- Email: [email protected]
Differentiation-specific mRNA expression of a mouse bipotential glial cell line
Neuroscience Letters 258 (1998) 21–24
Differentiation-specific mRNA expression of a mouse bipotential glial cell line Kunihiko Asakura a, Akio Suzumura b, Moses Rodriguez a, Makoto Sawada c , d ,* a
Departments of Neurology and Immunology, Mayo Clinic and Foundation, Rochester, MN, USA b Department of Neurology, Nara Medical University, Kashihara, Nara, Japan c Joint Research Division for Therapies against Intractable Diseases, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake, Aichi 470-1192, Japan d PRESTO, Japan Science and Technology Corporation, Tokyo 105, Japan Received 2 September 1998; received in revised form 14 October 1998; accepted 14 October 1998
Abstract We have previously reported that a bipotential glial cell line from mouse cerebrum, designated OS3, phenotypically differentiates into oligodendrocytes and astrocytes both in vitro and in vivo. To study the potential mechanisms of differentiation, in this study we investigated mRNA expression of cytokines and developmentally regulated proteins in OS3 during differentiation into oligodendrocytes by semi-quantitative reverse transcription and polymerase chain reaction. In the presence of 10% calf serum OS3 cells expressed IL-1a and IL-1b mRNA. However, when the cells were cultured in chemically defined medium or low serum-containing medium the expression of IL-1a and IL-1b mRNA was down-regulated. Under stimulation of phorbol ester, expression of IL-6 and nerve growth factor mRNA was up-regulated. The capacity for differentiation of OS3 cells into oligodendrocytes in vitro was limited and most OS3 cells ceased their differentiation at the proligodendroblast stage. However, expression of proteolipid protein (PLP) and DM20 mRNA was detectable and was up-regulated in accordance with the differentiation into oligodendrocytes. As a control, primary astrocytes expressed DM20 mRNA but not PLP mRNA and the expression of DM20 mRNA was independent of culture condition. Therefore, OS3 cells will be of use for the study of differentiation of progenitor cells into type-2 astrocytes or oligodendrocytes at the molecular level. 1998 Elsevier Science Ireland Ltd. All rights reserved
Keywords: O-2A progenitor; Oligodendrocytes; Differentiation; Cytokine; Proteolipid protein; DM20
Glial cell differentiation in the central nervous system (CNS) is elaborately regulated especially during the perinatal period. Oligodendrocytes are myelin forming cells in the CNS derived from oligodendrocyte/type-2 astrocyte (O-2A) progenitor cells, originally characterized in the optic nerve [12]. Approximately 50% of newly formed oligodendrocytes in the optic nerve normally die during development [2]. It has become evident that a variety of soluble factors influence the survival, proliferation and differentiation of O2A progenitor cells [3]. However, the precise mechanisms controlling their development are still unclear. Immortalized glial cell lines have the potential to provide a well
* Corresponding author. Tel.: +81 562 932487; fax: +81 562 932487; e-mail: [email protected]
0304-3940/98/$ - see front matter PII S0304- 3940(98) 00862- 3
developed in vitro model system to study the basis of survival, proliferation and differentiation. We previously established a bipotential glial cell line, designated OS3, from a neonatal C3H/HeN mouse primary mixed glial cell culture by transfection with an origin-defective simian virus 40 DNA [11]. OS3 cells have a flat cell body, multiple processes, and eccentric nucleus, which are morphologically similar to type-2 astrocytes when grown in the presence of 10% calf serum (CS). In this culture condition OS3 cells immunocytochemically express glial fibrillary acidic protein (GFAP) which is specific for astrocytes in the CNS. When OS3 cells are cultured in chemically defined medium or low serum-containing medium they lose immunoreactivity with anti-GFAP antibody and differentiate into oligodendrocytes which are characterized by phase bright cell body, multiple elaborated processes and
1998 Elsevier Science Ireland Ltd. All rights reserved
22
K. Asakura et al. / Neuroscience Letters 258 (1998) 21–24
