Distinct changes in chronic pain sensitivity and oxytocin receptor expression in a new rat model (Wisket) of schizophrenia

Journal Pre-proof Distinct changes in chronic pain sensitivity and oxytocin receptor expression in a new rat model (Wisket) of schizophrenia ´ o´ Banki, Alexandra Buki, Laszl ¨ Gyongyi Horvath, Gabriella Kekesi, ´ Gabor ´ ´ Laszlo ´ ´ Gyongyi Kis, Ferenc Somogyvari, Jancso, Vecsei, Endre Varga, Gabor Tuboly

PII:

S0304-3940(19)30664-0

DOI:

https://doi.org/10.1016/j.neulet.2019.134561

Reference:

NSL 134561

To appear in:

Neuroscience Letters

Received Date:

4 April 2019

Revised Date:

11 October 2019

Accepted Date:

13 October 2019

´ F, Jancso´ Please cite this article as: Banki L, Buki ¨ A, Horvath G, Kekesi G, Kis G, Somogyvari ´ G, Vecsei L, Varga E, Tuboly G, Distinct changes in chronic pain sensitivity and oxytocin receptor expression in a new rat model (Wisket) of schizophrenia, Neuroscience Letters (2019), doi: https://doi.org/10.1016/j.neulet.2019.134561

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

1 Distinct changes in chronic pain sensitivity and oxytocin receptor expression in a new rat model (Wisket) of schizophrenia László Bankia, Alexandra Bükib, Gyongyi Horvathb, Gabriella Kekesib, Gyongyi Kisb, Ferenc

a

Department of Traumatology, Faculty of Medicine, University of Szeged, Szeged, Hungary

b

Department of Physiology, Faculty of Medicine, University of Szeged, Szeged, Hungary

c

ro

Department of Medical Microbiology and Immunbiology, Faculty of Medicine, University of

Szeged, Szeged, Hungary d

Department of Neurology, Faculty of Medicine, University of Szeged, Szeged, Hungary

e

-p

MTA-SZTE Neuroscience Research Group

re

Author for correspondence: Gabor Tuboly

H-6725 Szeged, 6 Semmelweis Str., Hungary Tel: +36-62-544971

ur na

Fax: +36-62-545842

lP

Department of Neurology Faculty of Medicine, University of Szeged

e-mail: [email protected]

Highlights Schizophrenia-like animals (Wisket) displayed decreased chronic pain sensitivity. The opioid ligands preserved their antinociceptive effects in the Wisket animals. The Wisket animals had impaired oxytocin gene expression in several brain areas.

Jo

of

Somogyváric, Gábor Jancsób, Lászlo Vécseid,e, Endre Vargaa, Gabor Tubolyd

Impaired antinociceptive systems are not inevitably matched with hyperalgesia.

2

Abstract Clinical studies have shown that schizophrenia is accompanied by hypoalgesia. Accordingly, we have previously reported that a chronic schizophrenia-related rat substrain (Wisket) showed

mechanical pain sensitivity and the effects of opioid ligands in a chronic osteoarthritic pain model generated using Wisket rats. Our previous molecular biological studies indicated that the

ro

impairment in opioid and cannabinoid receptor functions observed in these animals did not

of

decreased acute heat pain sensitivity. The aim of the present study was to determine the

explain their altered pain sensitivity. Therefore, we aimed to investigate another endogenous

antinociceptive system, i.e., the oxytocinergic system (which is also implicated in schizophrenia)

-p

via the determination the brain-region specific oxytocin receptor mRNA expression in Wisket

rats. Osteoarthritis was induced in male adult control Wistar rats without any interventions and in

Wisket rats after juvenile social isolation and ketamine treatment. The degree of allodynia and the

re

effects of systemic morphine or intrathecal endomorphin-1 administration were determined. Furthermore, the expression of the oxytocin receptor mRNA was assessed in different brain

structures (prefrontal cortex, striatum, diencephalon, brainstem, and olfactory bulb). A lower

lP

degree of allodynia was observed in the Wisket group compared with control animals 1 and 2 weeks after the induction of osteoarthritis, which was accompanied by a comparable degree of edema. Systemically or intrathecally applied opioids caused similar time-response curves in both

ur na

groups, with apparently shorter effects in Wisket animals. The expression of the oxytocin receptor mRNA was lower in most of the brain regions (with the exception of the diencephalon) investigated in Wisket rats vs. the control animals. In summary, both acute and chronic hypoalgesia (as nonspecific symptoms in patients with schizophrenia) can be simulated in Wisket animals as endophenotypes despite the impairment of the endogenous antinociceptive systems evaluated. Thus, this model might be an appropriate tool for further investigation of the

Jo

molecular basis of altered pain perception in schizophrenia.

Keywords: allodynia; nociception; osteoarthritis; oxytocin receptor; rat; schizophrenia

3 1

Introduction

Schizophrenia is a heterogeneous disorder characterized by a high variability in symptomatology. In addition to the symptom domains (positive, negative, and cognitive), many patients with

schizophrenia have been used to simulate hypoalgesia. Ketamine treatment, social isolation, and prenatal or neonatal interventions produce changes in acute and/or inflammatory heat pain sensitivity in adult rats [3-5]. This polygenetic disorder is associated with environmental

ro

vulnerability factors; therefore, a new rat substrain was derived using a “multiple hit” method to

of

schizophrenia are less sensitive to pain than other individuals [1,2]. Some animal models of

ensure the constructive validity of the schizophrenia model [6-9]. The substrain was named

-p

Wisket, as the original strain used was Wistar and the selective breeding was based on behavioral alterations after the combination of postweaning isolation rearing and subchronic ketamine

treatment. These animals exhibit disturbances in sensory gating, acute heat pain sensitivity,

re

various types of cognitive and autonomic dysfunction, social behavior, and altered auditory

evoked potentials, which reinforce the validity of the model in several aspects [6-11]. Acute and persistent pain states have a distinct neurochemistry [12]; therefore, the results of tests of acute

lP

pain should be considered with caution. Few schizophrenia animal studies have investigated chronic pain sensitivity, with controversial results [13,14]. Thus, our primary aims were to characterize mechanical allodynia and the effects of the systemic or spinal administration of opioids in schizophrenia-related Wisket rats during chronic osteoarthritis.

