- Email: [email protected]
Distribution, serological and molecular characterization of Vibrio parahaemolyticus from shellfish in the eastern coast of China
Food Control 22 (2011) 1095e1100
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Distribution, serological and molecular characterization of Vibrio parahaemolyticus from shellfish in the eastern coast of China Feng Zhao a, b, De-qing Zhou a, *, Hui-hui Cao a, Li-ping Ma a, Yan-hua Jiang a a
Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China b College of Food Science and Technology, Shanghai Ocean University, Shanghai 201306, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 October 2010 Received in revised form 20 December 2010 Accepted 27 December 2010
To investigate the prevalence of Vibrio parahaemolyticus in shellfish, a total of 288 samples from retail markets in four coastal provinces of eastern China were collected and analyzed monthly from December 2008 to November 2009. Altogether 172 isolates were isolated and identified, of which 2 isolates were tdhþ and 5 were trhþ. The levels of V. parahaemolyticus were estimated by most probable number procedure and results suggested that the distribution of V. parahaemolyticus was disparity in season. Serotyping was performed among all isolates, 157 isolates were grouped into 9 O-groups and 42 isolates were determined by specific K-typing. Two tdhþ isolates were identified as O3:K6 and O4:K68 serovars. Random amplified polymorphic DNA (RAPD) was performed to assess the genetic diversity of all isolates. The results showed that there were 73 different patterns, which were clustered into 18 groups except 6 miscellaneous patterns. The two tdhþ isolates and two clinical isolates were grouped into the same cluster. This study demonstrated that V. parahaemolyticus from shellfishes were of high antigenic and genetic diversity. Comparison with serological method, RAPD might be a more efficient vehicle for epidemiology and risk assessment of V. parahaemolyticus. Ó 2011 Published by Elsevier Ltd.
Keywords: Vibrio parahaemolyticus Shellfish Serotype Random amplified polymorphic DNA Typing
1. Introduction Vibrio parahaemolyticus is a gram-negative, halophilic bacterium that occurs in the marine environment naturally and isolated from seafood samples frequently (Liston, 1990). V. parahaemolyticus was first found in 1950 in Osaka, Japan, leading to 20 fatalities among 272 patients (Daniels et al., 2000). This bacterium usually causes acute gastroenteritis associated with the consumption of raw or undercooked seafood, especially shellfish. Infection is characterized by diarrhea, headache, abdominal cramps, nausea and low fever. Foodborne outbreaks caused by this bacterium were reported in Asia (Alam, Tomochika, Miyoshi, & Shinoda, 2002; Cho, Shin, Choi, Park, & Lee, 2008), United States (Molenda et al., 1972) and some European countries (Martinez-Urtaza et al., 2005). The certain mechanism that V. parahaemolyticus infects humans has yet to be entirely determined. Thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) are considered as the major virulence factors for this organism, and either or both these virulence factors can cause illness (Honda, Ni, & Miwatani, 1988).
* Corresponding author. Tel./fax: þ86 532 85819337. E-mail address: [email protected] (D.-q. Zhou). 0956-7135/$ e see front matter Ó 2011 Published by Elsevier Ltd. doi:10.1016/j.foodcont.2010.12.017
Some other genes such as thermolabile hemolysin gene (tlh), B subunit of DNA gyrase gene (gyrB) and toxR gene that are involved in the regulation of gene expression in Vibrio species have also been characterized (Kim et al., 1999; Venkateswaran, Dohmoto, & Harayama, 1998). These genes were shown to be present in all of the V. parahaemolyticus isolates and could be used as target genes for specific detection of V. parahaemolyticus (Bej et al., 1999). At present, there are 13 O antigens (among which, 11 are approved) and 71 K antigens that are recognized by the Committee on the Serological Typing of V. parahaemolyticus. Since 1996, the O3:K6 has been recognized as the pandemic strain which is the most frequently detected from clinical isolates (Honda, Iida, Akeda, & Kadama, 2008). However, how this particular serotype gave rise to the recent pandemic is not known yet. Besides serotyping, a variety of molecular typing methods were applied to characterization of V. parahaemolyticus, including pulsed field gel electrophoresis (PFGE, Wong et al., 2000), ribotyping (Wong, Ho, et al., 1999), restriction fragment length polymorphism (RFLP, Marshall et al., 1999), RAPD (Wong, Liu, et al., 1999), and multilocus sequence typing (Cho, Stine, Morris, & Nair, 2004). Base on their fast, laborsaving, high discriminative and reproducible abilities, polymerase chain reaction (PCR) methods, such as RAPD has been preferred applying in characterizing V. parahaemolyticus (Wong, Liu, et al., 1999).
1096
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Table 1 The source and characterization of reference strains and clinical isolates. No.
Sources
Serotype
tdh
trh
1.1615 1.1616 1.1997 CDC-1 CDC-2 CDC-3 CDC-4
CGMCC (China General Microbiological Culture Collection Center)
O1:K1 O3:K29 O4:K11 O3:K6 O3:K6 O4:K8 UT
þ þ þ þ þ
þ þ
Qingdao Municipal Center for Disease Control and Prevention
A great number of the occurrences of pathogenic V. parahaemolyticus in human infections have been studied (Matsumoto et al., 2000; Wong et al., 2000). However, little attention has been taken into these subjects of this bacterium in shellfish of China. This study was designed to investigate the densities, serotypes and molecular characterization of V. parahaemolyticus in shellfish samples of different seasons and from different provinces in eastern China.
blenders. Then, the contents of the mixture were left to settle for a few minutes. Each of 1 mL, 0.1 mL and 0.01 mL of the mixture was added to each of three tubes containing APW. The final volume of each of the nine tubes was 10 mL, which was incubated at 37 C for 18e24 h. After culture enrichment, samples (10 ml) were subcultured onto thiosulfate citrate bile salt sucrose (TCBS, Land Bridge Technology) agar and incubated at 37 C for 18e24 h. Thereafter, green colonies were screened and examined for V. parahaemolyticus by PCR detection for tlh gene. Suspected V. parahaemolyticus isolates were then finally identified using the API 20 E system (BioMerieux Company, France). 2.4. DNA extraction
2. Materials and methods
For PCR detection and molecular characterization, the genomic DNA of V. parahaemolyticus was prepared using a standard DNA extraction method (Ausubel et al., 1987). The concentration and purity of genomic DNA in each sample were evaluated by measuring absorbance at 260 nm and calculating the ratio of absorbance at 260 nm to absorbance at 280 nm wavelengths. The DNA concentration of each sample was adjusted to 50 ng/ml.
2.1. Bacterial strains
2.5. PCR detection
Three V. parahaemolyticus reference strains (1.1615, 1.1616 and 1.1997) were purchased from CGMCC (China General Microbiological Culture Collection Center). Among these, 1.1615 and 1.1616 are tdhþ, 1.1997 is trhþ. Four clinical isolates (CDC-1e4) were gifted by Qingdao Municipal Center for Disease Control and Prevention. All strains above (Table 1) were grown on Tryptone Soy Agar (TSA, Land Bridge Technology, Beijing, China) supplemented with 3% (w/v) NaCl and incubated at 37 C for 18 h.
PCR assays for tlh and tdh gene were performed according to the procedure described by Bej et al. (1999). PCR assays for trh gene were according to what Tada et al. (1992) described. The sequence and annealing temperature of primers were listed in Table 2. Following PCR, 10 ml of the reaction mixture were loaded on 1% agarose gel containing 1 mg/ml ethidium bromide and were run at 120 V for 30 min. DL2000 maker (TaKaRa) was used as a molecular weight marker. Gels were examined under UV light and photographed.