surface immunocytochemical markers of the oligodendrocyte lineage. However, the capacity for differentiation of OS3 cells into mature oligodendrocytes in vitro is limited. Most OS3 cells cease their differentiation at the proligodendroblast stage which is recognized immunocytochemically by monoclonal antibody O4 [1]. Only a minor population of OS3 cells express galactocerebroside (GalC) but not other differentiated oligodendrocyte-specific markers, such as myelin basic protein (MBP) or proteolipid protein (PLP). However, OS3 cells express GalC and MBP when implanted into the infant mouse telencephalon. In contrast, OS3 cells keep their astrocytic phenotype, i.e., expression of GFAP but not GalC when implanted into 6-month-old adult mouse telencephalon [15]. This indicates that differentiation of O-2A progenitor cells is under specific control during development. In this study, we investigated mRNA expression of various cytokines and developmentally-regulated proteins in OS3 cells under different culture conditions by semi-quantitative reverse transcription and polymerase chain reaction (RT-PCR). OS3 cells were maintained in Eagle’s MEM supplemented with 10% CS, 5 mg/ml of insulin and 0.2% glucose. To enhance their differentiation, OS3 cells were cultured in 1% CS containing medium. OS3 cells were also stimulated with phorbol ester, 100 ng/ml of 12-O-tetradecanoylphorbol 13-acetate (TPA), in both culture conditions. As controls primary mixed glial cell cultures were prepared from telencephalon of C3H/HeN newborn mice (Charles River Japan, Shizuoka, Japan). Astrocyte-enriched cultures were prepared by repetitive passage of primary mixed glial cell cultures as described previously [14]. The purity of astrocyte cultures was more than 95% as determined by immunostaining with polyclonal anti-GFAP antibody (Dako, Carpinteria, CA). Enriched astrocytes were cultured in the presence of 10% CS or 1% CS. Total RNA was isolated by the modified acid guanidium thiocyanatephenol-chloroform extraction method [13] from (a) OS3 cells cultured in 10% CS or 1% CS containing medium for 4, 7, 10 and 14 days, and (b) highly enriched astrocytes cultured in 10% CS or 1% CS containing medium for 7 and 14 days. RT-PCR was performed as described previously [13]. Astrocytes produce a variety of cytokines and growth factors including IL-1 [9], IL-6 [7], and nerve growth factor (NGF) [8]. During myelination, oligodendrocytes produce several myelin-specific proteins including MBP, PLP, and myelin/oligodendrocyte glycoprotein. To investigate the differentiation of OS3 cells we focused on mRNA expression of IL-1 (IL-1a and IL-b), IL-6, NGF, and DM20/PLP. PLP is specific for myelin forming cells in the CNS, i.e. oligodendrocytes though it is expressed in very low levels in myelinating Schwann cells [5]. PLP and DM20, two abundant proteins of myelin, are produced from alternatively spliced mRNA from the primary PLP gene transcript. DM20 protein is identical to PLP except for the absence of an internal 35 amino acids derived from exon III [5]. The
following primers were synthesized and were used to detect the mRNA. Predicted sizes for the PCR products are shown in the parentheses. IL-1a sense: atggccaaagttcctgacttgttt, antisense: ccttcagcaacacgggctggtc (635 bp); NGF sense: caacatcactgtagacccc, antisense: ttgacgaaggtgtgagtcg (423 bp); b-actin sense: gtgggccgccctaggcacca, antisense: ctctttgatgtcacgcacgatttc (540 bp); IL-1b (563 bp) [10]; IL-6 (638 bp) [10]; DM20/PLP (747 bp/852 bp)[16]. Primers for DM20 and PLP were designed to include the entire coding region of both DM20 and PLP [16]. One microgram of total RNA was reverse transcribed into cDNA in a reaction mixture containing 10 mM dithiothreitol, 0.7 mM dNTPs, 0.2 mg of DNA random hexamer, 20 U of RNase inhibitor (Promega, Madison, WI), 50 U of MMLV reverse transcriptase (GIBCO, Grand Island, NY) at 37°C for 90 min. The reaction was terminated by heating at 72°C for 5 min. Negative controls were prepared by incubation without reverse transcriptase. Two microliters of the reaction mixture was used for PCR. The thermal cycle profile was as follows: denaturation at 94°C for 1 min, annealing at 55°C or 60°C for 1 min and extension at 72°C for 2 min, except in the first cycle where denaturation was for 5 min, and the last extension for 10 min. DNA fragments amplified by PCR were resolved by electrophoresis on 2% agarose gels containing ethidium bromide and the gels were photographed. For semi-quantitative analysis, the stained gels were scanned with TIAS-2000 Image Analyzer (ACI Japan, Yokohama, Japan). The expression of b-actin mRNA was detected as an internal control. The feasibility of this quantitative analysis has been examined previously [10]. Astrocytes produce two isoforms of IL-1, i.e. IL-1a and IL-1b [9]. In the presence of 10% CS, OS3 cells immunocytochemically expressed GFAP (Fig. 1A, [11]) and IL-1a and IL-1b mRNA were detected (Fig. 2A). When cultured in low serum-containing medium (1% CS), the surface of OS3 cells were stained with monoclonal antibody O4 (a gift from Dr. S.E. Pfeiffer, University of Connecticut, USA) (Fig. 1B, [11]) and the expression of IL-1a and IL-1b mRNA was down-regulated (IL-1b mRNA was undetectable at 7 days) indicating that OS3 cells lost their astrocytic phenotype (Fig. 2A,B). In contrast the expression of IL-1b
Fig. 1. Immunocytochemical staining of OS3 cells. (A) In the presence of 10% CS OS3 cells express GFAP. (B) In low serum-containing medium (1% CS for 7 days) the surface of OS3 cells is stained with monoclonal antibody O4. Scale bar, 20 mm. Note multiple elaborated processes, characteristic of oligodendrocytes in (B).