ur na

Dysfunction of multiple neurotransmitter systems, including the dopamine, glutamate, serotonin, acetylcholine, GABA, and oxytocin systems, has been implicated in the pathophysiology of schizophrenia [15-19]. Recently, we showed that the binding affinities and the receptor activation of two endogenous antinociceptive systems, i.e., the opioid and cannabinoid pathways, were significantly impaired in different brain regions of Wisket rats [20,21]; however, these alterations did not explain the alterations in pain sensitivity observed in these animals. Thus, to identify the common pathway that underlies the schizophrenia-related

Jo

specific symptoms and hypoalgesia, we examined the oxytocinergic system as another important antinociceptive system. Pain induces oxytocin release and strongly upregulates the mRNA levels of oxytocin in different brain structures [22,26]. Moreover, the administration of oxytocin enhances the pain threshold [22-25]. Oxytocin is synthetized primarily in the supraoptic and

4 paraventricular nuclei of the hypothalamus and is released into the bloodstream to reach peripheral targets via the posterior pituitary gland; however, it also acts as a peptide neurotransmitter via direct projections into other brain areas [16]. In addition to its essential roles in parturition, milk letdown, and maternal behaviors, oxytocin is also involved in social activities [16,19]. The nonsocial functions of oxytocin in the brain, which include brain development,

Furthermore, oxytocin and the G-protein-coupled oxytocin receptor (OTR) have been localized in

[16-18,23,27].

ro

several brain regions associated with both pain sensation and schizophrenia-related symptoms

of

stress reactivity, anxiety, learning, and memory, have also received attention [19,24,28,29].

A moderate decrease in the mRNA levels of OTR in the temporal and prefrontal cortex has been reported in studies of post-mortem schizophrenia samples [30]. A few studies of

-p

schizophrenia-related animal models have also investigated the expression of the OTR mRNA in different brain structures, with controversial results [31-33]. Therefore, we aimed to determine

the expression of the OTR mRNA in different brain structures involved in schizophrenia and pain

re

transmission. As hypoalgesia is an endophenotype of Wisket animals [6-11,20,21] and previous investigations of the opioid and cannabinoid receptor functions were performed in rats without

any treatment [20,21], we planned to determine the expression of the OTR mRNA in the different

lP

brain structures of separate groups of control and Wisket animals without the induction of osteoarthritis. The evaluation of Wisket rats in this respect may prove that, similar to patients with schizophrenia, hypoalgesia can occur even in the presence of impairment of several

2 2.1

ur na

antinociceptive systems.

Materials and methods Animals

Male Wistar (control, n = 29) and Wisket (n = 33) rats were used in this study. All experiments were carried out with the approval of the Hungarian Ethics Committee for Animal Research

Jo

(registration numbers I-74-114 and XIV/1248). The Wistar rats were purchased from the animal house of the Biological Research Centre, Szeged, Hungary; the Wisket rats were bred at our department. Animals were treated in accordance with the guidelines set by the Government of Hungary and EU Directive 2010/63EU for animal experiments. Animals were kept in a 12 h

Commented [A1]: Tip: Spaces Around Mathematical Operators: A space is usually inserted on either side of a mathematical operator. This is a stylistic preference followed by many style guides.

5 light/dark cycle under controlled temperature (22 ±1 °C). The experimental procedures were performed between 8:00 AM and 4:00 PM. 2.2

Drugs

The following drugs were used: ketamine (Calypsol; Gedeon Richter Plc., Budapest, Hungary),

Sigma Aldrich Ltd, Budapest, Hungary), morphine hydrochloride (Alkaloida, Tiszavasvari, Hungary), and endomorphin-1 (Sigma Aldrich Ltd, Budapest, Hungary). All drugs were

ro

dissolved in or diluted with saline. Morphine (1 mg/kg) was administered subcutaneously at a dose of 2 ml/kg of body weight. Endomorphin-1 (5 µg) was injected intrathecally in a volume of

-p

10 µl, followed by an 8 µl flush of physiological saline within 60 s. 2.3

Interventions in Wisket rats and baseline behavioral tests in both groups

Similar to our previous studies, basal acute heat pain sensitivity was assessed in both control and

re

Wisket rats using the tail-flick (TF) test (48 °C hot water), after weaning at 3 weeks of age [6-

9,20,21]. Subsequently, the Wisket animals were housed individually for 28 days and treated with ketamine intraperitoneally (30 mg/kg, 4 mL/kg, daily, 5 times/week; 15 injections in total) from 5

lP

to 7 weeks of age. The animals were then re-housed (3 animals/cage), followed by 1 week of recovery with no treatment. No intervention was applied to the control animals. Starting at the age of 9 weeks, the animals underwent TF and sensory gating (prepulse inhibition (PPI)) tests, as described previously [6]. Briefly, after a 10 min habituation in Plexiglas 17

15.3 cm), rats were exposed to two different trial types: the pulse

ur na

startle chambers (12

alone (PA), in which a 40 ms 95 dB white noise burst was presented, and the prepulse–pulse (PP) pair, in which prepulse stimuli (20 ms, 76 dB) were followed by the startle stimulus with a latency of 150 ms. Both types of stimuli were applied 20 times in a random pattern. The interstimulus intervals ranged from 7 to 13 s. PPI was calculated as a percentage using the following equation: PPI (%) = [1 − (startle response for PP) / (startle response for PA)] × 100. MIA-induced osteoarthritis

Jo

2.4

of

xylazine (Rompun TS; Bayer AG, Leverkusen, Germany), monosodium iodoacetate (MIA;

