- Email: [email protected]
Direct multiplex allele-specific PCR amplification for ABO genotyping from whole blood, hair root and buccal cell
Gene Reports 17 (2019) 100510
Contents lists available at ScienceDirect
Gene Reports journal homepage: www.elsevier.com/locate/genrep
Direct multiplex allele-specific PCR amplification for ABO genotyping from whole blood, hair root and buccal cell
T
⁎
Sirinart Chomeana, , Maysinee Prasarnjittb, Chutiphan Lapwonganana, Patchareerat Wongisaraphaba, Chollanot Kaseta,b a b
Department of Medical Technology, Faculty of Allied Health Sciences, Thammasat University, Thailand Department of Forensic Sciences, Faculty of Allied Health Sciences, Thammasat University, Thailand
A R T I C LE I N FO
A B S T R A C T
Keywords: ABO genotyping Buccal cell Direct PCR amplification Hair root Non-invasion detection Whole blood
Background: ABO genotyping is an increasingly being used for accurate prediction of blood transfusion, organ transplantation and forensic application. Traditional methods require DNA extract and purification which is time-consuming labor-intensive and limit the trace samples detection. Methods: Present study developed the multiplex allele-specific polymerase chain reaction (AS-PCR) method to identify the six major genotypes of ABO blood groups in two tubes reaction. The samples of whole blood, buccal cell and hair root from 30 volunteers were examined. Results: All genotyping results were interpreted and agreed with the serologic findings. The modified AS-PCR method was able to determine ABO genotyping using direct blood and non-invasive samples including buccal cell and hair root. Conclusions: The modified technique has a high specific and sensitive, rapid and cost-efficiency of genotyping method which might be valuable for transfusion medicine in a clinical laboratory and personal identification in forensic investigation.
1. Introduction Genetic analysis of the ABO blood group has become essential in both blood transfusion and organ transplantation and is used as one of the markers for personal identification in a forensic application (Prager et al., 2007; Bugert et al., 2012; Flegel, 2013; Kim et al., 2017). The routine examinations used serological ABO typing method based on red blood cells agglutination reaction against specific antisera. However, the serological typing methods show ambiguous results causing the ABO discrepancies such as massive transfusion, unexpected autoantibodies and alloantibodies (Jain et al., 2017; Meny, 2017; Mulvey et al., 2017). In recent years, many studies have turned attention to molecular typing methods. ABO genotyping is now commonly used in cases of an ABO discrepancy between cell typing and serum typing, especially in forensic practices for personal identification and paternity testing. Gene of ABO blood group is located on chromosome 9 (9q34.1–9q34.2) which contains 7 exons spanning over 18–20 kilobase (kb) pairs (Roubinet et al., 2004; Wheeler and Waikel, 2010; Huh et al.,
2011; Ito et al., 2013; Kensaku Aki et al., 2014). Analysis of the ABO gene can be classified into 6 common genotypes (A/A, A/O, B/B, B/O, O/O, and A/B) (Lee et al., 2009b; Wheeler and Waikel, 2010; Huh et al., 2011; Kensaku Aki et al., 2014; Zhang et al., 2015). Many PCR based methods have been developed including restriction fragment length polymorphism (RFLP) (Wheeler and Waikel, 2010), sequence-specific primer (SSP) (Prager, 2007), single-strand conformation polymorphism (SSCP) (Lee et al., 2009a), high-resolution melting (HRM) analysis (Jiang et al., 2017), DNA sequencing (Huh et al., 2011; Wu et al., 2018) and DNA chip (Watanabe et al., 2011; Watanabe et al., 2013). These methods often cause pseudo-positive from mispriming amplification and also require 2 step procedures (Yaku et al., 2008; Lee et al., 2009b; Huh et al., 2011). To improve the specificity of primer annealing, the allele-specific (AS) based on PCR amplification was proposed (Yaku et al., 2008; Lee et al., 2009b). However, the DNA extraction and purification are necessary before the PCR process because blood, tissue or secretory samples contain various substances to inhibit PCR. Likewise, the extraction process needs the proper sample volume and
Abbreviations: AS-PCR, allele-specific PCR amplification; bp, base pair; EDTA, ethylenediaminetetraacetic acid; HGH, human growth hormone; HRM, high-resolution melting; kb, kilobases; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; SSCP, single-strand conformation polymorphism; SSP, sequence-specific primer ⁎ Corresponding author. E-mail address: [email protected] (S. Chomean). https://doi.org/10.1016/j.genrep.2019.100510 Received 5 July 2019; Received in revised form 12 September 2019; Accepted 13 September 2019 Available online 18 October 2019 2452-0144/ © 2019 Elsevier Inc. All rights reserved.
Gene Reports 17 (2019) 100510
For direct multiplex allele-specific PCR amplification, various PCR buffer were evaluated including the 2× Green PCR Master Mix (biotechrabbit, Germany), 2× i-Taq PCR Master Mix (iNtRON Biotechnology, Korea) and 2× DreamTaq Green PCR Master Mix (Thermo Fisher Scientific Inc., USA). The reaction was performed in a final volume of 20 μl according to 2× of each PCR buffer, 5 μM of each primer and 2 μl of whole blood. Whole blood of O and AB group were 2
Target specificity
ABO*A1.01, ABO*A1.02, ABO*O.01.01(O1) ABO*O.01.01(O1), ABO*O.01.02(Ov) Human growth hormone (internal control) ABO*A1.01, ABO*A1.02, ABO*B.01 ABO*B.01 Human growth hormone (internal control) 164 205 434 205 381 434 CCATTGTCTGGGAGGGCcCA AGACCTCAATGTCCACAGTCACTCG GCAGTAGGAAGGATGTCCTCGTGtTA AGACCTCAATGTCCACAGTCACTCG TGCCTTCCCAACCATTCCCTTA CCACTCACGGATTTCTGTTGTGTTTC GCAGTAGGAAGGATGTCCTCGTGtTG AGACCTCAATGTCCACAGTCACTCG CCACTACTATGTCTTCACCGACCATCC CACCGACCCCCCGAAGAtCG TGCCTTCCCAACCATTCCCTTA CCACTCACGGATTTCTGTTGTGTTTC 2
2.3. Investigation of optimal condition for multiplex allele-specific PCR amplification
297A (rs8176720) R: int6 261A (rs8176720 (ΔG)) R: int6 HGH R: HGH 261G (rs8176719) R: int6 467C R: 803G (rs8176747) HGH R: HGH
The allele-specific primer set was modified from the previous report (Lee et al., 2009b) to identify the six common ABO genotypes into two PCR reactions (Table 1). The expected results of multiplex allele-specific PCR amplification were shown in Fig. 1. The six ABO genotypes (A/A, A/O, B/B, B/O, O/O, and A/B) were identified by multiplex allele-specific PCR using two reactions. The position of primer sequences at 3′ end relative to the cDNA sequence of ABO*A1.01 allele. The primers of human growth hormone (HGH) were used as internal control with product size 434 base pairs (bp). Reaction 1 was designed to differentiate ABO*O.01.01 and ABO*O.01.02 at the band of 205 bp. The ABO*O.01.01 also presented the band at 164 and 205 bp. While the reaction 2 was used to distinguish the ABO*B.01 at product size of 381 bp. For ABO*A1.01 and ABO*A1.02, the PCR product indicates DNA band at 164 bp and 205 bp in reactions 1 and 2, respectively.