K. Asakura et al. / Neuroscience Letters 258 (1998) 21–24
23
Fig. 2. (A) Expression of DM20, PLP, IL-1a, and IL-1b mRNA in OS3 cells by RT-PCR. OS3 cells were grown originally in the presence of 10% CS (0 day) and then were cultured in 1% CS-containing medium for 4, 7, 10, and 14 days. The expression of b-actin mRNA was used as an internal control. (B,C) Expression of each mRNA was quantitated with a image analyzer. The level of DM20, PLP, IL-1a, and IL-1b mRNA expression was adjusted to expression of b-actin mRNA; the relative expression (%) was compared with the 0 day time point. The relative expression of PLP mRNA was compared to the 4 day time point because PLP mRNA was not detected in the presence of 10% CS (0 day).
mRNA in primary astrocytes was not changed in low serumcontaining medium (Fig. 3B). Though both PLP and DM20 are produced from alternatively spliced mRNA from the primary PLP gene transcript, PLP is exclusively expressed in myelinating cells in the CNS. In contrast DM20 is expressed not only in the CNS but also in the cells outside of the CNS, e.g. myocardial cells
[5]. However, its physiological function is unclear. The developmental appearance of DM20 precedes that of PLP in the CNS. During the early stages of myelination the expression of DM20 predominates and gradually declines with development. At later stages, PLP is the major form that is expressed [5]. In the presence of 10% CS, OS3 cells expressed DM20 mRNA but not PLP mRNA (Fig. 2A).
Fig. 3. (a) Expression of NGF and IL-6 mRNA in OS3 cells under stimulation of phorbol ester. OS3 cells were grown originally in the presence of 10% CS (0 day) and then were cultured in 1% CS-containing medium for 4, 7, 10, and 14 days with or without 100 ng/ml of TPA. (B) Expression of DM20, PLP, IL-b, and NGF mRNA in astrocyte-enriched culture. Astrocytes enriched from mouse primary mixed glial cell culture were cultured in the presence of 10% CS (0 day) or 1% CS for 7 and 14 days.
24
K. Asakura et al. / Neuroscience Letters 258 (1998) 21–24
When cultured in low serum-containing medium (1% CS), OS3 cells began expressing both DM20 and PLP mRNA and expression was up-regulated with further differentiation (Fig. 2A,C). This up-regulation of PLP and DM20 occurred in a parallel manner such that a relative constant PLP/DM20 mRNA ratio was maintained. OS3 cells expressed DM20 predominantly throughout their differentiation. In contrast, primary astrocytes cultured in the presence of 10% CS expressed DM20 but not PLP mRNA (Fig. 3B). The expression of DM20 mRNA in primary astrocytes was not changed in low serum-containing medium (Fig. 3B). PLP mRNA was not detected in primary astrocytes cultured in low serum-containing medium (Fig. 3B). Astrocytes also produce NGF [8] and IL-6 [7]. Though it has been shown that oligodendrocytes produce NGF [4], a major source of NGF in the CNS is astrocytes. Non-stimulated OS3 cells in 10% CS-containing medium expressed NGF and IL-6 mRNA (Fig. 3A). When stimulated with TPA, the synthesis of NGF in astrocytes has been reported to be induced by protein kinase C activation [6]. In the presence of 10% CS, expression of NGF and IL-6 mRNA in OS3 cells were both enhanced two times and ten times by TPA, respectively. This expression of NGF mRNA was attenuated when cultured in low serum-containing medium under both non-stimulated and stimulated conditions with TPA in a parallel manner (Fig. 3A). IL-6 mRNA was not detected in non-stimulated OS3 cells cultured in low serumcontaining medium at 14 days. Even following the stimulation with TPA, the expression of IL-6 mRNA was drastically down-regulated in low serum culture condition (Fig. 3A). In contrast, primary astrocytes expressed NGF mRNA and its expression was independent of culture conditions (Fig. 3B). In this study we demonstrated that a bipotential glial cell line produces mRNA of various cytokines and differentially regulated myelin proteins in response to serum deprivation and the stimulation with phorbol ester. The pattern of expression of these mRNAs was compatible with that observed in primary glial cells. Therefore, the OS3 immortalized cell line will serve as a useful model for the study of mechanisms of developmental regulation in O-2A lineage cells. This study was supported in part by Grants-in-Aid for Scientific Research from the Japanese Ministry of Education, Science and Culture and Fujita Health University, and Funds for Comprehensive Research on Aging and Health. K.A. was supported in part by a fellowship grant from Applebaum Foundation.
