avian limb bud cell cultures [34,83]. To examine the effect of PGE2 in murine mesenchymal cells, E11.5 limb bud micromass cultures were treated with control medium or medium containing either PGE2 (10 9–10 5 M) or BMP-2 (50 ng/ml). After six days cultures were stained with alcian blue. While BMP-2 induced a robust and significant increase in alcian blue staining, PGE2 had no significant effect (Fig. 2A). Not only was there no alteration in the intensity of staining, but there was no effect on the number or size of the nodules following PGE2-treatment (Fig. 2A). In chick limb bud cells, PGE2-mediated stimulatory effects on chondrogenesis are dependent on PKA signaling [34,83]. A lack of chondrogenic responsiveness to PKA signaling by of E11.5 limb bud cells is a possible explanation for the absence of PGE2 effects in these cells. To examine this, E11.5 limb bud cell cultures were treated with either control medium or medium containing dibutyryl cAMP (1 mM) for 3 days. dbcAMP markedly stimulated nodule formation (data not shown) and also induced a greater than 10-fold increase in type II collagen (col2) expression, a specific chondrocyte marker after 3 days of treatment (Fig. 2B). These findings demonstrate that the PKA signaling pathway is operant in mesenchymal stem cells and acts to stimulate chondrogenesis. To determine if PGE2 stimulates PKA signaling in E11.5 mesenchymal limb bud cultures, cells were cotransfected with CRE-Luc and pRL (transfection efficiency control) and then were treated with either control medium or medium containing PGE2 (10 9–10 5 M) for 36 h. PGE2 showed a significant, dose-dependent activation of the CRE-Luc reporter. However, the effects were relatively small with a slightly less than 5-fold stimulation observed at the maximally physiologically relevant concentration of 10 6 M (Fig. 2C). Finally, to determine if PGE2-mediated activation of PKA is associated with physiological effects, col2 expres-

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

769

Fig. 2. Effect of PGE2 on cAMP signaling and cell phenotype in limb bud micromass cultures. Limb bud cells were isolated from stage E11.5 embryos. Freshly isolated cells either were plated immediately in micromass culture (A,B,D) or were co-transfected while in suspension with the CRE-Luc reporter construct and the pRL control plasmid (C) and then placed in micromass cultures. (A) Twenty four hours after plating, cells were treated with either PBS (CON), 50 ng/ml BMP-2 or varying doses of PGE2 between 10 9 and 10 6 M. After 6 days, cultures were stained with alcian blue and photographed for digital quantification. Images are shown from a representative culture. Digital quantification was performed using NIH image and the threshold was standardized to detect nodule area. This area was converted from pixels to mm2 and multiplied by the scalar intensity value for graphing. (B) Limb bud micromass cultures were treated with dibutyryl cAMP (1 mM) or vehicle (CON) for 3 days. RNA was extracted from the cultures and col2 levels were determined via real-time RT-PCR using b-actin for normalization. (C) Twenty-four hours post-transfection, cells were treated with either vehicle (ethanol, CON) or varying doses of PGE2 between 10 9 and 10 5 M. Thirty-six hours after treatment the cell layer was solubilized and cell extracts were assessed for luciferase activity. (D) Limb bud micromass cultures were treated with vehicle (ethanol, CON) or 10 6 M PGE2 for 6 days. mRNA was prepared and real-time RT-PCR was performed to assess col2 expression. Cycles to threshold values for col2 were normalized to those for b-actin. Significance is denoted with an asterisk (*).

sion was examined since this is a highly sensitive measure of chondrogenesis. E11.5 limb bud micromass cultures were treated with control medium or medium containing 10 6 M PGE2. After 6 days of treatment, RNA was harvested, reverse transcribed into cDNA, and analyzed for col2 expression levels via real-time RT-PCR. Compared to control, PGE2 stimulated col2 expression at 6 days (Fig. 2D). However, the effect was small and the data altogether suggest that PGE2 a weak stimulator of chondrogenesis and cAMP/PKA signaling in murine E11.5 limb bud cultures. PGE2 regulates matrix composition in long-term limb bud micromass cultures Prior work in our laboratory demonstrated that chronic PGE2 treatment resulted in delayed expression of the chondrocyte maturational marker, colX, and de-

creased mineralization in E11.5 limb bud micromass cultures examined after 2–3 weeks in culture [39]. In order to examine the relative effects of PGE2 on matrix accumulation over time, control and PGE-2 treated (10 6 M) cultures were examined by alcian blue as a measure of nodule formation/matrix deposition and with naphthol/red violet to determine alkaline phosphatase activity. Control and PGE2 cultures were harvested at 3, 7, 10, 14, and 21 days (Fig. 3). Consistent with the alcian blue staining shown in Fig. 2A, PGE2 did not significantly effect nodule formation through day 10 in culture. However, a significant enhancement in staining was detected in 14 and 21 day cultures (Fig. 3A). Comparatively, PGE2 was a more potent inhibitor of AP staining, with effects present in 7-day cultures (Fig. 3B). Altogether, the findings suggest that cells progressing down the chondrocyte lineage are more responsive to PGE2 compared to mesenchymal precursor cells.