2.2. Sampling 2.6. Serotyping A total of 288 samples including 80 oyster samples, 72 clam samples, 70 scallop samples and 66 mussel samples were collected in retail markets from 6 cities in the eastern coast of China. Six cities belong to four provinces, which are Shandong province (Yantai, Weihai and Qingdao), Jiangsu province (Lianyungang), Zhejiang province (Zhoushan) and Fujian province (Fuzhou). Samples were collected monthly during the period from December 2008 to November 2009. The samples were placed in individually labeled and sealed plastic bags and transported in sealed containers with ice to laboratory for analysis within approximately 24 h. 2.3. Most probable number (MPN) procedure The MPN method performed in this study was based on the Bacteriological Analytical Manual standard method (Kaysner & DePaola, 2004) with some modification. Briefly, 25 g of each sample were placed in 225 ml of sterile 3% NaCl Alkaline Peptone Water (APW, Land Bridge Technology) and homogenized in
Serotyping of V. parahaemolyticus was done using a commercially available V. parahaemolyticus antisera test kit (Denka Seiken, Tokyo, Japan). The fresh cultures grown on TSA plate containing 3% NaCl were used for serological reactions. K-typing and O-grouping are carried out by slide agglutination following the manufacturer’s instructions. 2.7. RAPD analysis The RAPD was performed in a 25 ml reaction mixtures containing 2 ml of template DNA, 2.5 ml of 10 PCR buffer, 2 ml of primer (10 pmol/ml), 3 ml of 2.5 mM dNTPs, 1.5 U Taq DNA polymerase and an appropriate volume of sterile MilliQ water. RAPD was performed via pre-denaturation at 94 C for 5 min followed by 35 cycles, 94 C for 60 s, annealing at 36 C for 90 s, and extension at 72 C for 150 s. Following PCR, 10 ml of the reaction mixture were loaded on 1.5% agarose gels containing 1 mg/ml ethidium bromide and run at 100 V
Table 2 Primers used for PCR characterization and typing of V. parahaemolyticus. Primer
Target gene
Sequence
Annealing temperature
Size
Reference
tlh-F tlh-R tdh-F tdh-R trh-F trh-R rapd-1
tlh
AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGC GTAAAGGTCTCTGACTTTTGGAC TGGAATAGAACCTTCATCTTCACC GGCTCAAAATGGTTAAGCG CATTTCCGCTCTCATATGC GACGCTCACA
58 C
450 bp
Bej et al., 1999
56 C
269 bp
Bej et al., 1999
55 C
250 bp
Tada et al., 1992
36 C
400e3000 bp
This study
tdh trh
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Fig. 1. Detectable rate and mean level of V. parahaemolyticus in different seasons. MareMay ¼ Spring, JuneAug ¼ Summer, SepeNov ¼ Autumn and DeceFeb ¼ Winter.
for 90 min. Wide range DNA maker (TaKaRa) was used as a molecular weight marker. Gels were examined under UV light and photographed.
1097
parahaemolyticus, a year was divided into four seasons: spring (MareMay), summer (JuneAug), autumn (SepeNov) and winter (DeceFeb). The mean levels of V. parahaemolyticus in samples collected from spring to winter were 2.32 102 MPN/g, 9.02 102 MPN/g, 4.06 102 MPN/g and 24.61 MPN/g, respectively (as shown in Fig. 1). The mean levels of V. parahaemolyticus in all shellfish were found to be below the FDA guidance of 104 CFU/g in ready-to-eat foods (FDA, 1986). The maximum isolation rate of V. parahaemolyticus in shellfish was in summer, which was up to 80.5%. And in spring, autumn and winter, it was 52.8%, 63.9% and 41.6%, respectively (Fig. 1). Based on one-way ANOVA analysis, there were significant differences (P < 0.05) between log10 V. parahaemolyticus levels and various seasons. The log10 levels of V. parahaemolyticus in the summer and the winter were significant different from other seasons (P < 0.05). But there were no significant differences between the spring and the autumn in the mean log10 density of V. parahaemolyticus in shellfish (P ¼ 0.26 > 0.05). The isolation rates of V. parahaemolyticus were 48.8% (39/80) of oyster samples, 60.0% (42/70) of scallop samples, 63.9% (46/72) of clam samples and 68.1% (45/70) of mussel samples. The mean level of different samples above were 3.0 102 MPN/g, 4.0 102 MPN/g, 4.2 102 MPN/g and 3.9 102 MPN/g, respectively. One-way ANOVA analysis of log10 V. parahaemolyticus levels versus various kinds of shellfish samples indicated no significant differences (P > 0.05).
2.8. Statistical analysis
3.2. Serotyping of V. parahaemolyticus
The size of each band in the RAPD patterns was determined and the data were coded as 0 (absence) or 1 (presence). Clusters were generated by unweighted pair group method with arithmetic mean (UPGMA) based on Dice coefficient (Dice, 1945) and dendrograms were drawn by NTSYS software (Applied Biostatistics Inc., USA). Then the discriminative index was calculated as Hunter and Gaston (1988) described. To facilitate statistical analyses of quantitative data, half the detection limit (1.5 MPN/g) for total V. parahaemolyticus in shellfish samples was substituted when levels were below the limit of detection (Parveen et al., 2008). A test of significance was conducted by SPSS 16.0 (IBM, USA) using a one-way analysis of variance (ANOVA).
A total of 172 isolates of V. parahaemolyticus isolated from 288 shellfish samples were identified. All of V. parahaemolyticus isolates during this study were serotyped by serums. Of 172 isolates, 155 were grouped into 9 different O-groups (O1, O2, O3, O4, O5, O6, O8, O10 and O11), 17 isolates were O-grouping untypable. Groups of O3 (19.1%), O4 (15.1%), O10 (15.1%) and O1 (14.0%) were the most frequently involved in shellfish (Table 3). From 155 O-group given isolates, 42 isolates were determined by specific K-typing, and the rest were K-typing untypable. Serotype of O3:K33 (with 7 isolates) was the most frequent serotype (Table 3). One strain of O3:K6 serotype and one strain of O4:K68 serotype was also found in this study. 3.3. Genetic diversity of V. parahaemolyticus
3. Results 3.1. V. parahaemolyticus in shellfish The range of V. parahaemolyticus level was from 1.50 to 2.40 103 MPN/g. To analyze the seasonal distribution of V.
There were 73 RAPD patterns identified for the 172 isolates. These patterns were grouped into 18 clusters with the coefficient more than 0.85, except that 6 miscellaneous patterns were not grouped into any of 18 clusters (Table 3). Comparing to serotype results, there was no obvious correlation between RAPD clusters
Table 3 Serotype and RAPD clusters of V. parahaemolyticus from shellfish samples. Ogroup
No. of isolated
K-type (No. of isolated)
O1 O2 O3 O4
24 14 33 26
O5 O6 O8 O10 O11 UT a
10 1 3 26 18 17
K25 (1), K32 (4), K38 (1), KUT (18) A (3), B (4), C (1), D (2), E (4), F (1), G (1), H (1), I (1), J (2), M (1), MS (3) K3 (1), K28 (3), KUT (10) A (3), B (1), C (2), E (1), G (1), I (4), K (1), P (1) K6 (1), K17 (1), K29 (2), K33 (7), K57 (1), KUT (21) A (6), B (3), C (3), D (7), F (2), H (1), I (1), K (2), L (1), M (2), MS (1), N (1), O (1), Q (2) K34 (3), K4 (3), K42 (2), K53 (1), K63 (1), K68 (1), K8 (1), KUT A (7), B (5), C (2), D (1), E (2), F (2), H (1), J (2), L (2), N (1), R (1) (14) K15 (1), K17 (2), KUT (7) A (2), B (2), C (2), D (2), L (1), MS (1) KUT (1) O (1) K41 (1), KUT (2) C (1), F (1), G (1) K24 (2), KUT (24) A (5), B (1), C (5), D (3), E (4), F (1), G (1), H (3), M (1), O (1), R (1) K40 (1), K51 (1), KUT (16) A (3), B (4), C (2), D (1), E (1), G (2), H (1), I (1), K (1), N (1), I (1) A (2), B (3), C (1), D (1), E (1), F (1), G (1), J (2), K (1), L (1), M (1), MS (1), P (1)
a
UT, untypable.