[1] Bansal, R., Stefansson, K. and Pfeiffer, S.E., Proligodendroblast antigen (POA), a developmental antigen expressed by A007/O4-positive oligodendrocyte progenitors prior to the appearance of the sulfatide and galactocerebroside, J. Neurochem., 58 (1992) 2221–2229. [2] Barres, B.A., Hart, I.K., Coles, H.S.R., Burne, J.F., Voyvodic, J.T., Richardson, W.D. and Raff, M.C., Cell death in the oligodendrocyte lineage, J. Neurobiol., 23 (1992) 1221–1230. [3] Barres, B.A. and Raff, M.C., Control of oligodendrocyte number in the developing rat optic nerve, Neuron, 12 (1994) 935–942. [4] Byravan, S., Foster, L.M., Phan, T., Verity, A.N. and Campagnoni, A.T., Murine oligodendroglial cells express nerve growth factor, Proc. Natl. Acad. Sci. USA, 91 (1994) 8812–8816. [5] Campagnoni, A.T., Molecular biology of myelination. In H. Kettenmann and B.R. Ransom (Eds.), Neuroglia, Oxford University Press, New York, 1995, pp. 555–570. [6] D’Mello, S.R. and Heinrich, G., Induction of nerve growth factor gene expression by 12-O-tetradecanoyl phorbol 13-acetate, J. Neurochem., 55 (1990) 718–721. [7] Frei, K., Malipiero, U.V., Leist, T.P., Zinkernagel, R.M., Schwab, M.E. and Fontana, A., On the cellular source and function of interleukin 6 produced in the central nervous system in viral disease, Eur. J. Immunol., 19 (1989) 689–694. [8] Furukawa, S., Furukawa, Y., Satoyoshi, E. and Hayashi, K., Synthesis and secretion of nerve growth factor by mouse astroglial cells in culture, Biochem. Biophys. Res. Commun., 136 (1986) 57–63. [9] Giulian, D., Baker, T.J., Shih, L.-C.N. and Lachman, L.B., Interleukin-1 of the central nervous system is produced by ameboid microglia, J. Exp. Med., 164 (1986) 594–604. [10] Mizuno, T., Sawada, M., Suzumura, A. and Marunouchi, T., Expression of cytokines during glial differentiation, Brain Res., 656 (1994) 141–146. [11] Ohtani, K., Suzumura, A., Sawada, M., Marunouchi, T., Nakashima, I. and Takahashi, A., Establishment of mouse oligodendrocyte/type-2 astrocyte lineage cell line by transfection with origin-defective simian virus 40 DNA, Cell Struc. Func., 17 (1992) 325–333. [12] Raff, M.C., Miller, R.H. and Noble, M., A glial progenitor cell that develops in vitro into an astrocyte or an oligodendrocyte depending on culture medium, Nature, 303 (1983) 390–396. [13] Sawada, M., Suzumura, A., Kondo, N. and Marunouchi, T., Induction of cytokines in glial cells by trans activator of human T-cell lymphotropic virus type I, FEBS Lett., 313 (1992) 47–50. [14] Sawada, M., Suzumura, A., Ohno, K. and Marunouchi, T., Regulation of astrocyte proliferation by prostaglandin E2 and the a subtype of protein kinase C, Brain Res., 613 (1993) 67–73. [15] Sawamura, S., Sawada, M., Ito, M., Nagatsu, T., Nagatsu, I., Suzumura, A., Shibuya, M., Sugita, K. and Marunouchi, T., The bipotential glial progenitor cell line can develop into both oligodendrocytes and astrocytes in the mouse forebrain, Neurosci. Lett., 188 (1995) 1–4. [16] Timsit, S., Sinoway, M.P., Levy, L., Allinquant, B., Stempak, J., Staugaitis, S.M. and Colman, D.R., The DM20 protein of myelin: intracellular and surface expression patterns in transfectants, J. Neurochem., 58 (1992) 1936–1942.