770

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

Fig. 3. Assessment of chondrocyte phenotype in long-term limb bud micromass cultures treated with PGE2. Stage E11.5 limb bud mesenchymal cells were plated in micromass culture and treated with 10 6 M PGE2 or vehicle (ethanol, control) for varying amounts of time up to 21 days. (A) At 3, 7, 10, 14, and 21 days, cultures were stained with alcian blue and photographed. (B) At the same time points as in A, cultures were stained for alkaline phosphatase activity and photographed. Findings shown are representative of results from 3 separate experiments.

EP receptor expression profile in limb bud mesenchymal cells We next performed a series of experiments to determine if differences in receptor expression occurred as limb bud cells underwent chondrogenesis and progressive maturation in culture. Initial experiments used mRNA from freshly isolated cells that were derived from either E11.5 or E14.5 embryos to examine the relative expression of the different EP receptors. EP1 and EP4 receptor mRNAs were more highly expressed in E14.5 cells, which have a more chondrocytic phenotype (Figs. 4A and D). EP2 receptor mRNA levels tended to follow this same pattern, although the data did not achieve significance (Fig. 4B). Conversely, EP3 receptor expression was higher in less mature E11.5 cells (Fig. 4C). Since EP3 is coupled to Gi it antagonizes signals mediated by the EP2 and EP4 receptors. Thus, the relatively low expression level of EP3 combined with the higher levels of EP2 and EP4 expression in E14.5 cells would permit enhanced cAMP/PKA signaling in response to PGE2 in these more differentiated cell populations. Additionally, increased EP1 receptor expression in cells committed to the chondrocyte lineage enhances signaling via Gq/IP3.

Thus, the potential responsiveness of cells to PGE2-induced phenotypic effects is likely dependent on shifts in the expression profile of EP receptor subtypes that occur as a cell progresses through chondrogenic commitment and chondrocyte maturation. EP2 and EP4 receptor expression in stage E11.5 and E14.5 cells was further assessed in high-density micromass cell cultures after 2 and 6 days (Fig. 4E). In culture, the EP4 receptor is more highly expressed than the EP2 receptor. While EP2 receptor expression increased several-fold in E11.5 cells between 2 and 6 days in cultures, it decreased over time in the E14.5 cultures. Comparatively, EP4 receptor expression in E11.5 cells did not change significantly with time in culture, while E14.5 cells showed an up-regulation of the EP4 subtype at 6 versus 2 days. Importantly, it is clear that at all time points, EP2 and EP4 receptor expression is elevated in E14.5 cultures compared to E11.5 cultures (Fig. 4E). The findings further suggest that mesenchymal limb bud cells become more responsive to cAMP/PKA signaling with increased gestational age of the cells as well as with chondrogenesis in culture. These findings suggest that the cAMP pathway-dependent effects of PGE2 are greater in chondrocytes committed to maturation. Regulation of EP receptor expression by BMP-2 and retinoic acid To further examine the profile of EP receptor expression during chondrogenesis, we determined the impact of BMP-2 and retinoic acid (RA) on EP1, EP2, and EP4 mRNAs. E11.5 limb bud cells were plated in micromass and treated for either 3 or 6 days with 50 ng/ml BMP-2 or 100 nM retinoic acid. Consistent with the known effects of these factors on chondrogenesis [84], BMP-2 treatment increased and retinoic acid strongly inhibited alcian blue staining (Fig. 5A). Similarly, BMP-2 strongly induced, while retinoic acid inhibited, the expression of Sox-9 and col2 after 3 and 6 days of treatment (Figs. 5B and C). The findings confirm that BMP-induces chondrogenesis, while RA strongly inhibits this process. EP1, EP2, and EP4 receptor expression was also determined in these cultures. All three EP receptor genes were up-regulated in response to BMP2, with the effect being maximal at 3 days for EP1 and EP2 receptors and maximal at 6 days for the EP4 receptor (Figs. 5D–F). Retinoic acid strongly inhibited EP1 and EP4 receptor expression at both 3 and 6 days in culture, while significant inhibition of the EP2 receptor by RA was observed at day 6 (Figs. 5D–F). Overall, these findings support our earlier observations and further suggest that EP1, EP2, and EP4 receptor expression is induced in mesenchymal cells undergoing chondrogenic commitment and entering the chondrocyte maturational program. The findings also are consistent with the larger effects observed on matrix synthesis in the long-term

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

771

Fig. 4. Assessment of EP receptor expression in limb bud mesenchymal cells. Limb bud cells were isolated from embryos at stage E11.5 and E14.5. Immediately following the isolation, mRNA was prepared and real-time RT-PCR was performed to assess the expression level of EP1 (A), EP2 (B), EP3 (C), and EP4 (D) receptors. Additionally, E11.5 and E14.5 cells were plated in micromass, and EP2 and EP4 receptor mRNAs were examined after 2 or 6 days in culture (E). mRNA was isolated and real-time RT-PCR was used to determine gene expression. Expression levels were normalized to those for b-actin. Data are derived from experiments that were repeated three times. Significance is denoted with an asterisk (*).

limb bud cultures in which there is established cartilage formation (Fig. 3). Regulation of EP receptor expression by PGE2 Since it is not uncommon for a given receptorÕs expression to be regulated in response to signaling induced by its own specific agonist, we examined the ability of PGE2 to regulate expression of each EP receptor. E11.5 limb bud cells were plated in micromass culture and treated either with vehicle (ethanol) or 10 6 M PGE2. Media were changed every 3 days and PGE2 was replenished at each change. RNA was extracted from the cultures at 3, 7, 10, 14, and 21 days, and real-time RT-PCR was performed to assess EP1, EP2, EP3, and EP4 receptor expression. The general trend was for all 4 receptor subtypes to be negatively regulated

by PGE2, especially at 10, 14, and 21 days (Figs. 6A– D). Over time, in both treated and control cultures, the expression of EP4 tended to increase, while EP3 decreased. Interestingly, the strongest suppression induced by PGE2 occurred with the EP3 receptor, suggesting that PGE2 tends to inhibit Gi-dependent blockade of EP2 and EP4-induced cAMP signaling. Less robust suppression of EP2 and EP4 receptor expression coupled with this strong EP3 suppression would lead to preservation of a cAMP/PKA signaling response.