F: F: F: F: F: F:
2.2. Primers for the six common ABO genotypes and the designed multiplex allele-specific PCR amplification
1
The study was reviewed and approved by the Ethics Committee of Thammasat University (COA No. 152/2559). Known samples of whole blood, hair root and buccal cell were collected to evaluate the six common ABO genotypes by multiplex allele-specific PCR amplification. To assess the identifying ability, thirty unknown samples of whole blood, hair root and buccal cell samples were received from a volunteer who signed an informed consent form to participate in the study. Whole blood was kept in ethylenediaminetetraacetic acid (EDTA) anticoagulant and separated the tubes for extracting the genomic DNA which was used as an experimental control. Genomic DNA was extracted using a PUREGENE@ Kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's protocol. The concentration and purity of extracted DNA were measured by UV–vis spectrophotometer using the absorbance at 260 and 280 nm. Extracted DNA and directed whole blood was kept at −20 °C and 4 °C, respectively until used. The 10 hair roots of each sample were stored in digestion buffer containing 50 mM Tris-HCl (pH 8.8), 0.5% Tween, 1 mM EDTA and 0.2 μg Proteinase K. The extracted hair root was incubated at 55 °C for 60 min and kept at −20 °C until used. Buccal cells were collected by swabbing the cells inside of the cheek with sterile cotton for 10 times after washing the mouth with sterile water. The buccal swab was proceeded similar to DNA extraction from the hair root.
Product size (bp)
2.1. Sample collection and preparation
Primer sequences (5′ ➔ 3′)
2. Materials and methods
Primer (reference SNP number)
extraction kit specify for each sample which does not suit for casework samples in forensic investigation. In this study, we attempted to develop the AS-PCR amplification for genotyping of ABO blood group from whole blood and non-invasive samples (buccal cell and hair root) without genomic DNA extraction. The two tubes reaction was created to identify the six common genotypes of the ABO blood group. The developed technique was a powerful ABO genotyping approach as a specific, simple, rapid and can be used as a screening method for personal identification.
Reaction
Table 1 Allele-specific primers sets to identify the six common genotypes by multiplex allele-specific PCR. The SNP site are shown underlined.The non-complementary nucleotides with the ABO*A1.01 allele template are shown in lower case.
S. Chomean, et al.
Gene Reports 17 (2019) 100510
S. Chomean, et al.
Fig. 1. Expected patterns of PCR product for the six common ABO genotypes by multiplex allele-specific PCR amplification. *Sample with ABO*O.01.01 genotype present the band at 164 bases pair (bp).
were compared to the serological tube test.
used as a positive control of O/O and A/B genotypes for assessing the optimal condition of multiplex allele-specific PCR amplification. The results were compared to the genomic DNA amplification. To prevent mispriming and pseudo-positive amplicons, the annealing temperature was varied at 58, 60, 61 and 63 °C for 30 s. Also, the additive solution was evaluated by adding 1, 1.5 and 3 M of betaine, 2, 3 and 5% of dimethyl sulfoxide (DMSO), 0.25, 0.5 and 1% of tween20 and 0.01, 0.05 and 0.1% of bovine serum albumin (BSA). The PCR amplification was carried out by a BIO-RAD T100 Thermocycler (Bio-Rad Laboratories Inc., USA) according to the initial denaturation at 95 °C for 5 min followed by 33 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and final extension at 72 °C for 5 min. All PCR products were verified by electrophoresis on 1.5% agarose gel stained with 0.5 μg/ml of ethidium bromide (EtBr) and observed under UV-transilluminator.
3. Results 3.1. Investigation of optimal condition for multiplex allele-specific PCR amplification Primer set of multiplex allele-specific PCR amplification for the six common ABO genotypes was designed into two reactions (Table 1). Known blood samples of O/O and A/B genotype were used to investigate the proper multiplex allele-specific PCR conditions. The amplified products from direct whole blood were compared to the extracted genomic DNA. The results showed that the optimal PCR buffer for direct blood amplifying was 2× i-taq PCR master mix (Fig. 2). All ABO alleles showed the intense band as expected size (Figs. 1 and 2). To reduced mispriming or pseudo-positive, the annealing temperature was determined. Fig. 3 showed the optimal annealing temperature was 60 °C since there were no ambiguous PCR products. Due to the faint band at 381 bp of ABO*B.01 allele, various additive solutions were investigated. The results found that betaine at a final concentration of 3 M can improve the ABO*B.01 allele amplification comparable to another (Fig. 4).
2.4. Evaluation of the six common ABO genotypes from whole blood, hair root and buccal cell The multiplex PCR of the six common ABO genotypes was evaluated in directed whole blood, hair root and buccal cell specimens. Two tubes of multiplex allele-specific PCR amplification were carried out using the two sets of primers (Table 1) according to the optimal condition. Briefly, PCR reaction was performed in a final volume of 20 μl containing 2× i-Taq PCR Master Mix (iNtRON Biotechnology, Korea), 5 μM of each primer, and 2 ul of each sample. The cycling conditions were an initial denaturation at 95 °C for 5 min, followed by 33 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s, and final extension was done at 72 °C for 5 min, followed by a quickly chill to 4 °C. The PCR products were analyzed by 1.5% agarose gel with 0.5 μg/ml of EtBr. Electrophoresis was visualized by UV-transilluminator.
3.2. Evaluation of the six common ABO genotypes from whole blood, hair root and buccal cell Known specimens of the six common genotypes were assessed the diagnostic potency of multiplex allele-specific PCR amplification under an optimal condition. The PCR products of the two tubes multiplex PCR amplified from direct blood, hair root and buccal cell were observed (Fig. 5A–C, respectively). It can be differentiated the O/O, A/B, A/O, A/ A, B/O and B/B genotypes by using the two tube PCR reactions (Fig. 5). The amplified products from whole blood, hair root and buccal cell showed similar results. Therefore, it can be indicated that the multiplex allele-specific PCR amplification can be used to identify the six common ABO genotypes from direct blood, hair root and buccal cell.
2.5. Casework application of the six common ABO genotypes by multiplex allele-specific PCR amplification Specimens of whole blood, hair root and buccal cell from 30 volunteers were collected and assessed the genotyping potency of multiplex allele-specific PCR amplification. Hair root and buccal cell were kept in the digestion buffer as above mentioned until tested. Results 3
Gene Reports 17 (2019) 100510
S. Chomean, et al.
Fig. 2. PCR products amplified in various PCR buffers. Lanes 2 to 7 were PCR products in reaction 1 while lanes 9 to 14 were reaction 2 of multiplex allele-specific PCR amplification. Lanes 1 and 8 were no template as a negative control of reactions 1 and 2, respectively. Genomic DNA of O/O genotype as a positive control was amplified by 2× Green PCR Master Mix (lane 2), 2× i-Taq PCR Master Mix (lane 3) and 2× DreamTaq Green PCR Master Mix (lane 4). Whole blood of O/O genotype was direct amplified by 2× Green PCR Master Mix (lane 5), 2× i-Taq PCR Master Mix (lane 6) and 2× DreamTaq Green PCR Master Mix (lane 7). Genomic DNA of A/O genotype as a positive control was amplified by 2× Green PCR Master Mix (lane 9), 2× i-Taq PCR Master Mix (lane 10) and 2× DreamTaq Green PCR Master Mix (lane 11). Whole blood of O/O genotype was direct amplified by 2× Green PCR Master Mix (lane 12), 2× i-Taq PCR Master Mix (lane 13) and 2× DreamTaq Green PCR Master Mix (lane 14).