RAPD cluster
1098
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Table 4 Characteristics of V. parahaemolyticus isolated from different provinces. Province
No. of isolated
RAPD cluster
Shandong Jiangsu Zhejiang Fujian
84 35 30 23
A, A, A, A,
B, B, B, B,
C, C, C, C,
D, D, D, D,
E, E, E, E,
F, G, I, J, K, N, O, P, Q, MS1, MS5, MS6 F, H, I, J, M, P, MS2, MS4 H, K, N, M, P, MS3 H, J, K, L, M, P
and O-groups. Isolates belonging to the same O-group were genetically heterogenous, and many of the O-groups contained isolates having different RAPD clusters. Cluster A, B, C, D and E were the most frequently occurring clusters, containing 31, 23, 19, 17 and 13 isolates, respectively. The five RAPD clusters were all detected from isolates in different provinces. Considering the sources of isolates, there were several RAPD clusters belonging to particular provinces. Cluster G, O, Q and R only appeared in the isolates from Shandong province, and cluster L only appeared in Fujian province. Cluster F and I were detected from isolates of Shandong and Jiangsu provinces, and cluster H and M from isolates of Jiangsu, Zhejiang and Fujian provinces (Table 4). 3.4. Detection of tdh and trh genes in V. parahaemolyticus To detect toxigenicity of the isolates, PCR amplifications of tdh and trh were carried out in all V. parahaemolyticus isolates. Results showed that 2 of the total 172 (1.2%) V. parahaemolyticus isolates from seafood samples showed positive PCR amplification of the tdh gene segment, and only 5 (2.9%) isolates showed amplification of the trh gene segment. There was no strain with tdh and trh genes simultaneously. The serovars of two tdhþ isolates were O3:K6 and O4:K68, which were considered as the “pathogenic serotypes”. These two isolates and two clinical isolates (CDC-1 and CDC-2) were grouped into the same cluster and showed almost identical RAPD patterns (Cluster B, Fig. 2). Among these, three strains with O3:K6 serotype were
isolated from shellfish and diarrheal patients respectively in the same city of Qingdao in August of 2009. The result above suggested that these strains might be from the same source. Among the 5 trhþ isolates, three were O10:KUT serotype, one was O4:K42 serotype and one was untypable. 4. Discussions V. parahaemolyticus is one of the major seafood-borne gastroenteritis causing bacteria and is frequently isolated from shellfish samples. In this study, V. parahaemolyticus isolates were isolated from different kinds of shellfish samples. The result demonstrated that this bacterium existed in shellfish widely. The results also revealed that the level of V. parahaemolyticus was seasonal variable. The highest presence and abundance were occurred in summer, and the lowest presence and abundance were occurred in winter. The seasonal cycle of V. parahaemolyticus in sediment, water, and plankton in the U.S. was first reported by Kaneko and Colwell (1973). The seasonal variation and cycle were considered to correlate with water temperature that was a major factor affecting the abundance of V. parahaemolyticus (Parveen et al., 2008). Some previous studies have reported a positive correlation between water temperature and V. parahaemolyticus counts in shellfish (DePaola, Nordstrom, Bowers, Wells, & Cook, 2003; Lhafi & Kuhne, 2007). The mechanism of the seasonal variation for V. parahaemolyticus has been explained by the capability of the bacteria overwintering in bottom sediments and entering the water column again when warm temperatures return (Pfeffer, Hite, & Oliver, 2003). There were no dominant serovars responsible for the V. parahaemolyticus outbreaks until the appearance of pandemic O3:K6 strains in 1996. The serotype O3:K6 V. parahaemolyticus emerged from India and spread throughout the world, including countries not only Southeast Asian but also the United States (Honda et al., 2008). In China, O3:K6 was the most dominant serovar, which was frequently isolated from food-poisoning events in coastal provinces. In Guangdong province, the main serotypes of the clinical isolates were O3:K6 (62.2%) in 2008 (Tan et al., 2010). In
Fig. 2. Dendrograms and amplification patterns of V. parahaemolyticus by RAPD analysis. 1, reference strains 1.1997; 2, reference strains 1.1615; 3, reference strains 1.1616; 4e7, clinical isolates (CDC-1e4); 8, O3:K6 isolates from shellfish in Qingdao; 9, O4:K68 isolates from shellfish in Fuzhou; 10e17, isolates from shellfish in Qingdao; 18e24, isolates from shellfish in Fuzhou.
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Zhejiang province, among 13 food-poisoning outbreaks caused by V. parahaemolyticus, O3:K6 isolates with tdhþ and trh- were detected in 11 episodes (Zhang, Pan, Meng, & Chen, 2006). Strains with O4:K68, O6:K18, O1:K25 and O1:KUT serotypes were genetically close to O3:K6 by PFGE analysis (Wong et al., 2000) and APPCR analysis (Okuda et al., 1997). They probably derived from a common clonal ancestor and caused a gastroenteritis pandemic. Our study showed a similar trend, one O3:K6 strain and one O4:K68 strain was isolated from shellfish samples and both of them carried tdh gene, suggesting that these isolates were probable pathogenic strains. These two isolates and two clinical isolates were grouped into the same RAPD cluster and showed almost identical RAPD patterns, suggesting that these isolates were genetically very closely related. These results confirmed that multiple serotypes occurred in a single genetic lineage. The serotypes might move among lineages, but how it arising was still uncertain. This study was the first report demonstrating that isolates of O3:K6 and O4:K68 were isolated from shellfish in eastern coast of China. The result showed that strains of O3:K6 and O4:K68 might the main pandemic clones in China. Serotyping method of V. parahaemolyticus is expensive and time-consuming, and moreover, a certain amount of isolates are untypable. In this study, 17 isolated isolates were O-grouping untypable and 130 isolates were K-typing untypable. There were lots of isolates from shellfish samples not to be typed by serums. But clinical isolates appeared to be typed by serums easily, three out of four clinical isolates used in this study were typed by serums and only one strain was not typed. Why did this difference exist between isolates from shellfish samples and diarrheal patients? In general, different serotypes occur as a result of variation in sugar composition and linkage specificity of surface antigenic determinant (SA). SA was buried in the flagellin molecule with dissociation of flagellar filaments to flagellin monomers or steric configuration of SA itself was altered to a different form which cannot react with the responsible antibody (Shinoda, Nakahara, & Ono, 1979). Comparison with serological method, RAPD analysis has advantages of being higher efficient, less labor-intensive and faster to complete. In this study, all 172 isolates were grouped into 18 clusters. However, effective arbitrary primers should be selected by time-consuming screening from large numbers of candidate primers to produce discriminative patterns. The primer rapd-1 used in this study showed high discriminative and reproducible abilities. RAPD analysis was based on differences in nucleotide sequences in the entire genome, so it should be a preferred method for the typing of V. parahaemolyticus and also for assaying the genetic diversity of isolates. In general, we concluded that the levels of V. parahaemolyticus were seasonal variable. V. parahaemolyticus from shellfishes in the eastern coast of China were of high serumal and genetic diversity, and that RAPD might be a vehicle for epidemiological and phylogenetic analysis. Acknowledgments This research was supported by National High Technology Research and Development Program of China (863 Program, 2007AA09Z438) and Key Project of the Ministry of Science and Technology of China (2008BAD94B09). Appendix. Supplementary material Supplementary data related to this article can be found online at doi:10.1016/j.foodcont.2010.12.017.