Differentiation-specific mRNA expression of a mouse bipotential glial cell line Kunihiko Asakura a, Akio Suzumura b, Moses Rodriguez a, Makoto Sawada c , d ,* a
Departments of Neurology and Immunology, Mayo Clinic and Foundation, Rochester, MN, USA b Department of Neurology, Nara Medical University, Kashihara, Nara, Japan c Joint Research Division for Therapies against Intractable Diseases, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake, Aichi 470-1192, Japan d PRESTO, Japan Science and Technology Corporation, Tokyo 105, Japan Received 2 September 1998; received in revised form 14 October 1998; accepted 14 October 1998
Abstract We have previously reported that a bipotential glial cell line from mouse cerebrum, designated OS3, phenotypically differentiates into oligodendrocytes and astrocytes both in vitro and in vivo. To study the potential mechanisms of differentiation, in this study we investigated mRNA expression of cytokines and developmentally regulated proteins in OS3 during differentiation into oligodendrocytes by semi-quantitative reverse transcription and polymerase chain reaction. In the presence of 10% calf serum OS3 cells expressed IL-1a and IL-1b mRNA. However, when the cells were cultured in chemically defined medium or low serum-containing medium the expression of IL-1a and IL-1b mRNA was down-regulated. Under stimulation of phorbol ester, expression of IL-6 and nerve growth factor mRNA was up-regulated. The capacity for differentiation of OS3 cells into oligodendrocytes in vitro was limited and most OS3 cells ceased their differentiation at the proligodendroblast stage. However, expression of proteolipid protein (PLP) and DM20 mRNA was detectable and was up-regulated in accordance with the differentiation into oligodendrocytes. As a control, primary astrocytes expressed DM20 mRNA but not PLP mRNA and the expression of DM20 mRNA was independent of culture condition. Therefore, OS3 cells will be of use for the study of differentiation of progenitor cells into type-2 astrocytes or oligodendrocytes at the molecular level. 1998 Elsevier Science Ireland Ltd. All rights reserved
Keywords: O-2A progenitor; Oligodendrocytes; Differentiation; Cytokine; Proteolipid protein; DM20
Glial cell differentiation in the central nervous system (CNS) is elaborately regulated especially during the perinatal period. Oligodendrocytes are myelin forming cells in the CNS derived from oligodendrocyte/type-2 astrocyte (O-2A) progenitor cells, originally characterized in the optic nerve [12]. Approximately 50% of newly formed oligodendrocytes in the optic nerve normally die during development [2]. It has become evident that a variety of soluble factors influence the survival, proliferation and differentiation of O2A progenitor cells [3]. However, the precise mechanisms controlling their development are still unclear. Immortalized glial cell lines have the potential to provide a well
* Corresponding author. Tel.: +81 562 932487; fax: +81 562 932487; e-mail: [email protected]
0304-3940/98/$ - see front matter PII S0304- 3940(98) 00862- 3
developed in vitro model system to study the basis of survival, proliferation and differentiation. We previously established a bipotential glial cell line, designated OS3, from a neonatal C3H/HeN mouse primary mixed glial cell culture by transfection with an origin-defective simian virus 40 DNA [11]. OS3 cells have a flat cell body, multiple processes, and eccentric nucleus, which are morphologically similar to type-2 astrocytes when grown in the presence of 10% calf serum (CS). In this culture condition OS3 cells immunocytochemically express glial fibrillary acidic protein (GFAP) which is specific for astrocytes in the CNS. When OS3 cells are cultured in chemically defined medium or low serum-containing medium they lose immunoreactivity with anti-GFAP antibody and differentiate into oligodendrocytes which are characterized by phase bright cell body, multiple elaborated processes and
1998 Elsevier Science Ireland Ltd. All rights reserved
22
K. Asakura et al. / Neuroscience Letters 258 (1998) 21–24
surface immunocytochemical markers of the oligodendrocyte lineage. However, the capacity for differentiation of OS3 cells into mature oligodendrocytes in vitro is limited. Most OS3 cells cease their differentiation at the proligodendroblast stage which is recognized immunocytochemically by monoclonal antibody O4 [1]. Only a minor population of OS3 cells express galactocerebroside (GalC) but not other differentiated oligodendrocyte-specific markers, such as myelin basic protein (MBP) or proteolipid protein (PLP). However, OS3 cells express GalC and MBP when implanted into the infant mouse telencephalon. In contrast, OS3 cells keep their astrocytic phenotype, i.e., expression of GFAP but not GalC when implanted into 6-month-old adult mouse telencephalon [15]. This indicates that