sample volume needed. The whole blood, buccal cell and hair root can be used as a specimen for ABO genotyping (Lee et al., 2009b; Sharma et al., 2012; Kensaku Aki et al., 2014). Especially, buccal cell and hair root are non-invasive samples that prefer for collecting the specimen in many people. Also, these are one of most common forensic sample that could be used to link between a suspect and a crime scene (Bugert et al., 2012; Watanabe et al., 2013; Kim et al., 2017). Moreover, The ABO genotype can be used as a screening test for paternity investigation. The application of SNP typing in routine laboratory as paternity testing requires proof of the reliability and standardization of the procedure (Bugert et al., 2012). Besides, The use of blood group genotyping has been used to prevent the hemolytic disease of fetus and newborn (HDFN). Blood group genotyping is also helpful in identifying the accurate RBC phenotype of alloimmunized patients and patients who have positive direct antiglobulin test. The last decade, several studies have been reported to the benefit of blood group genotyping and transfusion of genotype-matched RBC units to prevent alloimmunization in multi-transfused patients since discrepancies between the genotyping and phenotyping are frequently detected (Bakanay et al., 2013) However, it is complicated to amplify the above samples directly due to it contains many inhibitory substances (Kensaku Aki et al., 2014). As a result, it can be inhibited the PCR amplification and caused invalid results. Nowadays, commercially available PCR kits can effectively neutralize inhibitory substances present in the blood (Kensaku Aki et al., 2014). Fig. 2 demonstrated that the 2× Green PCR master mix could be amplified all alleles from whole blood directly. It doesn't need a particular Tth DNA polymerase, pre-treatment by diluting the blood in distilled water or heat-treatment of the sample as previous study (Lee et al., 2009b; Kensaku Aki et al., 2014; Taki and Kibayashi, 2014). The optimal annealing temperature was determined to prevent the pseudo-positive or mispriming of the primers commonly occurs in multiplex PCR amplification (Lee et al., 2009b; Taki and Kibayashi, 2014). The suitable temperature for amplifying the six alleles was 60 °C (Fig. 3), which correspond to the Lee SH and coworker report (Lee et al., 2009b). However, the ABO*B.01 allele from reaction 2 showed a faint band (lane 12, Fig. 2); various PCR additives were evaluated. A variety of enhancing agents such as ammonium sulfate, formamide,
3.3. Casework application of the six common ABO genotypes by multiplex allele-specific PCR amplification The specimens from 30 healthy volunteers were analyzed the ABO genotype by multiplex allele-specific PCR amplification using two tube reactions. The six common ABO genotypes were differentiated by gel electrophoresis. Results from directed whole blood amplification corresponded to hair root and buccal cell. There were 13 samples (44%) of O/O genotype, 1 sample (3%) of A/B genotype, 6 samples (20%) of A/O genotype, 1 sample (3%) of A/A genotype, 8 samples (27%) of B/O genotype and 1 sample (3%) of B/B genotype. Additionally, the genotypic ability of multiplex allele-specific PCR amplification was 100% consistent with the serologic phenotypes (Table 2). Analysis of the diagnostic ability of the developed multiplex allele-specific PCR amplification illustrated that it was 100% sensitivity and specificity compared with conventional test tube method. 4. Discussion Many methods for ABO genotyping has been developed including the PCR-based method, restriction fragment length polymorphism (RFLP) analysis (Wheeler and Waikel, 2010), single-strand conformation polymorphism (Lee et al., 2009a), high-resolution melting (HRM) analysis (Jiang et al., 2017) and allele-specific primers (Lee et al., 2009b; Taira et al., 2018). All of these methods are labor-intensive, time-consuming and require a separate PCR reaction and separation step for typing after PCR method. Present study designed multiplex allele-specific PCR amplification to differentiate the six common genotypes into two tube reactions. The primers were modified according to the previous study (Lee et al., 2009b) for identifying the ABO*O.01.01 and ABO*O.01.02 allele in reaction 1 and ABO*B.01 allele in reaction 2 while ABO*A1.01 and ABO*A1.02 allele require both 2 reactions (Table 1). Interpretation pattern of the six ABO genotypes was shown in Fig. 1. Although multiplex allele-specific PCR method is simple and effective, it requires the extraction of DNA from specimens. Direct PCR amplification, without genomic DNA extraction, is an interesting technique to develop because of time-saving, inexpensive and less
Fig. 3. PCR products amplified at the various annealing temperature. Negative control was distilled water (lane 1). Whole blood of O/O genotype was amplified at 58, 60, 61 and 63 °C in reaction 1 (lanes 2–5, respectively) and reaction 2 (lanes 6–9, respectively) of the multiplex allele-specific PCR amplification. Whole blood of A/B genotype was amplified at 58, 60, 61 and 63 °C in reaction 1 (lanes 10–13, respectively) and reaction 2 (lanes 14–17, respectively) of the multiplex allele-specific PCR amplification.
4
Gene Reports 17 (2019) 100510
S. Chomean, et al.
Fig. 4. PCR products amplified with an additive solution. The whole blood of A/B genotype was assessed the B allele by amplifying in reaction 2 of multiplex allele-specific PCR amplification. Lane 1 was negative control. Lane 2 was directed whole blood amplification without an additive solution. A final concentration of each additive solution at 1, 1.5 and 3 M of betaine (lanes 3–5), at 2, 3 and 5% of DMSO (lanes 6–8), at 0.25, 0.5 and 1% of tween20 (lanes 9–11) and at 0.01, 0.05 and 0.1% of BSA (lanes 12–14) were analyzed, respectively.
DMSO, betaine, tween20 and Triton-X 100 has been used to increase the yield, specificity and consistency of PCR reactions (Nagai et al., 1998; Hikmah et al., 2011; Chaloemnon et al., 2016; Erfan et al., 2016). Some additives may have beneficial effects on some amplification depending on each combination of template and primers (Nagai et al., 1998; Hikmah et al., 2011). Also, the concentrations of each additive in the reactions were varied. The results revealed that 3 M of betaine gave the highest ABO*B.01 allele amplification which doesn't affect to another (Fig. 4). Since the betaine can enhance amplification of GC rich sequences by reducing Tm and secondary structure stability (Henke and Loening, 1998; Hikmah et al., 2011). Then, the whole blood, hair root and buccal cell from known six genotypes of ABO blood group were assessed the multiplex allele-specific PCR under optimal condition. Results demonstrated that multiplex allele-specific PCR method can be used to identify the six common genotypes of ABO blood group from whole blood, hair root and buccal cell (Fig. 5). It also showed high diagnostic potency in 30 volunteers which were consistent with the serological test. The phenotypes of all samples are in the range of the incidence of ABO blood group in Thailand, as report previously (Nathalang et al., 2001). Our study examined 3 SNP sites, namely, SNP 261(rs8176719), SNP
Table 2 Phenotype-genotype correlation of the developed multiplex allele-specific PCR amplification compared with standard test tube method for the six ABO genotyping in 30 volunteers. ABO phenotype
Numbers tested
A
7
B
9
AB O
1 13
ABO genotype
Numbers found
AA AO BB BO AB OO
1 6 1 8 1 13
297 (rs8176720) and SNP 803 (rs8176747) to determine 6 common genotypes. However, our result may lead to false-positive when used for ABO genotyping. For example, ABO*O02.01 (O03) allele that has no deletion at SNP261 is typed as ABO*A1.01, ABO*A1.02 and ABO*B.01, as well as ABO* cisAB.01 and ABO*O01.24 contain SNP 803 site, are typed as ABO*B.01. Although there is no report for variant alleles or allele frequencies in Thais population, our result suggests that cautionary steps should be taken before genotyping of ABO gene and others alleles or rare alleles should be conducted in a large population to find Fig. 5. Diagnostic potency of multiplex allele-specific PCR amplified from directed whole blood (A), hair root (B) and buccal cell (C). The six common ABO genotypes of O/O (lanes 3 and 4), A/B (lanes 5 and 6), A/O (land 7 and 8), A/A (lanes 9 and 10), B/ O (lanes 11 and 12) and B/B (lanes 13 and 14) were identified from the two tube reactions.