At the age of 4 months, osteoarthritis was induced by injecting MIA (1 mg/30µL using a 27 G needle) into the tibiotarsal joint of one of the hind legs (7 Wistar and 11 Wisket rats), as described previously [34]. As these injections did not elicit signs of major distress, MIA was

6 administered to conscious, gently restrained animals without anesthesia, to avoid drug interactions. It has been shown that MIA causes severe end-stage cartilage destruction, resulting in prolonged osteoarthritis-like joint pain accompanied by moderate edema [34-36]. To determine the changes in the size of the inflamed joint, we measured the anteroposterior and mediolateral diameter of the paw at the level of the ankle joint using a digital caliper. The cross-section area b

π, where a and b are the radius in the two aspects. Body

weight and diameter of the ankle were determined before and at 7 and 14 days after MIA

2.5

ro

injection. Assessment of allodynia

The threshold for withdrawal from mechanical stimulation of the plantar aspect of the hind paw

-p

was assessed using a dynamic plantar esthesiometer (Ugo Basile, Comerio, Italy), which consists

of an elevated wire-mesh platform to allow access to the ventral surface of the hind paws. Prior to testing, rats were habituated to the testing box for at least 20 min. Measurements were performed

re

with a straight metal needle (diameter, 0.5 mm) that exerted an increasing upward force at a constant rate (6.25 g/s) with a maximum cut-off force of 50 g over an 8 s period. The

lP

measurement was stopped when the paw was withdrawn, and the results are expressed as pawwithdrawal thresholds in grams.

Mechanosensitivity was determined three times with a 15 min delay before the MIA injection (pre-MIA-value) and at 7 and 14 days after the MIA injection (post-MIA values); their

2.6

ur na

mean values were analyzed. Intrathecal catheterization

Two groups of Wistar and Wisket rats were anesthetized with a mixture of ketamine and xylazine (72 and 8 mg/kg intraperitoneally, respectively). An intrathecal catheter (PE-10 tubing) was inserted via the cistern magna and passed 8.5 cm caudally into the subarachnoid space [37], which serves to place the catheter tip between vertebrae Th12 and L2 corresponding to the spinal

Jo

segments that innervate the hind paws [38]. After surgery, the rats were housed individually and had free access to food and water. Rats exhibiting postoperative neurological deficits ( 10%) were excluded from the analyses. One day after the intrathecal catheterization, osteoarthritis was induced as described above.

of

was calculated using the formula a

7 2.7

Experimental paradigm for in vivo experiments

1st series: Mechanosensitivity was determined three times with a 15 min delay before the MIA injection (pre-MIA value) and at 7 and 14 days after the MIA injection (post-MIA values) in both Wistar (n = 7) and Wisket (n = 11) rats; their mean values were analyzed (Figure 1).

followed by the injection of morphine subcutaneously in both Wistar and Wisket animals (n = 9/group). The pain threshold was detected repeatedly every 15 min for a period of 120 min (Figure 1).

ro

3rd series: The post-MIA baseline value was established 2 weeks after the MIA injection. Endomorphin-1 was then injected intrathecally in both groups (n = 6/group) and the pain

2.8

-p

threshold was determined repeatedly every 15 min for a period of 90 min (Figure 1). In vitro experiments: expression of the OTR mRNA in brain structures

re

2.8.1 Tissue preparation At the age of 4 months, separate groups of animals (n = 7/group) without MIA treatment were terminated for the molecular biological study. The brain of the animals was removed, the

lP

olfactory bulb, prefrontal cortex (a coronal slice of 1.5 mm from each hemisphere), striatum, diencephalon, and brainstem were dissected immediately on dry ice, frozen in liquid nitrogen, and stored at –75 °C until the extraction of total RNA.

ur na

2.8.2 RNA extraction RNA extraction was carried out according to the instructions of the kit’s manufacturer. After homogenization of the tissue samples in TriXtractTM reagent (G-Biosciences), RNA content was separated into an aqueous phase by adding chloroform. Precipitation with isopropyl alcohol was followed by a wash with 70% ethanol. The RNA pellet was dissolved in RNase-free water. The quantity and quality of the extracted RNA were checked using a Genova Nano micro-volume spectrophotometer (Jenway) at an optical density of 260 and 260/280 nm, respectively. All

Jo

samples that were used for further analyses exhibited an absorbance ratio in the range of 1.6–2.0. Equal amounts of RNA were employed to synthetize cDNA in each experiment using the iScript cDNA synthesis kit (Bio-Rad).

of

2nd series: The post-MIA baseline value was established 2 weeks after the MIA injection,

8 2.8.3 Quantitative real-time polymerase chain reaction (qRT–PCR) qRT–PCR was used to detect the amount of the targeted mRNAs from rat brain tissues. PCR was carried out in 96-well microtitre plates using the iQ™ SYBR® Green Supermix (Bio-Rad) and specific primers to quantify the cDNA levels of various target genes. PCR was carried out in a 10 µL reaction volume (Table 1) in a thermocycler (Bio-Rad CFX96TM Optics Module) using the

the melting curves. The National Centre of Biotechnology Information reference sequence database (https://www.ncbi.nlm.nih.gov/Entrez) was used to design the primer pairs (Table 3)

ro

toward the 3 coding sequence. The primers were designed to have a Tm value of 58 ± 3 °C and

of

conditions listed in Table 2. The generation of specific products was confirmed by the analysis of

produce amplicons with a length of 100–150 bp. Expression of glyceraldehyde 3-phosphate

dehydrogenase (GAPDH) was determined as a housekeeping gene in the same set of samples, to

-p

be used as an international normalizer, and the threshold cycle (Ct) values were used as reference

points for the calculation of relative gene expression. All samples were analyzed in triplicate. The comparative Ct method, also known as the Δ∆Ct method [39], was implemented to achieve

re

relative quantification. For all data, 2–Δ∆Ct values were used to calculate fold changes in the

expression of the target gene. Data are presented as fold changes normalized to the values of the

2.9

Statistical analyses

lP

control group.