differentiation of O-2A progenitor cells is under specific control during development. In this study, we investigated mRNA expression of various cytokines and developmentally-regulated proteins in OS3 cells under different culture conditions by semi-quantitative reverse transcription and polymerase chain reaction (RT-PCR). OS3 cells were maintained in Eagle’s MEM supplemented with 10% CS, 5 mg/ml of insulin and 0.2% glucose. To enhance their differentiation, OS3 cells were cultured in 1% CS containing medium. OS3 cells were also stimulated with phorbol ester, 100 ng/ml of 12-O-tetradecanoylphorbol 13-acetate (TPA), in both culture conditions. As controls primary mixed glial cell cultures were prepared from telencephalon of C3H/HeN newborn mice (Charles River Japan, Shizuoka, Japan). Astrocyte-enriched cultures were prepared by repetitive passage of primary mixed glial cell cultures as described previously [14]. The purity of astrocyte cultures was more than 95% as determined by immunostaining with polyclonal anti-GFAP antibody (Dako, Carpinteria, CA). Enriched astrocytes were cultured in the presence of 10% CS or 1% CS. Total RNA was isolated by the modified acid guanidium thiocyanatephenol-chloroform extraction method [13] from (a) OS3 cells cultured in 10% CS or 1% CS containing medium for 4, 7, 10 and 14 days, and (b) highly enriched astrocytes cultured in 10% CS or 1% CS containing medium for 7 and 14 days. RT-PCR was performed as described previously [13]. Astrocytes produce a variety of cytokines and growth factors including IL-1 [9], IL-6 [7], and nerve growth factor (NGF) [8]. During myelination, oligodendrocytes produce several myelin-specific proteins including MBP, PLP, and myelin/oligodendrocyte glycoprotein. To investigate the differentiation of OS3 cells we focused on mRNA expression of IL-1 (IL-1a and IL-b), IL-6, NGF, and DM20/PLP. PLP is specific for myelin forming cells in the CNS, i.e. oligodendrocytes though it is expressed in very low levels in myelinating Schwann cells [5]. PLP and DM20, two abundant proteins of myelin, are produced from alternatively spliced mRNA from the primary PLP gene transcript. DM20 protein is identical to PLP except for the absence of an internal 35 amino acids derived from exon III [5]. The
following primers were synthesized and were used to detect the mRNA. Predicted sizes for the PCR products are shown in the parentheses. IL-1a sense: atggccaaagttcctgacttgttt, antisense: ccttcagcaacacgggctggtc (635 bp); NGF sense: caacatcactgtagacccc, antisense: ttgacgaaggtgtgagtcg (423 bp); b-actin sense: gtgggccgccctaggcacca, antisense: ctctttgatgtcacgcacgatttc (540 bp); IL-1b (563 bp) [10]; IL-6 (638 bp) [10]; DM20/PLP (747 bp/852 bp)[16]. Primers for DM20 and PLP were designed to include the entire coding region of both DM20 and PLP [16]. One microgram of total RNA was reverse transcribed into cDNA in a reaction mixture containing 10 mM dithiothreitol, 0.7 mM dNTPs, 0.2 mg of DNA random hexamer, 20 U of RNase inhibitor (Promega, Madison, WI), 50 U of MMLV reverse transcriptase (GIBCO, Grand Island, NY) at 37°C for 90 min. The reaction was terminated by heating at 72°C for 5 min. Negative controls were prepared by incubation without reverse transcriptase. Two microliters of the reaction mixture was used for PCR. The thermal cycle profile was as follows: denaturation at 94°C for 1 min, annealing at 55°C or 60°C for 1 min and extension at 72°C for 2 min, except in the first cycle where denaturation was for 5 min, and the last extension for 10 min. DNA fragments amplified by PCR were resolved by electrophoresis on 2% agarose gels containing ethidium bromide and the gels were photographed. For semi-quantitative analysis, the stained gels were scanned with TIAS-2000 Image Analyzer (ACI Japan, Yokohama, Japan). The expression of b-actin mRNA was detected as an internal control. The feasibility of this quantitative analysis has been examined previously [10]. Astrocytes produce two isoforms of IL-1, i.e. IL-1a and IL-1b [9]. In the presence of 10% CS, OS3 cells immunocytochemically expressed GFAP (Fig. 1A, [11]) and IL-1a and IL-1b mRNA were detected (Fig. 2A). When cultured in low serum-containing medium (1% CS), the surface of OS3 cells were stained with monoclonal antibody O4 (a gift from Dr. S.E. Pfeiffer, University of Connecticut, USA) (Fig. 1B, [11]) and the expression of IL-1a and IL-1b mRNA was down-regulated (IL-1b mRNA was undetectable at 7 days) indicating that OS3 cells lost their astrocytic phenotype (Fig. 2A,B). In contrast the expression of IL-1b
Fig. 1. Immunocytochemical staining of OS3 cells. (A) In the presence of 10% CS OS3 cells express GFAP. (B) In low serum-containing medium (1% CS for 7 days) the surface of OS3 cells is stained with monoclonal antibody O4. Scale bar, 20 mm. Note multiple elaborated processes, characteristic of oligodendrocytes in (B).