5
Gene Reports 17 (2019) 100510
S. Chomean, et al.
more information of allele frequency of ABO gene in Thailand.
phylogenetic network method. Genes & Genetic Systems 88, 382-382. Jain, A., Gupta, A., Malhotra, S., Marwaha, N., Sharma, R.R., 2017. An ABO blood grouping discrepancy: probable B(A) phenotype. Transfus. Apher. Sci. 56, 459–460. Jiang, E.Z., Yu, P.F., Zhang, S.Y., Li, C.M., Ding, M., Wang, B.J., Pang, H., 2017. Establishment of an alternative efficiently genotyping strategy for human ABO gene. Legal Med-Tokyo 29, 72–76. Kensaku Aki, K.K., Izumi, A., Tada, T., Minakuchi, K., Hosoi, E., 2014. Direct determination of ABO blood group genotypes from whole blood using PCR-amplification of specific alleles method. American Journal of BioScience 2, 49–55. Kim, J.Y., Park, E.Y., Lee, H.J., 2017. The study of ABO genotyping for forensic application. Forens Sci Int-Gen S 6, E570–E572. Lee, J.C.I., Hsieh, H.M., Teng, H.F., Lo, S.C., Linacre, A., Tsai, L.C., 2009a. ABO genotyping by single strand conformation polymorphism - using CE. Electrophoresis 30, 2544–2548. Lee, S.H., Park, G., Yang, Y.G., Lee, S.G., Kim, S.W., 2009b. Rapid ABO genotyping using whole blood without DNA purification. Korean J Lab Med 29, 231–237. Meny, G.M., 2017. Recognizing and resolving ABO discrepancies. Immunohematology 33, 76–81. Mulvey, J.J., Matnani, R., Cushing, M.M., 2017. Historical ABO blood group discrepancy: a blessing in disguise to unravel a medical identity theft. Transfusion 57, 1096–1097. Nagai, M., Yoshida, A., Sato, N., 1998. Additive effects of bovine serum albumin, dithiothreitol, and glycerol on PCR. Biochem. Mol. Biol. Int. 44, 157–163. Nathalang, O., Kuvanont, S., Punyaprasiddhi, P., Tasaniyanonda, C., Sriphaisal, T., 2001. A preliminary study of the distribution of blood group systems in Thai blood donors determined by the gel test. Southeast Asian J Trop Med Public Health 32, 204–207. Prager, M., 2007. Molecular genetic blood group typing by the use of PCR-SSP technique. Transfusion 47 (1), 54S-9S. Prager, M., Scharberg, E.A., Wagner, F.F., Burkhart, J., Seltsam, A., 2007. ABO genotyping for diagnosis of unusual ABO blood groups: a comparative study in German blood donor centers. Transfusion 47, 144a–145a. Roubinet, F., Despiau, S., Calafell, F., Jin, F., Bertranpetit, J., Saitou, N., Blancher, A., 2004. Evolution of the O alleles of the human ABO blood group gene. Transfusion 44, 707–715. Sharma, R., Virdi, A.S., Singh, P., 2012. A novel method for whole blood PCR without pretreatment. Gene 501, 85–88. Taira, C., Matsuda, K., Takeichi, N., Furukawa, S., Sugano, M., Uehara, T., Okumura, N., Honda, T., 2018. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples. J. Clin. Lab. Anal. 32. Taki, T., Kibayashi, K., 2014. A simple ABO genotyping by PCR using sequence-specific primers with mismatched nucleotides. Legal Med-Tokyo 16, 168–172. Watanabe, K., Ikegaya, H., Hirayama, K., Motani, H., Iwase, H., Kaneko, H., Fukushima, H., Akutsu, T., Sakurada, K., 2011. A novel method for ABO genotyping using a DNA chip. J. Forensic Sci. 56, S183–S187. Watanabe, K., Hosoya, M., Hirayama, K., Saitoh, H., Iwase, H., Ikegaya, H., Akutsu, T., Sekiguchi, K., Sakurada, K., 2013. Forensic validation of the modified ABO genotyping method using a DNA chip. Legal Med-Tokyo 15, 222–225. Wheeler, T.W., Waikel, R.L., 2010. ABO blood group genotyping by PCR-RFLP. FASEB J. 24. Wu, P.C., Lin, Y.H., Tsai, L.F., Chen, M.H., Chen, P.L., Pai, S.C., 2018. ABO genotyping with next-generation sequencing to resolve heterogeneity in donors with serology discrepancies. Transfusion 58, 2232–2242. Yaku, H., Yukimasa, T., Nakano, S.I., Sugimoto, N., Oka, H., 2008. Design of allele-specific primers and detection of the human ABO genotyping to avoid the pseudopositive problem. Electrophoresis 29, 4130–4140. Zhang, C., Zhu, J., Yang, J., Wan, Y., Ma, T., Cui, Y., 2015. Determination of ABO blood group genotypes using the realtime loopmediated isothermal amplification method. Mol. Med. Rep. 12, 5963–5966.
5. Conclusion Identification of ABO genotypes is essential to use in cases of an ABO discrepancy between cell typing and serum typing as well as in forensic practices. In this study, the multiplex allele-specific PCR amplification was developed to differentiate the six common ABO genotypes based on two tubes reaction. This method showed a high diagnostic ability to genotype the ABO blood group from directly whole blood and non-invasive samples such as hair root and buccal cell. A simple, rapid and cost-effective method allows the multiplex allelespecific PCR method to be used in the clinical laboratory for safe blood transfusion and forensic application for personal identification and paternity testing. Declaration of competing interest The authors declare that they have no conflict of interest. Acknowledgments The authors gratefully acknowledge the financial support provided by Thammasat University Research Fund under the TU Research Center Scholar, Contract No. 2/51/2559. References Bakanay, S.M., Ozturk, A., Ileri, T., Ince, E., Yavasoglu, S., Akar, N., Uysal, Z., Arslan, O., 2013. Blood group genotyping in multi-transfused patients. Transfus. Apher. Sci. 48, 257–261. Bugert, P., Rink, G., Kemp, K., Kluter, H., 2012. Blood group ABO genotyping in paternity testing. Transfus Med Hemoth 39, 182–186. Chaloemnon, P., Chomnawang, M.T., Junlapho, W., Paraksa, N., 2016. Application of real-time PCR for quantifying gastrointestinal microbiota in weaning pigs influenced by dietary feed additive supplementation. Thai J Vet Med 46, 23–32. Erfan, A.M., Kilany, W.H., Hassan, M.K., 2016. Assessing the enhancing effect of some PCR additives in the diagnosis of avian influenza (H5) and Marek’s disease viruses. Res J Pharm Biol Che 7, 450–458. Flegel, W.A., 2013. ABO genotyping: the quest for clinical applications. Blood TransfusItaly 11, 6–9. Henke, W., Loening, S.A., 1998. Recently, betaine has been introduced as an additive in different PCR strategies. Nucleic Acids Res. 26, 687. Hikmah, E.M., Ankathil, R., Peng, H.B., Zilfalil, B.A., 2011. Addition of low-cost additives improves real time PCR assay of GC rich FMR1 region utilizing Taqman probe. Int Med J 18, 272–274. Huh, J.Y., Park, G., Jang, S.J., Moon, D.S., Park, Y.J., 2011. A rapid long PCR-direct sequencing analysis for ABO genotyping. Ann. Clin. Lab. Sci. 41, 340–345. Ito, M., Sato, M., Kitano, T., 2013. A study of the human ABO blood group genes by the
6
Contents lists available at ScienceDirect
Gene Reports journal homepage: www.elsevier.com/locate/genrep
Direct multiplex allele-specific PCR amplification for ABO genotyping from whole blood, hair root and buccal cell
T
⁎
Sirinart Chomeana, , Maysinee Prasarnjittb, Chutiphan Lapwonganana, Patchareerat Wongisaraphaba, Chollanot Kaseta,b a b
Department of Medical Technology, Faculty of Allied Health Sciences, Thammasat University, Thailand Department of Forensic Sciences, Faculty of Allied Health Sciences, Thammasat University, Thailand
A R T I C LE I N FO
A B S T R A C T
Keywords: ABO genotyping Buccal cell Direct PCR amplification Hair root Non-invasion detection Whole blood
Background: ABO genotyping is an increasingly being used for accurate prediction of blood transfusion, organ transplantation and forensic application. Traditional methods require DNA extract and purification which is time-consuming labor-intensive and limit the trace samples detection. Methods: Present study developed the multiplex allele-specific polymerase chain reaction (AS-PCR) method to identify the six major genotypes of ABO blood groups in two tubes reaction. The samples of whole blood, buccal cell and hair root from 30 volunteers were examined. Results: All genotyping results were interpreted and agreed with the serologic findings. The modified AS-PCR method was able to determine ABO genotyping using direct blood and non-invasive samples including buccal cell and hair root. Conclusions: The modified technique has a high specific and sensitive, rapid and cost-efficiency of genotyping method which might be valuable for transfusion medicine in a clinical laboratory and personal identification in forensic investigation.