Behavioral data were analyzed using ANOVA. Data are expressed as means ± SEM. Post hoc comparisons were performed using Fisher’s LSD test. An unpaired t-test was used in the

ur na

molecular biological study to determine the differences in OTR mRNA expression between control and Wisket animals. Probabilities lower than 0.05 were considered significant. STATISTICA version 13.1 (Dell Inc., Round Rock, Texas, US) was used for the analyses.

3.1

Results

In vivo experiments

Jo

3

In agreement with the results of our recent studies [6-9], the Wisket rats showed significantly decreased acute heat pain sensitivity and impaired sensory gating. The model rats showed enhanced TF latency: repeated measures ANOVA revealed significant effects of group (F(1,16) = 21.32; P < 0.001), time (F(1,16) = 35.64; P < 0.001), and group and time interaction (F(1,16) =

9 24.31; P < 0.001), with significantly longer latencies in the Wisket rats at week 9 (5.3 ± 0.43 vs. 13.4 ± 1.28 s). The one-way ANOVA of the results of the prepulse inhibition (PPI) test revealed a significant effect of group (F(1,16) = 9.14; P < 0.01) with lower values in Wisket rats (82% ±

3.1.1 Results of the 1st series Regarding the body weight changes after MIA injection, a slight decrease was detected seven days after its administration; however, body weight increased in both groups in the second week

ro

without significant differences between the two groups. Repeated measures ANOVA showed significant differences only in time (F(2,32) = 10.24; P < 0.001; Figure 2A), which was caused by the significant weight gain observed on Day 14 in Wisket animals.

-p

Before the injection of MIA, there were no significant side-differences regarding the cross-

section area of the ankle (mean, 37.4 ± 0.34 mm2) and the mechanosensitivity (mean, 48.1 ± 0.44 g), independently of the group. In the non-injected side, no significant changes were detected

re

during the investigated period regarding these parameters (Figures 2B,C left side).

The cross-section area on the injected side increased significantly in both groups at both post-MIA investigations without significant differences between the two groups. Repeated

lP

measures ANOVA showed significant effects only of time (F(2,32) = 57.62; P < 0.001; Figure 2B, right side).

The mechanosensitivity on the injected side increased significantly in both groups at both post-MIA investigations, with a significantly higher threshold in the Wisket animals. Repeated

ur na

measures ANOVA showed significant effects of group (F(1,16) = 14.99; P < 0.01), time (F(2,32) = 113.82; P < 0.001), and their interaction (F(2,32) = 6.82; P < 0.01; Figure 2C, right side). The post hoc comparison revealed that no significant differences were present during the pre-MIA investigation, whereas both post-MIA values were higher in the Wisket group. 3.1.2 Results of the 2nd series Regarding the effect of morphine, a significant effect of time was observed (F(8,128) = 103.28; P

Jo

< 0.001; Fig. 3A). A post hoc comparison showed significant differences between the two groups only in the post-MIA baseline values. However, the comparisons between the post-MIA baseline and the post-morphine values showed significant effects of morphine up to 90 min in the Wistar group and up to 60 min in Wisket animals.

of

6.1% vs. 41% ± 10.2%).

10 3.1.3 Results of the 3rd series Similarly, after the spinal administration of endomorphin-1, a significant effect of time was observed (F(6,60) = 3.69; P < 0.005; Fig. 3B). A post hoc comparison showed that endomorhin-1 caused a significant enhancement in the pain threshold for 60 min only in the control animals. In vitro studies

The expression of the OTR mRNA significantly decreased in most of the investigated regions (olfactory bulb, prefrontal cortex, striatum, and diencephalon) of the Wisket animals, whereas it

4

ro

did not change in the brainstem of these rats compared with the naive samples (Figure 4).

of

3.2

Discussion

-p

This study showed that the new schizophrenia animal model (Wisket) displayed decreased

mechanical allodynia in a chronic osteoarthritis model. Systemically or intrathecally administered opioid ligands produced similar time-response curves in the two groups, with apparently shorter

re

effects in Wisket animals. These findings corroborate and strengthen the literature pertaining to the investigation of the alterations of pain perception in human patients with schizophrenia.

lP

Furthermore, the expression of the OTR gene was decreased in most of the brain regions investigated here; therefore, in addition to the opioid and cannabinoid receptors, the oxytocinergic system was also impaired in Wisket animals [20,21]. These data revealed that even in the presence of impaired endogenous antinociceptive systems, both acute and chronic pain

ur na

sensitivity might be decreased.

Patients with schizophrenia appear to have a diminished prevalence of pain as well as a lower pain intensity compared with healthy controls, which may result in unreported injuries and wounds, leading to further increases in the fiscal and emotional costs associated with this disorder [1,40-42]. However, some studies have reported increased or unchanged pain sensitivity [43]. Pain is a multidimensional experience that comprises sensory, emotional, cognitive, and motivational components, and the neural pathways that process these aspects might be differently

Jo

affected in schizophrenia [43]. A pain stimulus in these patients caused decreased activation in the pain affective–cognitive processing regions (posterior cingulate cortex and brainstem) as well as over-activation in the primary sensory–discriminative pain processing regions (somatosensory cortex) compared with the controls [40]. It is assumed that dysfunction of the frontal lobe in

11 schizophrenia may be involved in cognitive impairment and cause an excess of negative symptoms that affect the processing of the motivational–affective pain aspects, leading to changes in the expression of pain [44]. The MIA model has inflammatory and neuropathic components; therefore, it might be appropriate to simulate the human chronic pain states [45,46]. Our findings demonstrated the

which is consistent with the results of previous studies [34-36]. However, the high effectivity of low doses of opioids and the temporary blunting in the body weight gain observed in the two

ro

groups suggest a moderate pain level. Despite these findings, the similar degree of edema

of

presence of prolonged mechanical allodynia that persisted for 2 weeks after MIA administration,

detected in the two groups indicates comparable osteoarthritic changes, and the faster recovery of the weight gain observed in the Wisket group might have been caused by the decreased pain