Discussion The manuscript demonstrates a role PGE2 as a regulator of chondrocyte metabolism and differentiation. PGE2 had small effects on chondrogenesis in stage

772

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

Fig. 5. Impact of BMP-2 and retinoic acid on EP receptor mRNA expression. Limb bud mesenchymal cells were isolated from stage E11.5 mouse embryos and plated in micromass culture. After 24 h, the cultures were treated with 50 ng/ml BMP-2, 100 nM retinoic acid or vehicle (ethanol, control). (A) After six days of treatment, the cultures were stained with alcian blue and photographed. Other cultures were treated with either 50 ng/ ml BMP-2, 100 nM retinoic acid or vehicle (ethanol, control) and after either 3 or 6 days of treatment, mRNA was extracted. Using real-time RTPCR, the expression of Sox-9 (B), col2 (C), EP1 receptor (D), EP2 receptor (E), and EP4 receptor (F) was determined. b-Actin expression was used to normalize gene expression. Significance is denoted with an asterisk (*).

E11.5 mesenchymal limb bud cells, in contrast to prior reports in chick limb bud mesenchymal cells [31,34– 36]. PGE2 had more apparent effects on matrix composition once chondrogenesis occurred and during the process of chondrocyte maturation. Our findings demonstrate that the EP receptors are highly regulated and this likely accounts for differences in responsiveness to PGE2. In E11.5 mesenchymal limb bud cells, EP1, EP2, and EP4 receptor expression was relatively low, while EP3 receptor expression was relatively high. In comparison, E14.5 cells had higher levels of EP1, EP2, and EP4 expression and lower EP3 expression. The differential expression and regulation of EP receptors during chondrogenesis and chondrocyte maturation were confirmed through multiple experimental approaches. This includes comparison between E11.5

and E14.5 cell populations, both at the time of isolation and up to six days in culture. While E11.5 limb bud cells represent an undifferentiated population of mesenchymal precursors, E14.5 limb bud cells rapidly express chondrocyte characteristics and matrix formation in a more uniform manner in culture. Another strategy used was stimulation of differentiation with BMP-2 and inhibition of differentiation by retinoic acid, as has been previously described [84]. Cells undergoing BMP-2 induced chondrocyte differentiation also had much higher expression of EP1, EP2, and EP4 and lower levels of EP3 compared to retinoic acid treated cultures. The differentiation status of the cells was confirmed by assessing the expression of col2, aggrecan, and alcian blue staining. Retinoic acid maintained the cells in an undifferentiated state and this was associated with receptor

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

773

Fig. 6. Assessment of EP receptor mRNA expression in long-term limb bud micromass cultures treated with PGE2. Limb bud mesenchymal cells were isolated from mouse embryos at stage E11.5. After plating in micromass culture, cells were treated with either vehicle (ethanol, control) or 10 6 M PGE2. Cultures were maintained for up to 21 days with medium changes every 3 days. All fresh media contained either ethanol or PGE2 to maintain treatment conditions during the entire culture period. At 3, 7, 10, 14, and 21 days, mRNA was extracted from the cultures and EP1 receptor (A), EP2 receptor (B), EP3 receptor (C), and EP4 receptor (D) were determined, using b-actin expression for normalization. Significance is denoted with an asterisk (*).

expression levels consistent with reduced PGE2 signaling effects. Long-term stage E11.5 cultures, up to 21 days, demonstrated a similar pattern of expression. EP4 receptor expression continuously increased over time, while EP3 expression decreased. By 10 days, elevated levels of EP1 were expressed and were maintained throughout the remainder of the culture period. Thus, all of the models demonstrate EP receptor expression that is consistent with increases in PKA and PKC signaling with progression of chondrocyte differentiation. In short-term micromass cultures, PGE2 had small effects on chondrogenesis. Alcian blue staining failed to demonstrate any difference, but a slight increase in col2 expression was observed. This is consistent with the observations made in vivo in fracture healing studies using COX-2 / mice [82,85]. Compared to wild-type animals, these fractures have minimal changes in cartilage formation. However, there is persistence of cartilage in the absence of COX-2 and PGE2, suggesting effects on maturation and terminal differentiation. In contrast, COX-2 / mice have a marked decrease in osteoblast differentiation [39].