1. Introduction Genetic analysis of the ABO blood group has become essential in both blood transfusion and organ transplantation and is used as one of the markers for personal identification in a forensic application (Prager et al., 2007; Bugert et al., 2012; Flegel, 2013; Kim et al., 2017). The routine examinations used serological ABO typing method based on red blood cells agglutination reaction against specific antisera. However, the serological typing methods show ambiguous results causing the ABO discrepancies such as massive transfusion, unexpected autoantibodies and alloantibodies (Jain et al., 2017; Meny, 2017; Mulvey et al., 2017). In recent years, many studies have turned attention to molecular typing methods. ABO genotyping is now commonly used in cases of an ABO discrepancy between cell typing and serum typing, especially in forensic practices for personal identification and paternity testing. Gene of ABO blood group is located on chromosome 9 (9q34.1–9q34.2) which contains 7 exons spanning over 18–20 kilobase (kb) pairs (Roubinet et al., 2004; Wheeler and Waikel, 2010; Huh et al.,
2011; Ito et al., 2013; Kensaku Aki et al., 2014). Analysis of the ABO gene can be classified into 6 common genotypes (A/A, A/O, B/B, B/O, O/O, and A/B) (Lee et al., 2009b; Wheeler and Waikel, 2010; Huh et al., 2011; Kensaku Aki et al., 2014; Zhang et al., 2015). Many PCR based methods have been developed including restriction fragment length polymorphism (RFLP) (Wheeler and Waikel, 2010), sequence-specific primer (SSP) (Prager, 2007), single-strand conformation polymorphism (SSCP) (Lee et al., 2009a), high-resolution melting (HRM) analysis (Jiang et al., 2017), DNA sequencing (Huh et al., 2011; Wu et al., 2018) and DNA chip (Watanabe et al., 2011; Watanabe et al., 2013). These methods often cause pseudo-positive from mispriming amplification and also require 2 step procedures (Yaku et al., 2008; Lee et al., 2009b; Huh et al., 2011). To improve the specificity of primer annealing, the allele-specific (AS) based on PCR amplification was proposed (Yaku et al., 2008; Lee et al., 2009b). However, the DNA extraction and purification are necessary before the PCR process because blood, tissue or secretory samples contain various substances to inhibit PCR. Likewise, the extraction process needs the proper sample volume and
Abbreviations: AS-PCR, allele-specific PCR amplification; bp, base pair; EDTA, ethylenediaminetetraacetic acid; HGH, human growth hormone; HRM, high-resolution melting; kb, kilobases; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism; SSCP, single-strand conformation polymorphism; SSP, sequence-specific primer ⁎ Corresponding author. E-mail address: [email protected] (S. Chomean). https://doi.org/10.1016/j.genrep.2019.100510 Received 5 July 2019; Received in revised form 12 September 2019; Accepted 13 September 2019 Available online 18 October 2019 2452-0144/ © 2019 Elsevier Inc. All rights reserved.
Gene Reports 17 (2019) 100510
For direct multiplex allele-specific PCR amplification, various PCR buffer were evaluated including the 2× Green PCR Master Mix (biotechrabbit, Germany), 2× i-Taq PCR Master Mix (iNtRON Biotechnology, Korea) and 2× DreamTaq Green PCR Master Mix (Thermo Fisher Scientific Inc., USA). The reaction was performed in a final volume of 20 μl according to 2× of each PCR buffer, 5 μM of each primer and 2 μl of whole blood. Whole blood of O and AB group were 2
Target specificity
ABO*A1.01, ABO*A1.02, ABO*O.01.01(O1) ABO*O.01.01(O1), ABO*O.01.02(Ov) Human growth hormone (internal control) ABO*A1.01, ABO*A1.02, ABO*B.01 ABO*B.01 Human growth hormone (internal control) 164 205 434 205 381 434 CCATTGTCTGGGAGGGCcCA AGACCTCAATGTCCACAGTCACTCG GCAGTAGGAAGGATGTCCTCGTGtTA AGACCTCAATGTCCACAGTCACTCG TGCCTTCCCAACCATTCCCTTA CCACTCACGGATTTCTGTTGTGTTTC GCAGTAGGAAGGATGTCCTCGTGtTG AGACCTCAATGTCCACAGTCACTCG CCACTACTATGTCTTCACCGACCATCC CACCGACCCCCCGAAGAtCG TGCCTTCCCAACCATTCCCTTA CCACTCACGGATTTCTGTTGTGTTTC 2
2.3. Investigation of optimal condition for multiplex allele-specific PCR amplification
297A (rs8176720) R: int6 261A (rs8176720 (ΔG)) R: int6 HGH R: HGH 261G (rs8176719) R: int6 467C R: 803G (rs8176747) HGH R: HGH
The allele-specific primer set was modified from the previous report (Lee et al., 2009b) to identify the six common ABO genotypes into two PCR reactions (Table 1). The expected results of multiplex allele-specific PCR amplification were shown in Fig. 1. The six ABO genotypes (A/A, A/O, B/B, B/O, O/O, and A/B) were identified by multiplex allele-specific PCR using two reactions. The position of primer sequences at 3′ end relative to the cDNA sequence of ABO*A1.01 allele. The primers of human growth hormone (HGH) were used as internal control with product size 434 base pairs (bp). Reaction 1 was designed to differentiate ABO*O.01.01 and ABO*O.01.02 at the band of 205 bp. The ABO*O.01.01 also presented the band at 164 and 205 bp. While the reaction 2 was used to distinguish the ABO*B.01 at product size of 381 bp. For ABO*A1.01 and ABO*A1.02, the PCR product indicates DNA band at 164 bp and 205 bp in reactions 1 and 2, respectively.