1099
References Alam, M. J., Tomochika, K. I., Miyoshi, S. I., & Shinoda, S. (2002). Environmental investigation of potentially pathogenic Vibrio parahaemolyticus in the SetoInland Sea, Japan. FEMS. Microbiology Letters, 208, 83e87. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Sideman, J., Smith, J., et al. (1987). Current protocols in molecular biology. New York: Wiley. Bej, A. K., Patterson, D. P., Brasher, C. W., Vickery, M. C. L., Jones, D. D., & Kaysner, C. A. (1999). Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh, and trh. Journal of Microbiological Methods, 36, 215e225. Cho, N. R., Stine, O. C., Morris, J. G., & Nair, G. B. (2004). Assessment of evolution of pandemic Vibrio parahaemolyticus by multilocus sequence typing. Journal of Clinical Microbiology, 42, 1280e1282. Cho, S. H., Shin, H. H., Choi, Y. H., Park, M. S., & Lee, B. K. (2008). Enteric bacteria isolated from acute diarrheal patients in the Republic of Korea between the year 2004 and 2006. Journal of Microbiology, 46, 325e330. Daniels, N. A., Ray, B., Easton, A., Marano, N., Kahn, E., McShan, A. L., et al. (2000). Emergence of a new O3:K6 V. parahaemolyticus serotype in raw oysters. JAMA, 284, 1541e1545. DePaola, A., Nordstrom, J. L., Bowers, J. C., Wells, J. G., & Cook, D. W. (2003). Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Applied and Environmental Microbiology, 69, 1521e1526. Dice, L. R. (1945). Measures of the amount of ecologic association between species. Ecology, 26, 297e302. Food and Drug Administration (FDA). (1986). National shellfish sanitation program. Manual of operations. Part II. Sanitation of the harvesting and processing of shellfish. Washington, DC: U.S. Food and Drug Administration. Honda, T., Iida, T., Akeda, Y., & Kadama, T. (2008). Sixty years of Vibrio parahaemolyticus research. Microbe, 3, 462e466. Honda, T., Ni, Y. X., & Miwatani, T. (1988). Purification and characterization of a hemolysin produced by a clinical isolate of Kanagawa phenomenon-negative Vibrio parahaemolyticus and related to the thermostable direct hemolysin. Infection and Immunity, 56(4), 961e965. Hunter, P. R., & Gaston, M. A. (1988). Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. Journal of Clinical Microbiology, 26, 1465e1466. Kaneko, T., & Colwell, R. R. (1973). Ecology of Vibrio parahaemolyticus in Chesapeake Bay. Journal of Bacteriology, 113, 24e32. Kaysner, C., & DePaola, A. J. (2004). U. S. Food and Drug Administration; bacteriological analytical manual; methods for specific pathogens; Chapter 9 Vibrio. Available at. http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/ BacteriologicalAnalyticalManualBAM/UCM070830 Accessed on 05.08.2010. Kim, Y. B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., & Nishibuchi, M. (1999). Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. Journal of Clinical Microbiology, 37, 1173e1177. Lhafi, S. K., & Kuhne, M. (2007). Occurrence of Vibrio spp. in blue mussels (Mytilus edulis) from the German Wadden Sea. International Journal of Food Microbiology, 116, 297e300. Liston, J. (1990). Microbial hazards of seafood consumption. Food Technology, 44, 56e62. Marshall, S., Clark, C. G., Wang, G., Mulvey, M., Kelly, M. T., & Johnson, W. M. (1999). Comparison of molecular methods for typing Vibrio parahaemolyticus. Journal of Clinical Microbiology, 37, 2473e2478. Martinez-Urtaza, J., Simental, L., Velasco, D., DePaola, A., Ishibashi, M., Nakaguchi, Y., et al. (2005). Pandemic Vibrio parahaemolyticus O3:K6, Europe. Emerging Infectious Diseases, 11, 1319e1320. Matsumoto, C., Okuda, J., Ishibashi, M., Iwanaga, M., Garg, P., Rammamurthy, T., et al. (2000). Pandemic spread of an O3:K6 clone of Vibrio parahaemolyticus and emergence of related strains evidenced by arbitrarily primed PCR and toxRS sequence analyses. Journal of Clinical Microbiology, 38, 578e585. Molenda, J. R., Johnson, W. G., Fishbein, M., Wentz, B., Mehlman, I. J., & Dadisman, T. A. (1972). Vibrio parahaemolyticus gastroenteritis in Maryland: laboratory aspects. Applied Microbiology, 24, 444e448. Okuda, J., Ishibashi, M., Hayakawa, E., Nishino, T., Takeda, Y., Mukhopadhyay, A. K., Garg, S., Bhattacharya, S. K., Nair, G. B., & Nishibuchi, M. (1997). Emergence of a unique O3:K6 clone of Vibrio parahaemolyticus in Calcutta, India, and isolation of strains from the same clonal group from Southeast Asian travelers arriving in Japan. Journal of Clinical Microbiology, 35, 3150e3155. Parveen, S., Hettiarachchi, K. A., Bowers, J. C., Jones, J. L., Tamplin, M. L., McKay, R., et al. (2008). Seasonal distribution of total and pathogenic Vibrio parahaemolyticus in Chesapeake Bay oysters and waters. International Journal of Food Microbiology, 128, 354e361. Pfeffer, C. S., Hite, M. F., & Oliver, J. D. (2003). Ecology of Vibrio vulnificus in estuarine waters of eastern North Carolina. Applied and Environmental Microbiology, 69, 3526e3531. Shinoda, S., Nakahara, N., & Ono, B. I. (1979). Behavior of a surface antigenic determinant of lateral flagella of Vibrio parahaemolyticus. Infection and Immunity, 26, 322e327. Tada, J., Ohashi, T., Nishimura, N., Shirasaki, Y., Ozaki, H., Fukushima, S., et al. (1992). Detection of the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahaemolyticus by polymerase chain reaction. Molecular and Cellular Probes, 6, 477e487.
1100
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Tan, H. L., Li, B. S., Deng, X. L., Fang, W., Ke, B. X., & Ke, C. W. (2010). Molecular characteristics of Vibrio parahaemolyticus isolated from food-poisoning events in Guangdong Province, 2008. South China Journal of Preventive Medicine, 36, 23e27. Venkateswaran, K., Dohmoto, N., & Harayama, S. (1998). Cloning and nucleotide sequence of the gyrB gene of Vibrio parahaemolyticus and its application in detection of this pathogen in shrimp. Applied and Environmental Microbiology, 64, 681e687. Wong, H. C., Ho, C. Y., Kuo, L. P., Wang, T. K., Lee, C. L., & Shih, D. Y. (1999). Ribotyping of Vibrio parahaemolyticus isolates obtained from food poisoning outbreaks in Taiwan. Microbiology and Immunology, 43, 631e636.