K. Asakura et al. / Neuroscience Letters 258 (1998) 21–24
23
Fig. 2. (A) Expression of DM20, PLP, IL-1a, and IL-1b mRNA in OS3 cells by RT-PCR. OS3 cells were grown originally in the presence of 10% CS (0 day) and then were cultured in 1% CS-containing medium for 4, 7, 10, and 14 days. The expression of b-actin mRNA was used as an internal control. (B,C) Expression of each mRNA was quantitated with a image analyzer. The level of DM20, PLP, IL-1a, and IL-1b mRNA expression was adjusted to expression of b-actin mRNA; the relative expression (%) was compared with the 0 day time point. The relative expression of PLP mRNA was compared to the 4 day time point because PLP mRNA was not detected in the presence of 10% CS (0 day).
mRNA in primary astrocytes was not changed in low serumcontaining medium (Fig. 3B). Though both PLP and DM20 are produced from alternatively spliced mRNA from the primary PLP gene transcript, PLP is exclusively expressed in myelinating cells in the CNS. In contrast DM20 is expressed not only in the CNS but also in the cells outside of the CNS, e.g. myocardial cells
[5]. However, its physiological function is unclear. The developmental appearance of DM20 precedes that of PLP in the CNS. During the early stages of myelination the expression of DM20 predominates and gradually declines with development. At later stages, PLP is the major form that is expressed [5]. In the presence of 10% CS, OS3 cells expressed DM20 mRNA but not PLP mRNA (Fig. 2A).
Fig. 3. (a) Expression of NGF and IL-6 mRNA in OS3 cells under stimulation of phorbol ester. OS3 cells were grown originally in the presence of 10% CS (0 day) and then were cultured in 1% CS-containing medium for 4, 7, 10, and 14 days with or without 100 ng/ml of TPA. (B) Expression of DM20, PLP, IL-b, and NGF mRNA in astrocyte-enriched culture. Astrocytes enriched from mouse primary mixed glial cell culture were cultured in the presence of 10% CS (0 day) or 1% CS for 7 and 14 days.
24
K. Asakura et al. / Neuroscience Letters 258 (1998) 21–24
When cultured in low serum-containing medium (1% CS), OS3 cells began expressing both DM20 and PLP mRNA and expression was up-regulated with further differentiation (Fig. 2A,C). This up-regulation of PLP and DM20 occurred in a parallel manner such that a relative constant PLP/DM20 mRNA ratio was maintained. OS3 cells expressed DM20 predominantly throughout their differentiation. In contrast, primary astrocytes cultured in the presence of 10% CS expressed DM20 but not PLP mRNA (Fig. 3B). The expression of DM20 mRNA in primary astrocytes was not changed in low serum-containing medium (Fig. 3B). PLP mRNA was not detected in primary astrocytes cultured in low serum-containing medium (Fig. 3B). Astrocytes also produce NGF [8] and IL-6 [7]. Though it has been shown that oligodendrocytes produce NGF [4], a major source of NGF in the CNS is astrocytes. Non-stimulated OS3 cells in 10% CS-containing medium expressed NGF and IL-6 mRNA (Fig. 3A). When stimulated with TPA, the synthesis of NGF in astrocytes has been reported to be induced by protein kinase C activation [6]. In the presence of 10% CS, expression of NGF and IL-6 mRNA in OS3 cells were both enhanced two times and ten times by TPA, respectively. This expression of NGF mRNA was attenuated when cultured in low serum-containing medium under both non-stimulated and stimulated conditions with TPA in a parallel manner (Fig. 3A). IL-6 mRNA was not detected in non-stimulated OS3 cells cultured in low serumcontaining medium at 14 days. Even following the stimulation with TPA, the expression of IL-6 mRNA was drastically down-regulated in low serum culture condition (Fig. 3A). In contrast, primary astrocytes expressed NGF mRNA and its expression was independent of culture conditions (Fig. 3B). In this study we demonstrated that a bipotential glial cell line produces mRNA of various cytokines and differentially regulated myelin proteins in response to serum deprivation and the stimulation with phorbol ester. The pattern of expression of these mRNAs was compatible with that observed in primary glial cells. Therefore, the OS3 immortalized cell line will serve as a useful model for the study of mechanisms of developmental regulation in O-2A lineage cells. This study was supported in part by Grants-in-Aid for Scientific Research from the Japanese Ministry of Education, Science and Culture and Fujita Health University, and Funds for Comprehensive Research on Aging and Health. K.A. was supported in part by a fellowship grant from Applebaum Foundation.