F: F: F: F: F: F:
2.2. Primers for the six common ABO genotypes and the designed multiplex allele-specific PCR amplification
1
The study was reviewed and approved by the Ethics Committee of Thammasat University (COA No. 152/2559). Known samples of whole blood, hair root and buccal cell were collected to evaluate the six common ABO genotypes by multiplex allele-specific PCR amplification. To assess the identifying ability, thirty unknown samples of whole blood, hair root and buccal cell samples were received from a volunteer who signed an informed consent form to participate in the study. Whole blood was kept in ethylenediaminetetraacetic acid (EDTA) anticoagulant and separated the tubes for extracting the genomic DNA which was used as an experimental control. Genomic DNA was extracted using a PUREGENE@ Kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's protocol. The concentration and purity of extracted DNA were measured by UV–vis spectrophotometer using the absorbance at 260 and 280 nm. Extracted DNA and directed whole blood was kept at −20 °C and 4 °C, respectively until used. The 10 hair roots of each sample were stored in digestion buffer containing 50 mM Tris-HCl (pH 8.8), 0.5% Tween, 1 mM EDTA and 0.2 μg Proteinase K. The extracted hair root was incubated at 55 °C for 60 min and kept at −20 °C until used. Buccal cells were collected by swabbing the cells inside of the cheek with sterile cotton for 10 times after washing the mouth with sterile water. The buccal swab was proceeded similar to DNA extraction from the hair root.
Product size (bp)
2.1. Sample collection and preparation
Primer sequences (5′ ➔ 3′)
2. Materials and methods
Primer (reference SNP number)
extraction kit specify for each sample which does not suit for casework samples in forensic investigation. In this study, we attempted to develop the AS-PCR amplification for genotyping of ABO blood group from whole blood and non-invasive samples (buccal cell and hair root) without genomic DNA extraction. The two tubes reaction was created to identify the six common genotypes of the ABO blood group. The developed technique was a powerful ABO genotyping approach as a specific, simple, rapid and can be used as a screening method for personal identification.
Reaction
Table 1 Allele-specific primers sets to identify the six common genotypes by multiplex allele-specific PCR. The SNP site are shown underlined.The non-complementary nucleotides with the ABO*A1.01 allele template are shown in lower case.
S. Chomean, et al.
Gene Reports 17 (2019) 100510
S. Chomean, et al.
Fig. 1. Expected patterns of PCR product for the six common ABO genotypes by multiplex allele-specific PCR amplification. *Sample with ABO*O.01.01 genotype present the band at 164 bases pair (bp).
were compared to the serological tube test.
used as a positive control of O/O and A/B genotypes for assessing the optimal condition of multiplex allele-specific PCR amplification. The results were compared to the genomic DNA amplification. To prevent mispriming and pseudo-positive amplicons, the annealing temperature was varied at 58, 60, 61 and 63 °C for 30 s. Also, the additive solution was evaluated by adding 1, 1.5 and 3 M of betaine, 2, 3 and 5% of dimethyl sulfoxide (DMSO), 0.25, 0.5 and 1% of tween20 and 0.01, 0.05 and 0.1% of bovine serum albumin (BSA). The PCR amplification was carried out by a BIO-RAD T100 Thermocycler (Bio-Rad Laboratories Inc., USA) according to the initial denaturation at 95 °C for 5 min followed by 33 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and final extension at 72 °C for 5 min. All PCR products were verified by electrophoresis on 1.5% agarose gel stained with 0.5 μg/ml of ethidium bromide (EtBr) and observed under UV-transilluminator.
3. Results 3.1. Investigation of optimal condition for multiplex allele-specific PCR amplification Primer set of multiplex allele-specific PCR amplification for the six common ABO genotypes was designed into two reactions (Table 1). Known blood samples of O/O and A/B genotype were used to investigate the proper multiplex allele-specific PCR conditions. The amplified products from direct whole blood were compared to the extracted genomic DNA. The results showed that the optimal PCR buffer for direct blood amplifying was 2× i-taq PCR master mix (Fig. 2). All ABO alleles showed the intense band as expected size (Figs. 1 and 2). To reduced mispriming or pseudo-positive, the annealing temperature was determined. Fig. 3 showed the optimal annealing temperature was 60 °C since there were no ambiguous PCR products. Due to the faint band at 381 bp of ABO*B.01 allele, various additive solutions were investigated. The results found that betaine at a final concentration of 3 M can improve the ABO*B.01 allele amplification comparable to another (Fig. 4).
2.4. Evaluation of the six common ABO genotypes from whole blood, hair root and buccal cell The multiplex PCR of the six common ABO genotypes was evaluated in directed whole blood, hair root and buccal cell specimens. Two tubes of multiplex allele-specific PCR amplification were carried out using the two sets of primers (Table 1) according to the optimal condition. Briefly, PCR reaction was performed in a final volume of 20 μl containing 2× i-Taq PCR Master Mix (iNtRON Biotechnology, Korea), 5 μM of each primer, and 2 ul of each sample. The cycling conditions were an initial denaturation at 95 °C for 5 min, followed by 33 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s, and final extension was done at 72 °C for 5 min, followed by a quickly chill to 4 °C. The PCR products were analyzed by 1.5% agarose gel with 0.5 μg/ml of EtBr. Electrophoresis was visualized by UV-transilluminator.
3.2. Evaluation of the six common ABO genotypes from whole blood, hair root and buccal cell Known specimens of the six common genotypes were assessed the diagnostic potency of multiplex allele-specific PCR amplification under an optimal condition. The PCR products of the two tubes multiplex PCR amplified from direct blood, hair root and buccal cell were observed (Fig. 5A–C, respectively). It can be differentiated the O/O, A/B, A/O, A/ A, B/O and B/B genotypes by using the two tube PCR reactions (Fig. 5). The amplified products from whole blood, hair root and buccal cell showed similar results. Therefore, it can be indicated that the multiplex allele-specific PCR amplification can be used to identify the six common ABO genotypes from direct blood, hair root and buccal cell.
2.5. Casework application of the six common ABO genotypes by multiplex allele-specific PCR amplification Specimens of whole blood, hair root and buccal cell from 30 volunteers were collected and assessed the genotyping potency of multiplex allele-specific PCR amplification. Hair root and buccal cell were kept in the digestion buffer as above mentioned until tested. Results 3
Gene Reports 17 (2019) 100510
S. Chomean, et al.
Fig. 2. PCR products amplified in various PCR buffers. Lanes 2 to 7 were PCR products in reaction 1 while lanes 9 to 14 were reaction 2 of multiplex allele-specific PCR amplification. Lanes 1 and 8 were no template as a negative control of reactions 1 and 2, respectively. Genomic DNA of O/O genotype as a positive control was amplified by 2× Green PCR Master Mix (lane 2), 2× i-Taq PCR Master Mix (lane 3) and 2× DreamTaq Green PCR Master Mix (lane 4). Whole blood of O/O genotype was direct amplified by 2× Green PCR Master Mix (lane 5), 2× i-Taq PCR Master Mix (lane 6) and 2× DreamTaq Green PCR Master Mix (lane 7). Genomic DNA of A/O genotype as a positive control was amplified by 2× Green PCR Master Mix (lane 9), 2× i-Taq PCR Master Mix (lane 10) and 2× DreamTaq Green PCR Master Mix (lane 11). Whole blood of O/O genotype was direct amplified by 2× Green PCR Master Mix (lane 12), 2× i-Taq PCR Master Mix (lane 13) and 2× DreamTaq Green PCR Master Mix (lane 14).