Wong, H. C., Liu, C. C., Pan, T. M., Wang, T. K., Lee, C. L., & Shih, D. Y. (1999). Molecular typing of Vibrio parahaemolyticus isolates, obtained from patients involved in food poisoning outbreaks in Taiwan, by random amplified polymorphic DNA analysis. Journal of Clinical Microbiology, 37, 1809e1812. Wong, H. C., Liu, S. H., Ku, L. W., Lee, I. Y., Wang, T. K., Lee, Y. S., et al. (2000). Characterization of Vibrio parahaemolyticus isolates obtained from foodborne illness outbreaks during 1992 through 1995 in Taiwan. Journal of Food Protection, 63, 900e906. Zhang, W., Pan, J. C., Meng, D. M., & Chen, K. (2006). Molecular typing of Vibrio parahaemolyticus isolates from Hangzhou, China, during 2000e2002. Chinese Journal of Epidemiology, 27, 343e346.
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Distribution, serological and molecular characterization of Vibrio parahaemolyticus from shellfish in the eastern coast of China Feng Zhao a, b, De-qing Zhou a, *, Hui-hui Cao a, Li-ping Ma a, Yan-hua Jiang a a
Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China b College of Food Science and Technology, Shanghai Ocean University, Shanghai 201306, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 October 2010 Received in revised form 20 December 2010 Accepted 27 December 2010
To investigate the prevalence of Vibrio parahaemolyticus in shellfish, a total of 288 samples from retail markets in four coastal provinces of eastern China were collected and analyzed monthly from December 2008 to November 2009. Altogether 172 isolates were isolated and identified, of which 2 isolates were tdhþ and 5 were trhþ. The levels of V. parahaemolyticus were estimated by most probable number procedure and results suggested that the distribution of V. parahaemolyticus was disparity in season. Serotyping was performed among all isolates, 157 isolates were grouped into 9 O-groups and 42 isolates were determined by specific K-typing. Two tdhþ isolates were identified as O3:K6 and O4:K68 serovars. Random amplified polymorphic DNA (RAPD) was performed to assess the genetic diversity of all isolates. The results showed that there were 73 different patterns, which were clustered into 18 groups except 6 miscellaneous patterns. The two tdhþ isolates and two clinical isolates were grouped into the same cluster. This study demonstrated that V. parahaemolyticus from shellfishes were of high antigenic and genetic diversity. Comparison with serological method, RAPD might be a more efficient vehicle for epidemiology and risk assessment of V. parahaemolyticus. Ó 2011 Published by Elsevier Ltd.
Keywords: Vibrio parahaemolyticus Shellfish Serotype Random amplified polymorphic DNA Typing
1. Introduction Vibrio parahaemolyticus is a gram-negative, halophilic bacterium that occurs in the marine environment naturally and isolated from seafood samples frequently (Liston, 1990). V. parahaemolyticus was first found in 1950 in Osaka, Japan, leading to 20 fatalities among 272 patients (Daniels et al., 2000). This bacterium usually causes acute gastroenteritis associated with the consumption of raw or undercooked seafood, especially shellfish. Infection is characterized by diarrhea, headache, abdominal cramps, nausea and low fever. Foodborne outbreaks caused by this bacterium were reported in Asia (Alam, Tomochika, Miyoshi, & Shinoda, 2002; Cho, Shin, Choi, Park, & Lee, 2008), United States (Molenda et al., 1972) and some European countries (Martinez-Urtaza et al., 2005). The certain mechanism that V. parahaemolyticus infects humans has yet to be entirely determined. Thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) are considered as the major virulence factors for this organism, and either or both these virulence factors can cause illness (Honda, Ni, & Miwatani, 1988).
* Corresponding author. Tel./fax: þ86 532 85819337. E-mail address: [email protected] (D.-q. Zhou). 0956-7135/$ e see front matter Ó 2011 Published by Elsevier Ltd. doi:10.1016/j.foodcont.2010.12.017
Some other genes such as thermolabile hemolysin gene (tlh), B subunit of DNA gyrase gene (gyrB) and toxR gene that are involved in the regulation of gene expression in Vibrio species have also been characterized (Kim et al., 1999; Venkateswaran, Dohmoto, & Harayama, 1998). These genes were shown to be present in all of the V. parahaemolyticus isolates and could be used as target genes for specific detection of V. parahaemolyticus (Bej et al., 1999). At present, there are 13 O antigens (among which, 11 are approved) and 71 K antigens that are recognized by the Committee on the Serological Typing of V. parahaemolyticus. Since 1996, the O3:K6 has been recognized as the pandemic strain which is the most frequently detected from clinical isolates (Honda, Iida, Akeda, & Kadama, 2008). However, how this particular serotype gave rise to the recent pandemic is not known yet. Besides serotyping, a variety of molecular typing methods were applied to characterization of V. parahaemolyticus, including pulsed field gel electrophoresis (PFGE, Wong et al., 2000), ribotyping (Wong, Ho, et al., 1999), restriction fragment length polymorphism (RFLP, Marshall et al., 1999), RAPD (Wong, Liu, et al., 1999), and multilocus sequence typing (Cho, Stine, Morris, & Nair, 2004). Base on their fast, laborsaving, high discriminative and reproducible abilities, polymerase chain reaction (PCR) methods, such as RAPD has been preferred applying in characterizing V. parahaemolyticus (Wong, Liu, et al., 1999).
1096
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Table 1 The source and characterization of reference strains and clinical isolates. No.
Sources
Serotype
tdh
trh
1.1615 1.1616 1.1997 CDC-1 CDC-2 CDC-3 CDC-4
CGMCC (China General Microbiological Culture Collection Center)
O1:K1 O3:K29 O4:K11 O3:K6 O3:K6 O4:K8 UT
þ þ þ þ þ
þ þ
Qingdao Municipal Center for Disease Control and Prevention
A great number of the occurrences of pathogenic V. parahaemolyticus in human infections have been studied (Matsumoto et al., 2000; Wong et al., 2000). However, little attention has been taken into these subjects of this bacterium in shellfish of China. This study was designed to investigate the densities, serotypes and molecular characterization of V. parahaemolyticus in shellfish samples of different seasons and from different provinces in eastern China.
blenders. Then, the contents of the mixture were left to settle for a few minutes. Each of 1 mL, 0.1 mL and 0.01 mL of the mixture was added to each of three tubes containing APW. The final volume of each of the nine tubes was 10 mL, which was incubated at 37 C for 18e24 h. After culture enrichment, samples (10 ml) were subcultured onto thiosulfate citrate bile salt sucrose (TCBS, Land Bridge Technology) agar and incubated at 37 C for 18e24 h. Thereafter, green colonies were screened and examined for V. parahaemolyticus by PCR detection for tlh gene. Suspected V. parahaemolyticus isolates were then finally identified using the API 20 E system (BioMerieux Company, France). 2.4. DNA extraction
2. Materials and methods
For PCR detection and molecular characterization, the genomic DNA of V. parahaemolyticus was prepared using a standard DNA extraction method (Ausubel et al., 1987). The concentration and purity of genomic DNA in each sample were evaluated by measuring absorbance at 260 nm and calculating the ratio of absorbance at 260 nm to absorbance at 280 nm wavelengths. The DNA concentration of each sample was adjusted to 50 ng/ml.
2.1. Bacterial strains
2.5. PCR detection
Three V. parahaemolyticus reference strains (1.1615, 1.1616 and 1.1997) were purchased from CGMCC (China General Microbiological Culture Collection Center). Among these, 1.1615 and 1.1616 are tdhþ, 1.1997 is trhþ. Four clinical isolates (CDC-1e4) were gifted by Qingdao Municipal Center for Disease Control and Prevention. All strains above (Table 1) were grown on Tryptone Soy Agar (TSA, Land Bridge Technology, Beijing, China) supplemented with 3% (w/v) NaCl and incubated at 37 C for 18 h.