-p

sensation in these animals. The chronic mechanical hyposensitivity detected in Wisket animals is in agreement with the results obtained after the chronic administration of phencyclidine, as

another model of schizophrenia, in a neuropathy model generated via tight ligation of spinal

re

nerves [13]. In the neonatal-brain-lesion model of schizophrenia, however, enhanced mechanical allodynia was detected in the model of neuropathy resulting from sciatic nerve ligation [14].

schizophrenia and/or the pain tests used.

lP

These contradictory results might be attributable to the differences between the models of

Modulation of nociceptive signals can occur within spinal circuits as well as from supraspinal sites through descending pathways. Both spinal and systemic application of opioids

ur na

produced a seemingly similar antinociception in the two groups. However, because of the higher post-MIA baseline values recorded in the Wisket group and/or ceiling effects, the post hoc comparisons showed less significant differences between the pre-and the post-opioid values in the Wisket animals, suggesting shorter effects of these ligands in this group. This might also have been caused by the disturbance of opioid receptor functions observed in these animals [20]. The interaction between oxytocin and several neurotransmitter systems can affect both pain sensitivity and the symptoms of schizophrenia [16-18,30]. A substantial amount of evidence has

Jo

proved that the oxytocin system may be dysregulated in patients with schizophrenia [1619,24,47].

While low plasma oxytocin levels correlate with the severity of negative symptoms [19,47], higher oxytocin plasma levels were associated with less-severe positive symptoms and better pro-

12 social functions in patients with schizophrenia [49]. Variations of oxytocin and OTR singlenucleotide polymorphisms have been implicated with the risk for schizophrenia and may contribute to symptom severity and treatment efficacy [16,18,19]. Few human studies have investigated the expression of the OTR gene, with contradictory results. Uhrig et al. found a trend toward the decrease in the expression of the OTR mRNA in temporal and prefrontal cortical areas

study, no significant differences were detected in the expression of OTR in the prefrontal cortex [50]. However, it should be mentioned that patients were treated with antipsychotic drugs, which

ro

may have influenced the results. Oxytocin as an adjunctive therapy lessens the severity of

symptoms, leading to increased cognitive and affective functions; it also decreases the positive symptoms in patients with schizophrenia [16-19,31,48].

-p

Several animal models of schizophrenia exhibit a disturbed oxytocinergic system [18,3133,48,51]. Chronic phencyclidine treatment did not modify OTR mRNA expression in the

investigated areas (ventromedial hypothalamus and central amygdala) [31]. In the early-life-stress

re

model of schizophrenia, enhanced OTR binding was detected in the hypothalamus, while it was decreased in the cortex and caudate putamen [51]. The expression of the OTR gene was significantly increased in the amygdala, whereas it was slightly decreased in the PFC and

lP

hypothalamus after chronic social instability stress [32]. Reelin haploinsufficient reeler mice, as another schizophrenia animal model, also exhibit decreased OTR levels in cortical areas and in the hippocampus [33]. Similar to that reported in the human studies, animal models of psychosis

ur na

have shown that oxytocin administration reduces dopaminergic hyperactivity in the striatum and nucleus accumbens and alleviates PPI deficits in a similar manner to antipsychotic medications [18].

Our study demonstrated that, in the Wisket rats, several important brain structures that are involved in both the schizophrenic symptoms and pain processes had reduced OTR mRNA expression. There is a set of brain regions that is consistently activated in response to experimental nociceptive stimulation, which include brainstem regions, the thalamus/hypothalamus, and the primary and secondary somatosensory and prefrontal cortices;

Jo

of

and in the nucleus caudatus in patients with schizophrenia [30]. In contrast, in a very recent

OTRs are expressed in all of these areas [23,27,52]. Oxytocin might be involved in the ascending transmission of nociceptive signals from the amygdala to the frontal region of the brain [23,27,52]. Its antinociceptive effects are considered to be the result of its interaction with the

13 dopaminergic and opioid systems [22,24,53]. The downregulation of the OTR gene may be involved in the decrease in endogenous opioid functions; however, how it leads to decreased allodynia cannot be gleaned from these data. In schizophrenia, the oxytocinergic system is also impaired in the olfactory bulb, which plays a significant role in the manifestation of several symptoms, including impaired social behavior [54,55]. These impairments in the expression of

Surprisingly, all of the receptor systems investigated showed decreased functional activity in Wisket animals.

ro

Based on the results of our study, it is not entirely clear how the decreased pain sensitivity

of

the OTR mRNA may also be involved in the altered social behavior of these animals [10].

detected in these animals is related to the impaired opioid, cannabinoid, and oxytocin receptor

function and/or expression [20,21]. One possibility is that the level of their endogenous ligands is

-p

enhanced in the brain. Alternatively, other endogenous antinociceptive systems might be

overactivated (e.g., cortisol) or endogenous pro-nociceptive systems (e.g., glutamate acting on

NMDA receptors) might be suppressed. Furthermore, it is not clear whether our findings extend

re

to the level of the expression of the OTR protein. Therefore, further investigations are required to identify these mechanisms.

a Wisket group without isolation housing and ketamine

lP

The lack of appropriate controls

treatment and a Wistar group with isolation housing and ketamine treatment

might be taken as a

limitation of this study; however, we contend that this is not an issue. In our previous articles, we provided ample evidence that, after the complex treatment, the new substrain has the highest

ur na

validity as a model of schizophrenia compared with the appropriate control groups [6]. Since then, we have concentrated on the characterization of this model [7-9,56], as this would hardly be in agreement with the 3Rs (Replacement, Reduction, and Refinement) of humane animal research.