sample volume needed. The whole blood, buccal cell and hair root can be used as a specimen for ABO genotyping (Lee et al., 2009b; Sharma et al., 2012; Kensaku Aki et al., 2014). Especially, buccal cell and hair root are non-invasive samples that prefer for collecting the specimen in many people. Also, these are one of most common forensic sample that could be used to link between a suspect and a crime scene (Bugert et al., 2012; Watanabe et al., 2013; Kim et al., 2017). Moreover, The ABO genotype can be used as a screening test for paternity investigation. The application of SNP typing in routine laboratory as paternity testing requires proof of the reliability and standardization of the procedure (Bugert et al., 2012). Besides, The use of blood group genotyping has been used to prevent the hemolytic disease of fetus and newborn (HDFN). Blood group genotyping is also helpful in identifying the accurate RBC phenotype of alloimmunized patients and patients who have positive direct antiglobulin test. The last decade, several studies have been reported to the benefit of blood group genotyping and transfusion of genotype-matched RBC units to prevent alloimmunization in multi-transfused patients since discrepancies between the genotyping and phenotyping are frequently detected (Bakanay et al., 2013) However, it is complicated to amplify the above samples directly due to it contains many inhibitory substances (Kensaku Aki et al., 2014). As a result, it can be inhibited the PCR amplification and caused invalid results. Nowadays, commercially available PCR kits can effectively neutralize inhibitory substances present in the blood (Kensaku Aki et al., 2014). Fig. 2 demonstrated that the 2× Green PCR master mix could be amplified all alleles from whole blood directly. It doesn't need a particular Tth DNA polymerase, pre-treatment by diluting the blood in distilled water or heat-treatment of the sample as previous study (Lee et al., 2009b; Kensaku Aki et al., 2014; Taki and Kibayashi, 2014). The optimal annealing temperature was determined to prevent the pseudo-positive or mispriming of the primers commonly occurs in multiplex PCR amplification (Lee et al., 2009b; Taki and Kibayashi, 2014). The suitable temperature for amplifying the six alleles was 60 °C (Fig. 3), which correspond to the Lee SH and coworker report (Lee et al., 2009b). However, the ABO*B.01 allele from reaction 2 showed a faint band (lane 12, Fig. 2); various PCR additives were evaluated. A variety of enhancing agents such as ammonium sulfate, formamide,
3.3. Casework application of the six common ABO genotypes by multiplex allele-specific PCR amplification The specimens from 30 healthy volunteers were analyzed the ABO genotype by multiplex allele-specific PCR amplification using two tube reactions. The six common ABO genotypes were differentiated by gel electrophoresis. Results from directed whole blood amplification corresponded to hair root and buccal cell. There were 13 samples (44%) of O/O genotype, 1 sample (3%) of A/B genotype, 6 samples (20%) of A/O genotype, 1 sample (3%) of A/A genotype, 8 samples (27%) of B/O genotype and 1 sample (3%) of B/B genotype. Additionally, the genotypic ability of multiplex allele-specific PCR amplification was 100% consistent with the serologic phenotypes (Table 2). Analysis of the diagnostic ability of the developed multiplex allele-specific PCR amplification illustrated that it was 100% sensitivity and specificity compared with conventional test tube method. 4. Discussion Many methods for ABO genotyping has been developed including the PCR-based method, restriction fragment length polymorphism (RFLP) analysis (Wheeler and Waikel, 2010), single-strand conformation polymorphism (Lee et al., 2009a), high-resolution melting (HRM) analysis (Jiang et al., 2017) and allele-specific primers (Lee et al., 2009b; Taira et al., 2018). All of these methods are labor-intensive, time-consuming and require a separate PCR reaction and separation step for typing after PCR method. Present study designed multiplex allele-specific PCR amplification to differentiate the six common genotypes into two tube reactions. The primers were modified according to the previous study (Lee et al., 2009b) for identifying the ABO*O.01.01 and ABO*O.01.02 allele in reaction 1 and ABO*B.01 allele in reaction 2 while ABO*A1.01 and ABO*A1.02 allele require both 2 reactions (Table 1). Interpretation pattern of the six ABO genotypes was shown in Fig. 1. Although multiplex allele-specific PCR method is simple and effective, it requires the extraction of DNA from specimens. Direct PCR amplification, without genomic DNA extraction, is an interesting technique to develop because of time-saving, inexpensive and less
Fig. 3. PCR products amplified at the various annealing temperature. Negative control was distilled water (lane 1). Whole blood of O/O genotype was amplified at 58, 60, 61 and 63 °C in reaction 1 (lanes 2–5, respectively) and reaction 2 (lanes 6–9, respectively) of the multiplex allele-specific PCR amplification. Whole blood of A/B genotype was amplified at 58, 60, 61 and 63 °C in reaction 1 (lanes 10–13, respectively) and reaction 2 (lanes 14–17, respectively) of the multiplex allele-specific PCR amplification.
4
Gene Reports 17 (2019) 100510
S. Chomean, et al.
Fig. 4. PCR products amplified with an additive solution. The whole blood of A/B genotype was assessed the B allele by amplifying in reaction 2 of multiplex allele-specific PCR amplification. Lane 1 was negative control. Lane 2 was directed whole blood amplification without an additive solution. A final concentration of each additive solution at 1, 1.5 and 3 M of betaine (lanes 3–5), at 2, 3 and 5% of DMSO (lanes 6–8), at 0.25, 0.5 and 1% of tween20 (lanes 9–11) and at 0.01, 0.05 and 0.1% of BSA (lanes 12–14) were analyzed, respectively.
DMSO, betaine, tween20 and Triton-X 100 has been used to increase the yield, specificity and consistency of PCR reactions (Nagai et al., 1998; Hikmah et al., 2011; Chaloemnon et al., 2016; Erfan et al., 2016). Some additives may have beneficial effects on some amplification depending on each combination of template and primers (Nagai et al., 1998; Hikmah et al., 2011). Also, the concentrations of each additive in the reactions were varied. The results revealed that 3 M of betaine gave the highest ABO*B.01 allele amplification which doesn't affect to another (Fig. 4). Since the betaine can enhance amplification of GC rich sequences by reducing Tm and secondary structure stability (Henke and Loening, 1998; Hikmah et al., 2011). Then, the whole blood, hair root and buccal cell from known six genotypes of ABO blood group were assessed the multiplex allele-specific PCR under optimal condition. Results demonstrated that multiplex allele-specific PCR method can be used to identify the six common genotypes of ABO blood group from whole blood, hair root and buccal cell (Fig. 5). It also showed high diagnostic potency in 30 volunteers which were consistent with the serological test. The phenotypes of all samples are in the range of the incidence of ABO blood group in Thailand, as report previously (Nathalang et al., 2001). Our study examined 3 SNP sites, namely, SNP 261(rs8176719), SNP
Table 2 Phenotype-genotype correlation of the developed multiplex allele-specific PCR amplification compared with standard test tube method for the six ABO genotyping in 30 volunteers. ABO phenotype
Numbers tested
A
7
B
9
AB O
1 13
ABO genotype
Numbers found
AA AO BB BO AB OO
1 6 1 8 1 13
297 (rs8176720) and SNP 803 (rs8176747) to determine 6 common genotypes. However, our result may lead to false-positive when used for ABO genotyping. For example, ABO*O02.01 (O03) allele that has no deletion at SNP261 is typed as ABO*A1.01, ABO*A1.02 and ABO*B.01, as well as ABO* cisAB.01 and ABO*O01.24 contain SNP 803 site, are typed as ABO*B.01. Although there is no report for variant alleles or allele frequencies in Thais population, our result suggests that cautionary steps should be taken before genotyping of ABO gene and others alleles or rare alleles should be conducted in a large population to find Fig. 5. Diagnostic potency of multiplex allele-specific PCR amplified from directed whole blood (A), hair root (B) and buccal cell (C). The six common ABO genotypes of O/O (lanes 3 and 4), A/B (lanes 5 and 6), A/O (land 7 and 8), A/A (lanes 9 and 10), B/ O (lanes 11 and 12) and B/B (lanes 13 and 14) were identified from the two tube reactions.