PCR assays for tlh and tdh gene were performed according to the procedure described by Bej et al. (1999). PCR assays for trh gene were according to what Tada et al. (1992) described. The sequence and annealing temperature of primers were listed in Table 2. Following PCR, 10 ml of the reaction mixture were loaded on 1% agarose gel containing 1 mg/ml ethidium bromide and were run at 120 V for 30 min. DL2000 maker (TaKaRa) was used as a molecular weight marker. Gels were examined under UV light and photographed.
2.2. Sampling 2.6. Serotyping A total of 288 samples including 80 oyster samples, 72 clam samples, 70 scallop samples and 66 mussel samples were collected in retail markets from 6 cities in the eastern coast of China. Six cities belong to four provinces, which are Shandong province (Yantai, Weihai and Qingdao), Jiangsu province (Lianyungang), Zhejiang province (Zhoushan) and Fujian province (Fuzhou). Samples were collected monthly during the period from December 2008 to November 2009. The samples were placed in individually labeled and sealed plastic bags and transported in sealed containers with ice to laboratory for analysis within approximately 24 h. 2.3. Most probable number (MPN) procedure The MPN method performed in this study was based on the Bacteriological Analytical Manual standard method (Kaysner & DePaola, 2004) with some modification. Briefly, 25 g of each sample were placed in 225 ml of sterile 3% NaCl Alkaline Peptone Water (APW, Land Bridge Technology) and homogenized in
Serotyping of V. parahaemolyticus was done using a commercially available V. parahaemolyticus antisera test kit (Denka Seiken, Tokyo, Japan). The fresh cultures grown on TSA plate containing 3% NaCl were used for serological reactions. K-typing and O-grouping are carried out by slide agglutination following the manufacturer’s instructions. 2.7. RAPD analysis The RAPD was performed in a 25 ml reaction mixtures containing 2 ml of template DNA, 2.5 ml of 10 PCR buffer, 2 ml of primer (10 pmol/ml), 3 ml of 2.5 mM dNTPs, 1.5 U Taq DNA polymerase and an appropriate volume of sterile MilliQ water. RAPD was performed via pre-denaturation at 94 C for 5 min followed by 35 cycles, 94 C for 60 s, annealing at 36 C for 90 s, and extension at 72 C for 150 s. Following PCR, 10 ml of the reaction mixture were loaded on 1.5% agarose gels containing 1 mg/ml ethidium bromide and run at 100 V
Table 2 Primers used for PCR characterization and typing of V. parahaemolyticus. Primer
Target gene
Sequence
Annealing temperature
Size
Reference
tlh-F tlh-R tdh-F tdh-R trh-F trh-R rapd-1
tlh
AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGC GTAAAGGTCTCTGACTTTTGGAC TGGAATAGAACCTTCATCTTCACC GGCTCAAAATGGTTAAGCG CATTTCCGCTCTCATATGC GACGCTCACA
58 C
450 bp
Bej et al., 1999
56 C
269 bp
Bej et al., 1999
55 C
250 bp
Tada et al., 1992
36 C
400e3000 bp
This study
tdh trh
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Fig. 1. Detectable rate and mean level of V. parahaemolyticus in different seasons. MareMay ¼ Spring, JuneAug ¼ Summer, SepeNov ¼ Autumn and DeceFeb ¼ Winter.
for 90 min. Wide range DNA maker (TaKaRa) was used as a molecular weight marker. Gels were examined under UV light and photographed.
1097
parahaemolyticus, a year was divided into four seasons: spring (MareMay), summer (JuneAug), autumn (SepeNov) and winter (DeceFeb). The mean levels of V. parahaemolyticus in samples collected from spring to winter were 2.32 102 MPN/g, 9.02 102 MPN/g, 4.06 102 MPN/g and 24.61 MPN/g, respectively (as shown in Fig. 1). The mean levels of V. parahaemolyticus in all shellfish were found to be below the FDA guidance of 104 CFU/g in ready-to-eat foods (FDA, 1986). The maximum isolation rate of V. parahaemolyticus in shellfish was in summer, which was up to 80.5%. And in spring, autumn and winter, it was 52.8%, 63.9% and 41.6%, respectively (Fig. 1). Based on one-way ANOVA analysis, there were significant differences (P < 0.05) between log10 V. parahaemolyticus levels and various seasons. The log10 levels of V. parahaemolyticus in the summer and the winter were significant different from other seasons (P < 0.05). But there were no significant differences between the spring and the autumn in the mean log10 density of V. parahaemolyticus in shellfish (P ¼ 0.26 > 0.05). The isolation rates of V. parahaemolyticus were 48.8% (39/80) of oyster samples, 60.0% (42/70) of scallop samples, 63.9% (46/72) of clam samples and 68.1% (45/70) of mussel samples. The mean level of different samples above were 3.0 102 MPN/g, 4.0 102 MPN/g, 4.2 102 MPN/g and 3.9 102 MPN/g, respectively. One-way ANOVA analysis of log10 V. parahaemolyticus levels versus various kinds of shellfish samples indicated no significant differences (P > 0.05).
2.8. Statistical analysis
3.2. Serotyping of V. parahaemolyticus
The size of each band in the RAPD patterns was determined and the data were coded as 0 (absence) or 1 (presence). Clusters were generated by unweighted pair group method with arithmetic mean (UPGMA) based on Dice coefficient (Dice, 1945) and dendrograms were drawn by NTSYS software (Applied Biostatistics Inc., USA). Then the discriminative index was calculated as Hunter and Gaston (1988) described. To facilitate statistical analyses of quantitative data, half the detection limit (1.5 MPN/g) for total V. parahaemolyticus in shellfish samples was substituted when levels were below the limit of detection (Parveen et al., 2008). A test of significance was conducted by SPSS 16.0 (IBM, USA) using a one-way analysis of variance (ANOVA).
A total of 172 isolates of V. parahaemolyticus isolated from 288 shellfish samples were identified. All of V. parahaemolyticus isolates during this study were serotyped by serums. Of 172 isolates, 155 were grouped into 9 different O-groups (O1, O2, O3, O4, O5, O6, O8, O10 and O11), 17 isolates were O-grouping untypable. Groups of O3 (19.1%), O4 (15.1%), O10 (15.1%) and O1 (14.0%) were the most frequently involved in shellfish (Table 3). From 155 O-group given isolates, 42 isolates were determined by specific K-typing, and the rest were K-typing untypable. Serotype of O3:K33 (with 7 isolates) was the most frequent serotype (Table 3). One strain of O3:K6 serotype and one strain of O4:K68 serotype was also found in this study. 3.3. Genetic diversity of V. parahaemolyticus
3. Results 3.1. V. parahaemolyticus in shellfish The range of V. parahaemolyticus level was from 1.50 to 2.40 103 MPN/g. To analyze the seasonal distribution of V.