Conclusion

To our knowledge, altered mechanical pain sensitivity to chronic arthritic pain was documented

Jo

for the first time in a schizophrenia-like rat substrain. The findings of the current study might open the door for translational research in this field. Moreover, the chronic osteoarthritic pain model in Wisket rats can be used to study the effects of different antipsychotic drugs on the pain threshold. Finally, this animal model may provide a tool for the investigation of the mechanisms

14 that might lead to hypoalgesia despite the impairment of endogenous antinociceptive (e.g., opioid, cannabinoid, and oxytocin) systems.

Acknowledgments This work was supported by the Hungarian Economic Development and Innovation Operational

of

Programme (GINOP 2.3.3-15-2016-00031). The skilled technical assistance of Ágnes Tandari is

Jo

ur na

lP

re

-p

ro

gratefully acknowledged.

15 References

[1] R.H. Dworkin, Pain insensitivity in schizophrenia: a neglected phenomenon and some

[2] T. Jochum, A. Letzsch, W. Greiner, G. Wagner, H. Sauer, K.J. Bar, Influence of antipsychotic medication on pain perception in schizophrenia, Psychiatry Res. 142

ro

(2006) 151-156. [3] G. Tuboly, G. Benedek, G. Horvath, Selective disturbance of pain sensitivity after social

-p

isolation, Physiol. Behav. 96 (2009) 18-22.

[4] A. Becker, G. Grecksch, H. Schroder, Pain sensitivity is altered in animals after

re

subchronic ketamine treatment, Psychopharmacology (Berl) 189 (2006) 237-247.

[5] G. Sandner, L. Meyer, M.J. Angst, B. Guignard, T. Guiberteau, A.G. Mensah-Nyagan, Neonatal ventral hippocampal lesions modify pain perception and evoked potentials in

lP

rats, Behav. Brain Res. 234 (2012) 167-174.

[6] Z. Petrovszki, G. Adam, G. Tuboly, G. Kekesi, G. Benedek, S. Keri, G. Horvath, Characterization of gene-environment interactions by behavioral profiling of selectively

ur na

bred rats: the effect of NMDA receptor inhibition and social isolation, Behav. Brain Res. 240 (2013) 134-145.

[7] G. Kekesi, Z. Petrovszki, G. Benedek, G. Horvath, Sex-specific alterations in behavioral and cognitive functions in a "three hit" animal model of schizophrenia, Behav. Brain Res. 284 (2015) 85-93.

[8] G. Horvath, Z. Petrovszki, G. Kekesi, G. Tuboly, B. Bodosi, J. Horvath, P. Gombkoto,

Jo

G. Benedek, A. Nagy, Electrophysiological alterations in a complex rat model of schizophrenia, Behav. Brain Res. 307 (2016) 65-72.

of

implications, Schizophr. Bull. 20 (1994) 235-248.

16 [9] G. Horvath, P. Liszli, G. Kekesi, A. Büki, G. Benedek, Characterization of exploratory activity and learning ability of healthy and "schizophrenia-like" rats in a square corridor system (AMBITUS), Physiol. Behav. 169 (2017) 155-164. [10] A. Büki, G. Horvath, G. Benedek, E. Ducza, G. Kekesi, Impaired GAD1 expression in

motivational deficit, Genes Brain Behav. (2018) e 12507. [11] A. Büki, G. Kalmar, G. Kekesi, G. Benedek, L.G. Nyul, G. Horvath, Impaired pupillary

ro

control in schizophrenia-like WISKET rats, Auton. Neurosci. 213 (2018) 34-42.

[12] A.I. Basbaum, Distinct neurochemical features of acute and persistent pain, Proc. Natl.

-p

Acad. Sci. USA 96 (1999) 7739-7743.

[13] J. Boyette-Davis, P.N. Fuchs, Chronic administration of phencyclidine produces

re

decreased sensitivity to mechanical stimulation in the absence of altered affective

behavior: implications for pain processing in schizophrenia, Neurosci. Lett. 498 (2011) 153-157.

lP

[14] M. Franek, S. Vaculin, A. Yamamotova, F. Stastny, V. Bubenikova-Valesova, R. Rokyta, Pain perception in neurodevelopmental animal models of schizophrenia, Physiol. Res. 59 (2010) 811-819.

ur na

[15] P.J. Harrison, D.R. Weinberger, Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence, Mol. Psychiatry 10 (2005) 40-68. [16] P.D. Shilling, D. Feifel, Potential of oxytocin in the treatment of schizophrenia, CNS Drugs 30 (2016) 193-208.

[17] M.E. Rich, H.K. Caldwell, A role for oxytocin in the etiology and treatment of

Jo

schizophrenia, Front. Endocrinol. 6 (2015) 1-14.

[18] C.F. Bartholomeusz, E.P. Ganella, I. Labuschagne, C. Bousman, C. Pantelis, Effects of oxytocin and genetic variants on brain and behaviour: implications for treatment in schizophrenia, Schizophr. Res. 168 (2015) 614-627.

of

schizophrenia-related WISKET rat model with sex-dependent aggressive behavior and

17 [19] D. Cochran, D. Fallon, M. Hill, J.A. Frazier, The role of oxytocin in psychiatric disorders: a review of biological and therapeutic research findings, Harv. Rev. Psychiatry 21 (2013) 219-247. [20] E. Szűcs, A. Büki, G. Kekesi, G. Horvath, S. Benyhe, Mu-Opioid (MOP) receptor

schizophrenia, Neurosci. Lett. 619 (2016) 29-33. [21] E. Szűcs, S. Dvorácskó, C. Tömböly, A. Büki, G. Kekesi, G. Horvath, S. Benyhe,

model of schizophrenia, Neurosci. Lett. 633 (2016) 87-93.

-p

[22] H.P. Yang, L. Wang, L. Han, S.C. Wang, Nonsocial functions of hypothalamic

ro

Decreased CB receptor binding and cannabinoid signaling in three brain regions of a rat

oxytocin, ISRN Neuroscience 2013 (2013) 1-13.

re

[23] L.M. Tracy, N. Georgiou-Karistianis, S.J. Gibson, M.J. Giummarra, Oxytocin and the modulation of pain experience: implications for chronic pain management, Neurosci. Biobehav. Rev. 55 (2015) 53-67.

lP

[24] R. Arletti, A. Benelli, A. Bertolini, Influence of oxytocin on nociception and morphine antinociception, Neuropeptides 24 (1993) 125-129.