PGE2 effects in later stages of chondrocyte differentiation were similarly observed in the current experiments. Inhibition of maturation, as measured by alkaline phosphatase staining, occurred by one week, while alcian blue staining was enhanced in cultures treated with PGE2 after 14 and 21 days. We previously examined gene expression by in situ hybridization in micromass cultures over time and demonstrated similar findings [39]. These experiments similarly showed a small increase in col2 expression at 1 week. At two weeks, colX was slightly reduced, and the greatest changes were observed in 3 weeks where the expression of the terminal differentiation markers VEGF and osteocalcin was abolished, and matrix mineralization was reduced. More recently, we examined PGE2 effects on chondrocyte maturation in chick growth plate chondrocytes [47]. PGE2 reduced the expression of maturation dependent genes including colX, VEGF, alkaline phosphatase, and MMP13. These effects were found to be dependent upon PKA signaling effects, consistent with activation of EP2 and EP4 receptors. Thus, the current findings are consistent with our previous work demonstrating

774

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

PGE2 effects during later stages of chondrocyte maturation, and mediation of effects by increases in EP4 and decreases in EP3 receptor expressions. Prior studies have shown differentiation related expression of EP receptors. In pristane-treated mice arthritis develops. EP2 and EP4 receptors are induced in macrophages and synovial fibroblasts, and this alters the relative expression pattern of IL-6 and TNF-a [86]. In another study, EP2 and EP4 were found to be differentially regulated during macrophage activation by LPS [87]. EP4 expression is regulated in the cervix and peaks on the day of parturition [88]. EP receptor expression has also been shown to be growth factor dependent. Interleukin-1b-stimulated expression of EP2 and EP4 transcripts in concentration- and time-dependent manner in human granulosa cells [89]. We found regulation of EP receptors during chondrogenesis and chondrocyte maturation. BMP-2 and retinoic acid caused opposite effects on expression while PGE2 caused down-regulation of the EP receptors. Bone repair is a complex process that involves both endochondral and intramembranous ossification. Prior studies have established an essential role for COX-2/ PGE2 signaling in osteogenesis, and there is evidence of reduced bone formation in fractures lacking COX-2 [82,85]. However, the effect of COX-2/PGE2 on chondrocytes is less clear and the importance of cartilage as a target tissue for cyclooxygenase inhibitors in fracture healing is not known. This work, along with other studies, suggests that chondrogenesis, the earliest event involved endochondral bone formation, is minimally affected [82,85]. However, COX-2/PGE2 regulates chondrocyte maturation and terminal differentiation. Finally, the relative responsiveness of chondrocytes to PGE2 at different stages of maturation is regulated at least in part through differential regulation of the EP receptors. Future studies will identify the role of individual receptors and define how PGE2 generated signals interact with other factors and signaling pathways involved in chondrocyte maturation.

Acknowledgment The work was supported in part by Public Health Services Award AR48681 (R.J.O.).

References [1] D.M. Bell, K.K. Leung, S.C. Wheatley, L.J. Ng, S. Zhao, K.W. Ling, M.H. Sham, P. Koopman, P.P. Tam, K.S. Cheah, SOX9 directly regulates the type-II collagen gene, Nat. Genet. 16 (1997) 174–178. [2] W. Bi, J.M. Deng, Z. Zhang, R.R. Behringer, B.D. Crombrugghe, Sox9 is required for cartilage formation, Nat. Genet. 22 (1999) 85– 89.