There were 73 RAPD patterns identified for the 172 isolates. These patterns were grouped into 18 clusters with the coefficient more than 0.85, except that 6 miscellaneous patterns were not grouped into any of 18 clusters (Table 3). Comparing to serotype results, there was no obvious correlation between RAPD clusters
Table 3 Serotype and RAPD clusters of V. parahaemolyticus from shellfish samples. Ogroup
No. of isolated
K-type (No. of isolated)
O1 O2 O3 O4
24 14 33 26
O5 O6 O8 O10 O11 UT a
10 1 3 26 18 17
K25 (1), K32 (4), K38 (1), KUT (18) A (3), B (4), C (1), D (2), E (4), F (1), G (1), H (1), I (1), J (2), M (1), MS (3) K3 (1), K28 (3), KUT (10) A (3), B (1), C (2), E (1), G (1), I (4), K (1), P (1) K6 (1), K17 (1), K29 (2), K33 (7), K57 (1), KUT (21) A (6), B (3), C (3), D (7), F (2), H (1), I (1), K (2), L (1), M (2), MS (1), N (1), O (1), Q (2) K34 (3), K4 (3), K42 (2), K53 (1), K63 (1), K68 (1), K8 (1), KUT A (7), B (5), C (2), D (1), E (2), F (2), H (1), J (2), L (2), N (1), R (1) (14) K15 (1), K17 (2), KUT (7) A (2), B (2), C (2), D (2), L (1), MS (1) KUT (1) O (1) K41 (1), KUT (2) C (1), F (1), G (1) K24 (2), KUT (24) A (5), B (1), C (5), D (3), E (4), F (1), G (1), H (3), M (1), O (1), R (1) K40 (1), K51 (1), KUT (16) A (3), B (4), C (2), D (1), E (1), G (2), H (1), I (1), K (1), N (1), I (1) A (2), B (3), C (1), D (1), E (1), F (1), G (1), J (2), K (1), L (1), M (1), MS (1), P (1)
a
UT, untypable.
RAPD cluster
1098
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Table 4 Characteristics of V. parahaemolyticus isolated from different provinces. Province
No. of isolated
RAPD cluster
Shandong Jiangsu Zhejiang Fujian
84 35 30 23
A, A, A, A,
B, B, B, B,
C, C, C, C,
D, D, D, D,
E, E, E, E,
F, G, I, J, K, N, O, P, Q, MS1, MS5, MS6 F, H, I, J, M, P, MS2, MS4 H, K, N, M, P, MS3 H, J, K, L, M, P
and O-groups. Isolates belonging to the same O-group were genetically heterogenous, and many of the O-groups contained isolates having different RAPD clusters. Cluster A, B, C, D and E were the most frequently occurring clusters, containing 31, 23, 19, 17 and 13 isolates, respectively. The five RAPD clusters were all detected from isolates in different provinces. Considering the sources of isolates, there were several RAPD clusters belonging to particular provinces. Cluster G, O, Q and R only appeared in the isolates from Shandong province, and cluster L only appeared in Fujian province. Cluster F and I were detected from isolates of Shandong and Jiangsu provinces, and cluster H and M from isolates of Jiangsu, Zhejiang and Fujian provinces (Table 4). 3.4. Detection of tdh and trh genes in V. parahaemolyticus To detect toxigenicity of the isolates, PCR amplifications of tdh and trh were carried out in all V. parahaemolyticus isolates. Results showed that 2 of the total 172 (1.2%) V. parahaemolyticus isolates from seafood samples showed positive PCR amplification of the tdh gene segment, and only 5 (2.9%) isolates showed amplification of the trh gene segment. There was no strain with tdh and trh genes simultaneously. The serovars of two tdhþ isolates were O3:K6 and O4:K68, which were considered as the “pathogenic serotypes”. These two isolates and two clinical isolates (CDC-1 and CDC-2) were grouped into the same cluster and showed almost identical RAPD patterns (Cluster B, Fig. 2). Among these, three strains with O3:K6 serotype were
isolated from shellfish and diarrheal patients respectively in the same city of Qingdao in August of 2009. The result above suggested that these strains might be from the same source. Among the 5 trhþ isolates, three were O10:KUT serotype, one was O4:K42 serotype and one was untypable. 4. Discussions V. parahaemolyticus is one of the major seafood-borne gastroenteritis causing bacteria and is frequently isolated from shellfish samples. In this study, V. parahaemolyticus isolates were isolated from different kinds of shellfish samples. The result demonstrated that this bacterium existed in shellfish widely. The results also revealed that the level of V. parahaemolyticus was seasonal variable. The highest presence and abundance were occurred in summer, and the lowest presence and abundance were occurred in winter. The seasonal cycle of V. parahaemolyticus in sediment, water, and plankton in the U.S. was first reported by Kaneko and Colwell (1973). The seasonal variation and cycle were considered to correlate with water temperature that was a major factor affecting the abundance of V. parahaemolyticus (Parveen et al., 2008). Some previous studies have reported a positive correlation between water temperature and V. parahaemolyticus counts in shellfish (DePaola, Nordstrom, Bowers, Wells, & Cook, 2003; Lhafi & Kuhne, 2007). The mechanism of the seasonal variation for V. parahaemolyticus has been explained by the capability of the bacteria overwintering in bottom sediments and entering the water column again when warm temperatures return (Pfeffer, Hite, & Oliver, 2003). There were no dominant serovars responsible for the V. parahaemolyticus outbreaks until the appearance of pandemic O3:K6 strains in 1996. The serotype O3:K6 V. parahaemolyticus emerged from India and spread throughout the world, including countries not only Southeast Asian but also the United States (Honda et al., 2008). In China, O3:K6 was the most dominant serovar, which was frequently isolated from food-poisoning events in coastal provinces. In Guangdong province, the main serotypes of the clinical isolates were O3:K6 (62.2%) in 2008 (Tan et al., 2010). In
Fig. 2. Dendrograms and amplification patterns of V. parahaemolyticus by RAPD analysis. 1, reference strains 1.1997; 2, reference strains 1.1615; 3, reference strains 1.1616; 4e7, clinical isolates (CDC-1e4); 8, O3:K6 isolates from shellfish in Qingdao; 9, O4:K68 isolates from shellfish in Fuzhou; 10e17, isolates from shellfish in Qingdao; 18e24, isolates from shellfish in Fuzhou.
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Zhejiang province, among 13 food-poisoning outbreaks caused by V. parahaemolyticus, O3:K6 isolates with tdhþ and trh- were detected in 11 episodes (Zhang, Pan, Meng, & Chen, 2006). Strains with O4:K68, O6:K18, O1:K25 and O1:KUT serotypes were genetically close to O3:K6 by PFGE analysis (Wong et al., 2000) and APPCR analysis (Okuda et al., 1997). They probably derived from a common clonal ancestor and caused a gastroenteritis pandemic. Our study showed a similar trend, one O3:K6 strain and one O4:K68 strain was isolated from shellfish samples and both of them carried tdh gene, suggesting that these isolates were probable pathogenic strains. These two isolates and two clinical isolates were grouped into the same RAPD cluster and showed almost identical RAPD patterns, suggesting that these isolates were genetically very closely related. These results confirmed that multiple serotypes occurred in a single genetic lineage. The serotypes might move among lineages, but how it arising was still uncertain. This study was the first report demonstrating that isolates of O3:K6 and O4:K68 were isolated from shellfish in eastern coast of China. The result showed that strains of O3:K6 and O4:K68 might the main pandemic clones in China. Serotyping method of V. parahaemolyticus is expensive and time-consuming, and moreover, a certain amount of isolates are untypable. In this study, 17 isolated isolates were O-grouping untypable and 130 isolates were K-typing untypable. There were lots of isolates from shellfish samples not to be typed by serums. But clinical isolates appeared to be typed by serums easily, three out of four clinical isolates used in this study were typed by serums and only one strain was not typed. Why did this difference exist between isolates from shellfish samples and diarrheal patients? In general, different serotypes occur as a result of variation in sugar composition and linkage specificity of surface antigenic determinant (SA). SA was buried in the flagellin molecule with dissociation of flagellar filaments to flagellin monomers or steric configuration of SA itself was altered to a different form which cannot react with the responsible antibody (Shinoda, Nakahara, & Ono, 1979). Comparison with serological method, RAPD analysis has advantages of being higher efficient, less labor-intensive and faster to complete. In this study, all 172 isolates were grouped into 18 clusters. However, effective arbitrary primers should be selected by time-consuming screening from large numbers of candidate primers to produce discriminative patterns. The primer rapd-1 used in this study showed high discriminative and reproducible abilities. RAPD analysis was based on differences in nucleotide sequences in the entire genome, so it should be a preferred method for the typing of V. parahaemolyticus and also for assaying the genetic diversity of isolates. In general, we concluded that the levels of V. parahaemolyticus were seasonal variable. V. parahaemolyticus from shellfishes in the eastern coast of China were of high serumal and genetic diversity, and that RAPD might be a vehicle for epidemiological and phylogenetic analysis. Acknowledgments This research was supported by National High Technology Research and Development Program of China (863 Program, 2007AA09Z438) and Key Project of the Ministry of Science and Technology of China (2008BAD94B09). Appendix. Supplementary material Supplementary data related to this article can be found online at doi:10.1016/j.foodcont.2010.12.017.