[25] M. Zubrzycka, A. Janecka, Effect of tooth pulp stimulation on oxytocin and vasopressin

ur na

release into the cerebrospinal fluid and fluid perfusing the cerebral ventricles in rats, Endocr. Regul. 41 (2007) 149-154.

[26] M. Zubrzycka, J. Szemraj, A. Janecka, Effect of tooth pulp and periaqueductal central gray stimulation on the expression of genes encoding the selected neuropeptides and opioid receptors in the mesencephalon, hypothalamus and thalamus in rats, Brain Res.

Jo

1382 (2011) 19-28.

[27] D.A. Seminowicz, M. Moayedi, The dorsolateral prefrontal cortex in acute and chronic pain, J. Pain 18 (2017) 1027-1035.

of

mediated G-protein signaling is impaired in specific brain regions in a rat model of

18 [28] G.L. Kovacs, Z. Horvath, Z. Sarnyai, M. Faludi, G. Telegdy, Oxytocin and a C-terminal derivative (Z-prolyl-D-leucine) attenuate tolerance to and dependence on morphine and interact with dopaminergic neurotransmission in the mouse-brain, Neuropharmacology 24 (1985) 413-419.

Lenard, Positive reinforcing effect of oxytocin microinjection in the rat central nucleus of amygdala, Behav. Brain Res. 296 (2016) 279-285.

ro

[30] S. Uhrig, N. Hirth, L. Broccoli, M. von Wilmsdorff, M. Bauer, C. Sommer, M. Zink, J. Steiner, T. Frodl, B. Malchow, P. Falkai, R. Spanagel, A.C. Hansson, A. Schmitt,

Reduced oxytocin receptor gene expression and binding sites in different brain regions

-p

in schizophrenia: a post-mortem study, Schizophr. Res. 177 (2016) 59-66.

[31] P.R. Lee, D.L. Brady, R.A. Shapiro, D.M. Dorsa, J.I. Koenig, Social interaction deficits

re

caused by chronic phencyclidine administration are reversed by oxytocin, Neuropsychopharmacol. 30 (2005) 1883-1894.

lP

[32] M.M. Nowacka-Chmielewska, D. Kasprowska-Liskiewicz, J.J. Barski, E. Obuchowicz, A. Malecki, The behavioral and molecular evaluation of effects of social instability stress as a model of stress-related disorders in adult female rats, Stress 20 (2017) 549-

ur na

561.

[33] W. Liu, G.D. Pappas, S. Carter, Oxytocin receptors in brain cortical regions are reduced in haploinsufficient (+/-) reeler mice, Neurol. Res. 27 (2005) 339-345. [34] G. Kovacs, Z. Petrovszki, J.R. Mallareddy, G. Toth, G. Benedek, G. Horvath, Characterization of antinociceptive potency of endomorphin-2 derivatives with unnatural amino acids in rats, Acta Physiol. Hung. 99 (2012) 353-363.

Jo

[35] S.E. Bove, S.L. Calcaterra, R.M. Brooker, C.M. Huber, R.E. Guzman, P.L. Juneau, D.J. Schrier, K.S. Kilgore, Weight bearing as a measure of disease progression and efficacy of anti-inflammatory compounds in a model of monosodium iodoacetate-induced osteoarthritis, Osteoarthr. Cartil. 11 (2003) 821-830.

of

[29] K. Laszlo, A. Kovacs, O. Zagoracz, T. Ollmann, L. Peczely, E. Kertes, D.G. Lacy, L.

19 [36] R. Combe, S. Bramwell, M.J. Field, The monosodium iodoacetate model of osteoarthritis: a model of chronic nociceptive pain in rats?, Neurosci. Lett. 370 (2004) 236-240. [37] T.L. Yaksh, T.A. Rudy, Chronic catheterization of the spinal subarachnoid space,

[38] I. Dobos, K. Toth, G. Kekesi, G. Joo, E. Csullog, W. Klimscha, G. Benedek, G.

(2003) 487-492.

ro

Horvath, The significance of intrathecal catheter location in rats, Anesth. Analg. 96

[39] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time

-p

quantitative PCR and the 2-DDCT Method, Methods 25 (2001) 402-408.

[40] C. de la Fuente-Sandoval, R. Favila, D. Gomez-Martin, P. Leon-Ortiz, A. Graff-

re

Guerrero, Neural response to experimental heat pain in stable patients with schizophrenia, J. Psychiatr. Res. 46 (2012) 128-134.

[41] R. Blumensohn, D. Ringler, I. Eli, Pain perception in patients with schizophrenia, J.

lP

Nerv. Ment. Dis. 190 (2002) 481-483.

[42] B. Stubbs, T. Thompson, S. Acaster, D. Vancampfort, F. Gaughran, C.U. Correll, Decreased pain sensitivity among people with schizophrenia: a meta-analysis of

ur na

experimental pain induction studies, Pain 156 (2015) 2121-2131. [43] G. Engels, A.L. Francke, B. van Meijel, J.G. Douma, H. de Kam, W. Wesselink, W. Houtjes, E.J.A. Scherder, Clinical pain in schizophrenia: a systematic review, J. Pain 15 (2014) 457-467.

[44] R.S. El Mallakh, D. Garver, J.A. Holcomb, J.R. Wyatt, Post lumbar-puncture headaches in schizophrenic and psychiatrically normal control subjects, Schizophr. Res. 77 (2005)

Jo

of

Physiol. Behav. 17 (1976) 1031-1036.

111-112.