[3] V. Lefebvre, W. Huang, V. Harley, P. Goodfellow, B. De Crombrugghe, Sox9 is a potent activator of the chondrocytespecific enhancer of the pro alpha1 (II) collagen gene, Mol. Cell. Biol. 17 (1997) 2336–2346. [4] F. Arai, O. Ohneda, T. Miyamoto, X.Q. Zhang, T. Suda, Mesenchymal stem cells in perichondrium express activated leukocyte cell adhesion molecule and participate in bone marrow formation, J. Exp. Med. 195 (2002) 1549–1563. [5] M. Yin, C. Gentili, E. Koyama, M. Zasloff, M. Pacifici, Antiangiogenic treatment delays chondrocyte maturation and bone formation during limb skeletogenesis, J. Bone Miner. Res. 17 (2002) 56–65. [6] M. DÕAngelo, Z. Yan, M. Nooreyazdan, M. Pacifici, D.S. Sarment, P.C. Billings, P.S. Leboy, MMP-13 is induced during chondrocyte hypertrophy, J. Cell. Biochem. 77 (2000) 678–693. [7] H. Enomoto, M. Enomoto-Iwamoto, M. Iwamoto, S. Nomura, M. Himeno, Y. Kitamura, T. Kishimoto, T. Komori, Cbfa1 is a positive regulatory factor in chondrocyte maturation, J. Biol. Chem. 275 (2000) 8695–8702. [8] S.W. Volk, P. Lu Valle, T. Leask, P.S. Leboy, A BMP responsive transcriptional region in the chicken type X collagen gene, J. Bone Miner. Res. 13 (1998) 1521–1529. [9] R.J. OÕKeefe, L. Loveys, D.G. Hicks, P.R. Reynolds, I.D. Crabb, J.E. Puzas, R.N. Rosier, Differential regulation of type II and type X collagen synthesis by PTHrP in chick growth plate chondrocytes, J. Orthoped. Res. 15 (1997) 162–174. [10] A. Vortkamp, S. Pathi, G.M. Peretti, E.M. Caruso, D.J. Zaleske, C.J. Tabin, Recapitulation of signals regulating embryonic bone formation during postnatal growth and in fracture repair, Mech. Dev. 71 (1998) 65–76. [11] M.D. McKee, M.J. Glimcher, A. Nanci, High-resolution immunolocalization of osteopontin and osteocalcin in bone and cartilage during endochondral ossification in the chicken tibia, Anat. Rec. 234 (1992) 479–492. [12] C. Ferguson, E. Alpern, T. Miclau, J.A. Helms, Does adult fracture repair recapitulate embryonic skeletal formation? Mech. Dev. 87 (1999) 57–66. [13] L.C. Gerstenfeld, F.D. Shapiro, Expression of bone-specific genes by hypertrophic chondrocytes: implication of the complex functions of the hypertrophic chondrocyte during endochondral bone development, J. Cell. Biochem. 62 (1996) 1–9. [14] M. Garcia-Ramirez, N. Toran, P. Andaluz, A. Carrascosa, L. Audi, Vascular endothelial growth factor is expressed in human fetal growth cartilage, J. Bone Miner. Res. 15 (2000) 534–540. [15] A. Horner, N.J. Bishop, S. Bord, C. Beeton, A.W. Kelsall, N. Coleman, J.E. Compston, Immunolocalisation of vascular endothelial growth factor (VEGF) in human neonatal growth plate cartilage, J. Anat. 194 (1999) 519–524. [16] M.F. Carlevaro, S. Cermelli, R. Cancedda, F. Descalzi Cancedda, Vascular endothelial growth factor (VEGF) in cartilage neovascularization and chondrocyte differentiation: auto-paracrine role during endochondral bone formation, J. Cell Sci. 113 (2000) 59– 69. [17] J.O. Cheung, M.E. Grant, C.J. Jones, J.A. Hoyland, A.J. Freemont, M.C. Hillarby, Apoptosis of terminal hypertrophic chondrocytes in an in vitro model of endochondral ossification, J. Pathol. 201 (2003) 496–503. [18] T. Takano, M. Panesar, J. Papillon, A.V. Cybulsky, Cyclooxygenases-1 and 2 couple to cytosolic but not group IIA phospholipase A2 in COS-1 cells, Prostaglandins Other Lipid Mediat. 60 (2000) 15–26. [19] Y. Shinji, T. Tsukui, A. Tatsuguchi, K. Shinoki, M. Kusunoki, K. Suzuki, T. Hiratsuka, K. Wada, S. Futagami, K. Miyake, K. Gudis, C. Sakamoto, Induced microsomal prostaglandin E synthase-1 is involved in cyclooxygenase-2-dependent PGE2 production in gastric fibroblasts, Am. J. Physiol. Gastrointest. Liver Physiol. (2004).

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776 [20] K. Masuko-Hongo, F. Berenbaum, L. Humbert, C. Salvat, M.B. Goldring, S. Thirion, Up-regulation of microsomal prostaglandin E synthase 1 in osteoarthritic human cartilage: critical roles of the ERK-1/2 and p38 signaling pathways, Arthritis Rheum. 50 (2004) 2829–2838. [21] L.S. Simon, F.L. Lanza, P.E. Lipsky, R.C. Hubbard, S. Talwalker, B.D. Schwartz, P.C. Isakson, G.S. Geis, Preliminary study of the safety and efficacy of SC-58635, a novel cyclooxygenase 2 inhibitor: efficacy and safety in two placebo-controlled trials in osteoarthritis and rheumatoid arthritis, and studies of gastrointestinal and platelet effects, Arthritis Rheum. 41 (1998) 1591–1602. [22] N.E. Lane, Pain management in osteoarthritis: the role of COX-2 inhibitors, J. Rheumatol. 24 (1997) 20–24. [23] K.E. Giercksky, G. Huseby, H.E. Rugstad, Epidemiology of NSAID-related gastrointestinal side effects, Scand. J. Gastroenterol. 163 (1989) 3–8. [24] B.I. Hirschowitz, Nonsteroidal antiinflammatory drugs and the gastrointestinal tract, Gastroenterologist 2 (1994) 207–223. [25] J.L. Goldstein, F.E. Silverstein, N.M. Agrawal, R.C. Hubbard, J. Kaiser, C.J. Maurath, K.M. Verburg, G.S. Geis, Reduced risk of upper gastrointestinal ulcer complications with celecoxib, a novel COX-2 inhibitor, Am. J. Gastroenterol. 95 (2000) 1681–1690. [26] J.L. Masferrer, B.S. Zweifel, P.T. Manning, S.D. Hauser, K.M. Leahy, W.G. Smith, P.C. Isakson, K. Seibert, Selective inhibition of inducible cyclooxygenase 2 in vivo is antiinflammatory and nonulcerogenic, Proc. Natl. Acad. Sci. USA 91 (1994) 3228–3232. [27] Y. Geng, F.J. Blanco, M. Cornelisson, M. Lotz, Regulation of cyclooxygenase-2 expression in normal human articular chondrocytes, J. Immunol. 155 (1995) 796–801. [28] L.J. Crofford, COX-1 and COX-2 tissue expression: implications and predictions, J. Rheumatol. 24 (1997) 15–19. [29] K.P. Chepenik, W.C. Ho, B.M. Waite, C.L. Parker, Arachidonate metabolism during chondrogenesis in vitro, Calcif. Tissue Int. 36 (1984) 175–181. [30] D.M. Biddulph, M.M. Dozier, A.A. Capehart, Inhibition of prostaglandin synthesis reduces cyclic AMP levels and inhibits chondrogenesis in cultured chick limb mesenchyme, Methods Cell Sci. 22 (2000) 9–16. [31] D.M. Biddulph, A.A. Capehart, T.C. Beasley, Comparative effects of cytosine arabinoside and a prostaglandin E2 antagonist, AH6809, on chondrogenesis in serum-free cultures of chick limb mesenchyme, Exp. Cell Res. 196 (1991) 131–133. [32] A.A. Capehart, D.M. Biddulph, Effects of a putative prostaglandin E2 antagonist, AH6809, on chondrogenesis in serum-free cultures of chick limb mesenchyme, J. Cell. Physiol. 147 (1991) 403–411. [33] R.A. Kosher, K.H. Walker, The effect of prostaglandins on in vitro limb cartilage differentiation, Exp. Cell Res. 145 (1983) 145– 153. [34] D.M. Biddulph, L.M. Sawyer, M.M. Dozier, Chondrogenesis in chick limb mesenchyme in vitro derived from distal limb bud tips: changes in cyclic AMP and in prostaglandin responsiveness, J. Cell. Physiol. 136 (1988) 81–87. [35] D.M. Biddulph, M.M. Dozier, N.C. Julian, L.M. Sawyer, Inhibition of chondrogenesis by retinoic acid in limb mesenchymal cells in vitro: effects on PGE2 and cyclic AMP concentrations, Cell Differ. Dev. 25 (1988) 65–75. [36] A.A. Capehart, D.M. Biddulph, M.M. Dozier, N.C. Julian, Responsiveness of adenylate cyclase to PGE2 and forskolin in isolated cells from micromass cultures of chick limb mesenchyme during chondrogenesis, Prostaglandins 38 (1990) 167–178. [37] R.A. Kosher, S.W. Gay, The effect of prostaglandins on the cyclic AMP content of limb mesenchymal cells, Cell Differ. 17 (1985) 159–167. [38] K. Hanada, L.A. Solchaga, A.I. Caplan, T.M. Hering, V.M. Goldberg, J.U. Yoo, B. Johnstone, BMP-2 induction and TGF-