[1] Bansal, R., Stefansson, K. and Pfeiffer, S.E., Proligodendroblast antigen (POA), a developmental antigen expressed by A007/O4-positive oligodendrocyte progenitors prior to the appearance of the sulfatide and galactocerebroside, J. Neurochem., 58 (1992) 2221–2229. [2] Barres, B.A., Hart, I.K., Coles, H.S.R., Burne, J.F., Voyvodic, J.T., Richardson, W.D. and Raff, M.C., Cell death in the oligodendrocyte lineage, J. Neurobiol., 23 (1992) 1221–1230. [3] Barres, B.A. and Raff, M.C., Control of oligodendrocyte number in the developing rat optic nerve, Neuron, 12 (1994) 935–942. [4] Byravan, S., Foster, L.M., Phan, T., Verity, A.N. and Campagnoni, A.T., Murine oligodendroglial cells express nerve growth factor, Proc. Natl. Acad. Sci. USA, 91 (1994) 8812–8816. [5] Campagnoni, A.T., Molecular biology of myelination. In H. Kettenmann and B.R. Ransom (Eds.), Neuroglia, Oxford University Press, New York, 1995, pp. 555–570. [6] D’Mello, S.R. and Heinrich, G., Induction of nerve growth factor gene expression by 12-O-tetradecanoyl phorbol 13-acetate, J. Neurochem., 55 (1990) 718–721. [7] Frei, K., Malipiero, U.V., Leist, T.P., Zinkernagel, R.M., Schwab, M.E. and Fontana, A., On the cellular source and function of interleukin 6 produced in the central nervous system in viral disease, Eur. J. Immunol., 19 (1989) 689–694. [8] Furukawa, S., Furukawa, Y., Satoyoshi, E. and Hayashi, K., Synthesis and secretion of nerve growth factor by mouse astroglial cells in culture, Biochem. Biophys. Res. Commun., 136 (1986) 57–63. [9] Giulian, D., Baker, T.J., Shih, L.-C.N. and Lachman, L.B., Interleukin-1 of the central nervous system is produced by ameboid microglia, J. Exp. Med., 164 (1986) 594–604. [10] Mizuno, T., Sawada, M., Suzumura, A. and Marunouchi, T., Expression of cytokines during glial differentiation, Brain Res., 656 (1994) 141–146. [11] Ohtani, K., Suzumura, A., Sawada, M., Marunouchi, T., Nakashima, I. and Takahashi, A., Establishment of mouse oligodendrocyte/type-2 astrocyte lineage cell line by transfection with origin-defective simian virus 40 DNA, Cell Struc. Func., 17 (1992) 325–333. [12] Raff, M.C., Miller, R.H. and Noble, M., A glial progenitor cell that develops in vitro into an astrocyte or an oligodendrocyte depending on culture medium, Nature, 303 (1983) 390–396. [13] Sawada, M., Suzumura, A., Kondo, N. and Marunouchi, T., Induction of cytokines in glial cells by trans activator of human T-cell lymphotropic virus type I, FEBS Lett., 313 (1992) 47–50. [14] Sawada, M., Suzumura, A., Ohno, K. and Marunouchi, T., Regulation of astrocyte proliferation by prostaglandin E2 and the a subtype of protein kinase C, Brain Res., 613 (1993) 67–73. [15] Sawamura, S., Sawada, M., Ito, M., Nagatsu, T., Nagatsu, I., Suzumura, A., Shibuya, M., Sugita, K. and Marunouchi, T., The bipotential glial progenitor cell line can develop into both oligodendrocytes and astrocytes in the mouse forebrain, Neurosci. Lett., 188 (1995) 1–4. [16] Timsit, S., Sinoway, M.P., Levy, L., Allinquant, B., Stempak, J., Staugaitis, S.M. and Colman, D.R., The DM20 protein of myelin: intracellular and surface expression patterns in transfectants, J. Neurochem., 58 (1992) 1936–1942.