[45] Y. Kawarai, S. Orita, J. Nakamura, S. Miyamoto, M. Suzuki, K. Inage, S. Hagiwara, T. Suzuki, T. Nakajima, T. Akazawa, S. Ohtori, Changes in proinflammatory cytokines,

20 neuropeptides, and microglia in an animal model of monosodium iodoacetate-induced hip osteoarthritis, J. Orthopaed. Res. (2018). [46] J. Havelin, I. Imbert, J. Cormier, J. Allen, F. Porreca, T. King, Central sensitization and neuropathic features of ongoing pain in a rat model of advanced osteoarthritis, J. Pain

[47] S. Keri, I. Kiss, O. Kelemen, Sharing secrets: oxytocin and trust in schizophrenia, Social

[48] J. Qi, J.Y. Yang, M. Song, Y. Li, F. Wang, C.F. Wu, Inhibition by oxytocin of methamphetamine-induced hyperactivity related to dopamine turnover in the

ro

Neuroscience 4 (2009) 287-293.

-p

mesolimbic region in mice, Naunyn Schmiedebergs Arch. Pharmacol. 376 (2008) 441448.

re

[49] L.H. Rubin, C.S. Carter, L. Drogos, H. Pournajafi-Nazarloo, J.A. Sweeney, P.M. Maki, Peripheral oxytocin is associated with reduced symptom severity in schizophrenia, Schizophr. Res. 124 (2010) 13-21.

lP

[50] M.R. Lee, M.B. Sheskier, M. Farokhnia, N. Feng, S. Marenco, B.K. Lipska, L. Leggio, Oxytocin receptor mRNA expression in dorsolateral prefrontal cortex in major psychiatric disorders: A human post-mortem study, Psychoneuroendocrinol. 96 (2018)

ur na

143-147.

[51] M. Lukas, R. Bredewold, I.D. Neumann, A.H. Veenema, Maternal separation interferes with developmental changes in brain vasopressin and oxytocin receptor binding in male rats, Neuropharmacol. 58 (2010) 78-87.

[52] V. Mylius, J.J. Borckardt, J.P. Lefaucheur, Noninvasive cortical modulation of experimental pain, Pain 153 (2012) 1350-1363.

Jo

of

17 (2016) 374-382.

[53] T.M. Love, M.A. Enoch, C.A. Hodgkinson, M. Peciña, B. Mickey, R.A. Koeppe, C.S. Stohler, D. Goldman, J.K. Zubieta, Oxytocin gene polymorphisms influence human dopaminergic function in a sex-dependent manner, Biol. Psychiatry 72 (2012) 198-206.

21 [54] A.D. Nguyen, M.E. Shenton, J.J. Levitt, Olfactory dysfunction in schizophrenia: a review of neuroanatomy and psychophysiological measurements, Harv. Rev. Psychiatry 18 (2010) 279-292. [55] G.P. Strauss, W.R. Keller, J.I. Koenig, J.M. Gold, K.L. Ossenfort, R.W. Buchanan,

individuals with schizophrenia, Schizophr. Res. 162 (2015) 57-61. [56] G. Horvath, G. Kekesi, Z. Petrovszki, G. Benedek, Abnormal motor activity and

ro

thermoregulation in a schizophrenia rat model for translational science, Plos One 10

ur na

lP

re

-p

(2015) e0143751.

Jo

of

Plasma oxytocin levels predict olfactory identification and negative symptoms in

22 Figure legends

-p

ro

of

Figure 1 The experimental protocol.

Figure 2 Time-course changes in body weight (A), the cross-sectional area (B), and the paw-

re

withdrawal latency (C) at the non-injected (left) and injected (right) sides during the investigated period for both Wistar (n = 7) and Wisket (n = 11) animals. Each point represents the mean

lP

SEM. * Significant (P < 0.05) difference compared with the control (Wistar) animals. #

Jo

ur na

Significant (P < 0.05) difference from the values obtained on Day 0.

of

ro

-p

re

lP

ur na

Jo

23

of

ro

-p

re

lP

ur na

Jo

24

ur na

lP

re

-p

ro

of

25

Figure 3 Time-course effect of morphine (1 mg/kg, subcutaneously; n = 9/group; A) or endomorphin-1 (5 µg, intrathecally; n = 6/group; B) on the paw-withdrawal latency at the injected sides in both Wistar and Wisket animals. Each point represents the mean

SEM. *

Significant (P < 0.05) difference compared with the control (Wistar) animals. # Significant

Jo

difference from the post-MIA baseline values.

of

ro

-p

re

lP

ur na

Jo

26

ur na

lP

re

-p

ro

of

27

Figure 4 Relative expression of the oxytocin receptor mRNA in the olfactory bulb, prefrontal cortex (PFC), striatum (STR), diencephalon (DIEN), and brainstem (BS) in Wisket animals compared with control Wistars rats (the dotted line also indicates the control baseline). * and **

Jo

Significant (P < 0.05 and 0.001, respectively) differences compared with the control group.

of

ro

-p

re

lP

ur na

Jo

28

29

Tables

Table 1 PCR cycling conditions Hold time (s)

# of cycles

Start

95

30

1

Denaturation

95

10

39

Annealing

58

30

Extension

72

20

Melting curve

72

5

95

5

4

hold

-p

End

1

Concentration

Volume (µL)

(pmol/µL) iQ™ SYBR® Green Supermix 10

Reverse primer

10

cDNA sample Total volume

0.5 0.5 4.5

ur na

Nuclease-free water

lP

4.0

Forward primer

re

Table 2 qPCR reaction mixture Reagent

0.5

10.0

Table 3 Primer pairs used for the amplification of GAPDH and OTR Target gene

Primer pairs (5

3)

Fw: AAGAAGGTGGTGAAGCAGGCG

(GAPDH)

Rev: AGCAATGCCAGCCCCAGCAT

Jo

Glyceraldehyde 3-phosphate dehydrogenase

Oxytocin receptor (OTR)

of

Temperature (°C)

ro

Cycling step

Fw: CCAAAATCCGCACGGTGAAG Rev: CATTGACGTCCCAAACGCTC

of

ro

-p

re

lP

ur na

Jo

30