5
Gene Reports 17 (2019) 100510
S. Chomean, et al.
more information of allele frequency of ABO gene in Thailand.
phylogenetic network method. Genes & Genetic Systems 88, 382-382. Jain, A., Gupta, A., Malhotra, S., Marwaha, N., Sharma, R.R., 2017. An ABO blood grouping discrepancy: probable B(A) phenotype. Transfus. Apher. Sci. 56, 459–460. Jiang, E.Z., Yu, P.F., Zhang, S.Y., Li, C.M., Ding, M., Wang, B.J., Pang, H., 2017. Establishment of an alternative efficiently genotyping strategy for human ABO gene. Legal Med-Tokyo 29, 72–76. Kensaku Aki, K.K., Izumi, A., Tada, T., Minakuchi, K., Hosoi, E., 2014. Direct determination of ABO blood group genotypes from whole blood using PCR-amplification of specific alleles method. American Journal of BioScience 2, 49–55. Kim, J.Y., Park, E.Y., Lee, H.J., 2017. The study of ABO genotyping for forensic application. Forens Sci Int-Gen S 6, E570–E572. Lee, J.C.I., Hsieh, H.M., Teng, H.F., Lo, S.C., Linacre, A., Tsai, L.C., 2009a. ABO genotyping by single strand conformation polymorphism - using CE. Electrophoresis 30, 2544–2548. Lee, S.H., Park, G., Yang, Y.G., Lee, S.G., Kim, S.W., 2009b. Rapid ABO genotyping using whole blood without DNA purification. Korean J Lab Med 29, 231–237. Meny, G.M., 2017. Recognizing and resolving ABO discrepancies. Immunohematology 33, 76–81. Mulvey, J.J., Matnani, R., Cushing, M.M., 2017. Historical ABO blood group discrepancy: a blessing in disguise to unravel a medical identity theft. Transfusion 57, 1096–1097. Nagai, M., Yoshida, A., Sato, N., 1998. Additive effects of bovine serum albumin, dithiothreitol, and glycerol on PCR. Biochem. Mol. Biol. Int. 44, 157–163. Nathalang, O., Kuvanont, S., Punyaprasiddhi, P., Tasaniyanonda, C., Sriphaisal, T., 2001. A preliminary study of the distribution of blood group systems in Thai blood donors determined by the gel test. Southeast Asian J Trop Med Public Health 32, 204–207. Prager, M., 2007. Molecular genetic blood group typing by the use of PCR-SSP technique. Transfusion 47 (1), 54S-9S. Prager, M., Scharberg, E.A., Wagner, F.F., Burkhart, J., Seltsam, A., 2007. ABO genotyping for diagnosis of unusual ABO blood groups: a comparative study in German blood donor centers. Transfusion 47, 144a–145a. Roubinet, F., Despiau, S., Calafell, F., Jin, F., Bertranpetit, J., Saitou, N., Blancher, A., 2004. Evolution of the O alleles of the human ABO blood group gene. Transfusion 44, 707–715. Sharma, R., Virdi, A.S., Singh, P., 2012. A novel method for whole blood PCR without pretreatment. Gene 501, 85–88. Taira, C., Matsuda, K., Takeichi, N., Furukawa, S., Sugano, M., Uehara, T., Okumura, N., Honda, T., 2018. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples. J. Clin. Lab. Anal. 32. Taki, T., Kibayashi, K., 2014. A simple ABO genotyping by PCR using sequence-specific primers with mismatched nucleotides. Legal Med-Tokyo 16, 168–172. Watanabe, K., Ikegaya, H., Hirayama, K., Motani, H., Iwase, H., Kaneko, H., Fukushima, H., Akutsu, T., Sakurada, K., 2011. A novel method for ABO genotyping using a DNA chip. J. Forensic Sci. 56, S183–S187. Watanabe, K., Hosoya, M., Hirayama, K., Saitoh, H., Iwase, H., Ikegaya, H., Akutsu, T., Sekiguchi, K., Sakurada, K., 2013. Forensic validation of the modified ABO genotyping method using a DNA chip. Legal Med-Tokyo 15, 222–225. Wheeler, T.W., Waikel, R.L., 2010. ABO blood group genotyping by PCR-RFLP. FASEB J. 24. Wu, P.C., Lin, Y.H., Tsai, L.F., Chen, M.H., Chen, P.L., Pai, S.C., 2018. ABO genotyping with next-generation sequencing to resolve heterogeneity in donors with serology discrepancies. Transfusion 58, 2232–2242. Yaku, H., Yukimasa, T., Nakano, S.I., Sugimoto, N., Oka, H., 2008. Design of allele-specific primers and detection of the human ABO genotyping to avoid the pseudopositive problem. Electrophoresis 29, 4130–4140. Zhang, C., Zhu, J., Yang, J., Wan, Y., Ma, T., Cui, Y., 2015. Determination of ABO blood group genotypes using the realtime loopmediated isothermal amplification method. Mol. Med. Rep. 12, 5963–5966.
5. Conclusion Identification of ABO genotypes is essential to use in cases of an ABO discrepancy between cell typing and serum typing as well as in forensic practices. In this study, the multiplex allele-specific PCR amplification was developed to differentiate the six common ABO genotypes based on two tubes reaction. This method showed a high diagnostic ability to genotype the ABO blood group from directly whole blood and non-invasive samples such as hair root and buccal cell. A simple, rapid and cost-effective method allows the multiplex allelespecific PCR method to be used in the clinical laboratory for safe blood transfusion and forensic application for personal identification and paternity testing. Declaration of competing interest The authors declare that they have no conflict of interest. Acknowledgments The authors gratefully acknowledge the financial support provided by Thammasat University Research Fund under the TU Research Center Scholar, Contract No. 2/51/2559. References Bakanay, S.M., Ozturk, A., Ileri, T., Ince, E., Yavasoglu, S., Akar, N., Uysal, Z., Arslan, O., 2013. Blood group genotyping in multi-transfused patients. Transfus. Apher. Sci. 48, 257–261. Bugert, P., Rink, G., Kemp, K., Kluter, H., 2012. Blood group ABO genotyping in paternity testing. Transfus Med Hemoth 39, 182–186. Chaloemnon, P., Chomnawang, M.T., Junlapho, W., Paraksa, N., 2016. Application of real-time PCR for quantifying gastrointestinal microbiota in weaning pigs influenced by dietary feed additive supplementation. Thai J Vet Med 46, 23–32. Erfan, A.M., Kilany, W.H., Hassan, M.K., 2016. Assessing the enhancing effect of some PCR additives in the diagnosis of avian influenza (H5) and Marek’s disease viruses. Res J Pharm Biol Che 7, 450–458. Flegel, W.A., 2013. ABO genotyping: the quest for clinical applications. Blood TransfusItaly 11, 6–9. Henke, W., Loening, S.A., 1998. Recently, betaine has been introduced as an additive in different PCR strategies. Nucleic Acids Res. 26, 687. Hikmah, E.M., Ankathil, R., Peng, H.B., Zilfalil, B.A., 2011. Addition of low-cost additives improves real time PCR assay of GC rich FMR1 region utilizing Taqman probe. Int Med J 18, 272–274. Huh, J.Y., Park, G., Jang, S.J., Moon, D.S., Park, Y.J., 2011. A rapid long PCR-direct sequencing analysis for ABO genotyping. Ann. Clin. Lab. Sci. 41, 340–345. Ito, M., Sato, M., Kitano, T., 2013. A study of the human ABO blood group genes by the
6