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49] [50]

[51] [52]

[53]

[54]

[55]

[56]

775

beta 1 modulation of rat periosteal cell chondrogenesis, J. Cell. Biochem. 81 (2001) 284–294. X. Zhang, N. Ziran, J.J. Goater, E.M. Schwarz, J.E. Puzas, R.N. Rosier, M. Zuscik, H. Drissi, R.J. OÕKeefe, Primary murine limb bud mesenchymal cells in long-term culture complete chondrocyte differentiation: TGF-beta delays hypertrophy and PGE2 inhibits terminal differentiation, Bone 34 (2004) 809–817. L. Fischer, G. Boland, R.S. Tuan, Wnt-3A enhances bone morphogenetic protein-2-mediated chondrogenesis of murine C3H10T1/2 mesenchymal cells, J. Biol. Chem. 277 (2002) 30870–30878. P.Y. Wong, R.J. Majeska, R.E. Wuthier, Biosynthesis and metabolism of prostaglandins in chick epiphyseal cartilage, Prostaglandins 14 (1977) 839–851. K.P. Mankin, D.J. Zaleske, Response of physeal cartilage to lowlevel compression and tension in organ culture, J. Pediater. Orthoped. 18 (1998) 145–148. Z. Schwartz, V.L. Sylvia, F. Del Toro, R.R. Hardin, D.D. Dean, B.D. Boyan, 24R,25-(OH)(2)D(3) mediates its membrane receptor-dependent effects on protein kinase C and alkaline phosphatase via phospholipase A(2) and cyclooxygenase-1 but not cyclooxygenase-2 in growth plate chondrocytes, J. Cell. Physiol. 182 (2000) 390–401. K. Ueno, T. Haba, D. Woodbury, P. Price, R. Anderson, W.S. Jee, The effects of prostaglandin E2 in rapidly growing rats: depressed longitudinal and radial growth and increased metaphyseal hard tissue mass, Bone 6 (1985) 79–86. Y. Furuta, W.S. Jee, Effect of 16,16-dimethyl prostaglandin E2 methyl ester on weanling rat skeleton: daily and systemic administration, Anat. Rec. 215 (1986) 305–316. R. OÕKeefe, I. Crabb, J. Puzas, R. Rosier, Influence of prostaglandins on DNA and matrix synthesis in growth plate chondrocytes, J. Bone Miner. Res. 7 (1992) 397–404. T.F. Li, M.J. Zuscik, A.M. Ionescu, X. Zhang, R.N. Rosier, E.M. Schwarz, H. Drissi, R.J. OÕKeefe, PGE2 inhibits chondrocyte differentiation through PKA and PKC signaling, Exp. Cell Res. 300 (2004) 159–169. Z. Schwartz, R.M. Gilley, V.L. Sylvia, D.D. Dean, B.D. Boyan, Prostaglandins mediate the effects of 1,25-(OH)2D3 and 24,25(OH)2D3 on growth plate chondrocytes in a metabolite-specific and cell maturation-dependent manner, Bone 24 (1999) 475– 484. M.C. Pierce, S. Fuchs, Evaluation of ketorolac in children with forearm fractures, Acad. Emerg. Med. 4 (1997) 22–26. R. Facchini, G. Selva, G. Peretti, Tolerability of nimesulide and ketoprofen in paediatric patients with traumatic or surgical fractures, Drugs 46 (1993) 238–241. A.M. Egbert, Postoperative pain management in the frail elderly, Clin. Geriatr. Med. 12 (1996) 583–599. G.W. Cramer, B.S. Galer, M.A. Mendelson, G.D. Thompson, A drug use evaluation of selected opioid and nonopioid analgesics in the nursing facility setting, J. Am. Geriatr. Soc. 48 (2000) 304– 398. M. Fredericson, A.G. Bergman, K.L. Hoffman, M.S. Dillingham, Tibial stress reaction in runners. Correlation of clinical symptoms and scintigraphy with a new magnetic resonance imaging grading system, Am. J. Sports Med. 23 (1995) 472–481. P. Massart, H. Bezes, Comparison of the efficacy and tolerance of isoxicam and piroxicam following surgery for skiing accidents, Br. J. Clin. Pharmacol. 22 (1986) S161–S165. S.S. Reuben, N.R. Connelly, R. Steinberg, Ketorolac as an adjunct to patient-controlled morphine in postoperative spine surgery patients, Reg. Anes. 22 (1997) 343–346. R.D. Altman, L.L. Latta, R. Keer, K. Renfree, F.J. Hornicek, K. Banovac, Effect of nonsteroidal antiinflammatory drugs on fracture healing: a laboratory study in rats, J. Orthoped. Trauma 9 (1995) 392–400.

776

C.A. Clark et al. / Biochemical and Biophysical Research Communications 328 (2005) 764–776

[57] M.L. Ho, J.K. Chang, G.J. Wang, Effects of ketorolac on bone repair: a radiographic study in modeled demineralized bone matrix grafted rabbits, Pharmacology 57 (1998) 148–159. [58] P.V. Giannoudis, D.A. MacDonald, S.J. Matthews, R.M. Smith, A.J. Furlong, P. De Boer, Nonunion of the femoral diaphysis. The influence of reaming and non-steroidal anti-inflammatory drugs, J. Bone Joint Surg. 82B (2000) 655–658. [59] G.J.J. Martin, S.D. Boden, L. Titus, Recombinant human bone morphogenetic protein-2 overcomes the inhibitory effect of ketorolac, a nonsteroidal anti-inflammatory drug (NSAID), on posterolateral lumbar intertransverse process spine fusion, Spine 24 (1999) 2188–2193. [60] J.R. n. Dimar, W.A. Ante, Y.P. Zhang, S.D. Glassman, The effects of nonsteroidal anti-inflammatory drugs on posterior spinal fusions in the rat, Spine 21 (1996) 1870–1876. [61] M. Deguchi, A.J. Rapoff, T.A. Zdeblick, Posterolateral fusion for isthmic spondylolisthesis in adults: analysis of fusion rate and clinical results, J. Spinal Disord. 11 (1998) 459–464. [62] S.D. Glassman, S.M. Rose, J.R. Dimar, R.M. Puno, M.J. Campbell, J.R. Johnson, The effect of postoperative nonsteroidal anti-inflammatory drug administration on spinal fusion, Spine 23 (1998) 834–838. [63] J. Keller, A. Klamer, B. Bak, P. Suder, Effect of local prostaglandin E2 on fracture callus in rabbits, Acta Orthoped. Scand. 64 (1993) 59–63. [64] R.W. Norrdin, M.S. Shih, Systemic effects of prostaglandin E2 on vertebral trabecular remodeling in beagles used in a healing study, Calcif. Tissues Int. 42 (1988) 363–368. [65] I. Suponitzky, M. Weinreb, Differential effects of systemic prostaglandin E2 on bone mass in rat long bones and calvariae, J. Endocrinol. 156 (1998) 51–57. [66] S.G. Harris, J. Padilla, L. Koumas, D. Ray, R.P. Phipps, Prostaglandins as modulators of immunity, Trends Immunol. 23 (2002) 144–150. [67] E.R. Fedyk, R.P. Phipps, Prostaglandin E2 receptors of the EP2 and EP4 subtypes regulate activation and differentiation of mouse B lymphocytes to IgE-secreting cells, Proc. Natl. Acad. Sci. USA 93 (1996) 10978–10983. [68] V.L. Sylvia, F. Del Toro Jr., R.R. Hardin, D.D. Dean, B.D. Boyan, Z. Schwartz, Characterization of PGE(2) receptors (EP) and their role as mediators of 1alpha,25-(OH)(2)D(3) effects on growth zone chondrocytes, J. Steroid Biochem. Mol. Biol. 78 (2001) 261–274. [69] F. DelToro Jr., V.L. Sylvia, S.R. Schubkegel, R. Campos, D.D. Dean, B.D. Boyan, Z. Schwartz, Characterization of prostaglandin E(2) receptors and their role in 24,25-(OH)(2)D(3)-mediated effects on resting zone chondrocytes, J. Cell. Physiol. 182 (2000) 196–208. [70] A.J. de Brum-Fernandes, S. Morisset, G. Bkaily, C. Patry, Characterization of the PGE2 receptor subtype in bovine chondrocytes in culture, Br. J. Pharmacol. 118 (1996) 1597–1604. [71] T. Kobayashi, S. Narumiya, Function of prostanoid receptors: studies on knockout mice, Prostaglandins Other Lipid Mediat. 68–69 (2002) 557–573. [72] L. Yang, N. Yamagata, R. Yadav, S. Brandon, R.L. Courtney, J.D. Morrow, Y. Shyr, M. Boothby, S. Joyce, D.P. Carbone, R.M. Breyer, Cancer-associated immunodeficiency and dendritic cell abnormalities mediated by the prostaglandin EP2 receptor, J. Clin. Invest. 111 (2003) 727–735. [73] M. Sonoshita, K. Takaku, N. Sasaki, Y. Sugimoto, F. Ushikubi, S. Narumiya, M. Oshima, M.M. Taketo, Acceleration of intestinal polyposis through prostaglandin receptor EP2 in Apc(Delta 716) knockout mice, Nat. Med. 7 (2001) 1048–1051.

[74] R.M. Breyer, C.R. Kennedy, Y. Zhang, Y. Guan, M.D. Breyer, Targeted gene disruption of the prostaglandin E2 EP2 receptor, Adv. Exp. Med. Biol. 507 (2002) 321–326. [75] A. Schneider, Y. Guan, Y. Zhang, M.A. Magnuson, C. Pettepher, C.D. Loftin, R. Langenbach, R.M. Breyer, M.D. Breyer, Generation of a conditional allele of the mouse prostaglandin EP (4) receptor, Genesis 40 (2004) 7–14. [76] M. Nguyen, T. Camenisch, J.N. Snouwaert, E. Hicks, T.M. Coffman, P.A. Anderson, N.N. Malouf, B.H. Koller, The prostaglandin receptor EP4 triggers remodelling of the cardiovascular system at birth, Nature 390 (1997) 78–81. [77] C. Nataraj, D.W. Thomas, S.L. Tilley, M.T. Nguyen, R. Mannon, B.H. Koller, T.M. Coffman, Receptors for prostaglandin E(2) that regulate cellular immune responses in the mouse, J. Clin. Invest. 108 (2001) 1229–1235. [78] J.M. McCoy, J.R. Wicks, L.P. Audoly, The role of prostaglandin E2 receptors in the pathogenesis of rheumatoid arthritis, J. Clin. Invest. 110 (2002) 651–658. [79] K. Kabashima, D. Sakata, M. Nagamachi, Y. Miyachi, K. Inaba, S. Narumiya, Prostaglandin E2-EP4 signaling initiates skin immune responses by promoting migration and maturation of Langerhans cells, Nat. Med. 9 (2003) 744–749. [80] X. Li, C.C. Pilbeam, L. Pan, R.M. Breyer, L.G. Raisz, Effects of prostaglandin E2 on gene expression in primary osteoblastic cells from prostaglandin receptor knockout mice, Bone 30 (2002) 567– 573. [81] K. Yoshida, H. Oida, T. Kobayashi, T. Maruyama, M. Tanaka, T. Katayama, K. Yamaguchi, E. Segi, T. Tsuboyama, M. Matsushita, K. Ito, Y. Ito, Y. Sugimoto, F. Ushikubi, S. Ohuchida, K. Kondo, T. Nakamura, S. Narumiya, Stimulation of bone formation and prevention of bone loss by prostaglandin E EP4 receptor activation, Proc. Natl. Acad. Sci. USA 99 (2002) 4580–4585. [82] X. Zhang, E.M. Schwarz, D.A. Young, J.E. Puzas, R.N. Rosier, R.J. OÕKeefe, Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair, J. Clin. Invest 109 (2002) 1405–1415. [83] D.M. Biddulph, L.M. Sawyer, W.P. Smales, Chondrogenesis of chick limb mesenchyme in vitro. Effects of prostaglandins on cyclic AMP, Exp. Cell Res. 153 (1984) 270–274. [84] A.D. Weston, V. Rosen, R.A. Chandraratna, T.M. Underhill, Regulation of skeletal progenitor differentiation by the BMP and retinoid signaling pathways, J. Cell Biol. 148 (2000) 679–690. [85] A.M. Simon, M.B. Manigrasso, J.P. OÕConnor, Cyclo-oxygenase 2 function is essential for bone fracture healing, J. Bone Miner. Res. 17 (2002) 963–976. [86] J. Akaogi, H. Yamada, Y. Kuroda, D.C. Nacionales, W.H. Reeves, M. Satoh, Prostaglandin E2 receptors EP2 and EP4 are up-regulated in peritoneal macrophages and joints of pristanetreated mice and modulate TNF-alpha and IL-6 production, J. Leukoc. Biol. 76 (2004) 227–236. [87] R. Ikegami, Y. Sugimoto, E. Segi, M. Katsuyama, H. Karahashi, F. Amano, T. Maruyama, H. Yamane, S. Tsuchiya, A. Ichikawa, The expression of prostaglandin E receptors EP2 and EP4 and their different regulation by lipopolysaccharide in C3H/HeN peritoneal macrophages, J. Immunol. 166 (2001) 4689–4696. [88] E.K. Chien, C. Macgregor, Expression and regulation of the rat prostaglandin E2 receptor type 4 (EP4) in pregnant cervical tissue, Am. J. Obstet. Gynecol. 189 (2003) 1501–1510. [89] K. Narko, K. Saukkonen, I. Ketola, R. Butzow, M. Heikinheimo, A. Ristimaki, Regulated expression of prostaglandin E(2) receptors EP2 and EP4 in human ovarian granulosa-luteal cells, J. Clin. Endocrinol. Metab. 86 (2001) 1765–1768.