1099
References Alam, M. J., Tomochika, K. I., Miyoshi, S. I., & Shinoda, S. (2002). Environmental investigation of potentially pathogenic Vibrio parahaemolyticus in the SetoInland Sea, Japan. FEMS. Microbiology Letters, 208, 83e87. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Sideman, J., Smith, J., et al. (1987). Current protocols in molecular biology. New York: Wiley. Bej, A. K., Patterson, D. P., Brasher, C. W., Vickery, M. C. L., Jones, D. D., & Kaysner, C. A. (1999). Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh, and trh. Journal of Microbiological Methods, 36, 215e225. Cho, N. R., Stine, O. C., Morris, J. G., & Nair, G. B. (2004). Assessment of evolution of pandemic Vibrio parahaemolyticus by multilocus sequence typing. Journal of Clinical Microbiology, 42, 1280e1282. Cho, S. H., Shin, H. H., Choi, Y. H., Park, M. S., & Lee, B. K. (2008). Enteric bacteria isolated from acute diarrheal patients in the Republic of Korea between the year 2004 and 2006. Journal of Microbiology, 46, 325e330. Daniels, N. A., Ray, B., Easton, A., Marano, N., Kahn, E., McShan, A. L., et al. (2000). Emergence of a new O3:K6 V. parahaemolyticus serotype in raw oysters. JAMA, 284, 1541e1545. DePaola, A., Nordstrom, J. L., Bowers, J. C., Wells, J. G., & Cook, D. W. (2003). Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Applied and Environmental Microbiology, 69, 1521e1526. Dice, L. R. (1945). Measures of the amount of ecologic association between species. Ecology, 26, 297e302. Food and Drug Administration (FDA). (1986). National shellfish sanitation program. Manual of operations. Part II. Sanitation of the harvesting and processing of shellfish. Washington, DC: U.S. Food and Drug Administration. Honda, T., Iida, T., Akeda, Y., & Kadama, T. (2008). Sixty years of Vibrio parahaemolyticus research. Microbe, 3, 462e466. Honda, T., Ni, Y. X., & Miwatani, T. (1988). Purification and characterization of a hemolysin produced by a clinical isolate of Kanagawa phenomenon-negative Vibrio parahaemolyticus and related to the thermostable direct hemolysin. Infection and Immunity, 56(4), 961e965. Hunter, P. R., & Gaston, M. A. (1988). Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. Journal of Clinical Microbiology, 26, 1465e1466. Kaneko, T., & Colwell, R. R. (1973). Ecology of Vibrio parahaemolyticus in Chesapeake Bay. Journal of Bacteriology, 113, 24e32. Kaysner, C., & DePaola, A. J. (2004). U. S. Food and Drug Administration; bacteriological analytical manual; methods for specific pathogens; Chapter 9 Vibrio. Available at. http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/ BacteriologicalAnalyticalManualBAM/UCM070830 Accessed on 05.08.2010. Kim, Y. B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., & Nishibuchi, M. (1999). Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. Journal of Clinical Microbiology, 37, 1173e1177. Lhafi, S. K., & Kuhne, M. (2007). Occurrence of Vibrio spp. in blue mussels (Mytilus edulis) from the German Wadden Sea. International Journal of Food Microbiology, 116, 297e300. Liston, J. (1990). Microbial hazards of seafood consumption. Food Technology, 44, 56e62. Marshall, S., Clark, C. G., Wang, G., Mulvey, M., Kelly, M. T., & Johnson, W. M. (1999). Comparison of molecular methods for typing Vibrio parahaemolyticus. Journal of Clinical Microbiology, 37, 2473e2478. Martinez-Urtaza, J., Simental, L., Velasco, D., DePaola, A., Ishibashi, M., Nakaguchi, Y., et al. (2005). Pandemic Vibrio parahaemolyticus O3:K6, Europe. Emerging Infectious Diseases, 11, 1319e1320. Matsumoto, C., Okuda, J., Ishibashi, M., Iwanaga, M., Garg, P., Rammamurthy, T., et al. (2000). Pandemic spread of an O3:K6 clone of Vibrio parahaemolyticus and emergence of related strains evidenced by arbitrarily primed PCR and toxRS sequence analyses. Journal of Clinical Microbiology, 38, 578e585. Molenda, J. R., Johnson, W. G., Fishbein, M., Wentz, B., Mehlman, I. J., & Dadisman, T. A. (1972). Vibrio parahaemolyticus gastroenteritis in Maryland: laboratory aspects. Applied Microbiology, 24, 444e448. Okuda, J., Ishibashi, M., Hayakawa, E., Nishino, T., Takeda, Y., Mukhopadhyay, A. K., Garg, S., Bhattacharya, S. K., Nair, G. B., & Nishibuchi, M. (1997). Emergence of a unique O3:K6 clone of Vibrio parahaemolyticus in Calcutta, India, and isolation of strains from the same clonal group from Southeast Asian travelers arriving in Japan. Journal of Clinical Microbiology, 35, 3150e3155. Parveen, S., Hettiarachchi, K. A., Bowers, J. C., Jones, J. L., Tamplin, M. L., McKay, R., et al. (2008). Seasonal distribution of total and pathogenic Vibrio parahaemolyticus in Chesapeake Bay oysters and waters. International Journal of Food Microbiology, 128, 354e361. Pfeffer, C. S., Hite, M. F., & Oliver, J. D. (2003). Ecology of Vibrio vulnificus in estuarine waters of eastern North Carolina. Applied and Environmental Microbiology, 69, 3526e3531. Shinoda, S., Nakahara, N., & Ono, B. I. (1979). Behavior of a surface antigenic determinant of lateral flagella of Vibrio parahaemolyticus. Infection and Immunity, 26, 322e327. Tada, J., Ohashi, T., Nishimura, N., Shirasaki, Y., Ozaki, H., Fukushima, S., et al. (1992). Detection of the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahaemolyticus by polymerase chain reaction. Molecular and Cellular Probes, 6, 477e487.
1100
F. Zhao et al. / Food Control 22 (2011) 1095e1100
Tan, H. L., Li, B. S., Deng, X. L., Fang, W., Ke, B. X., & Ke, C. W. (2010). Molecular characteristics of Vibrio parahaemolyticus isolated from food-poisoning events in Guangdong Province, 2008. South China Journal of Preventive Medicine, 36, 23e27. Venkateswaran, K., Dohmoto, N., & Harayama, S. (1998). Cloning and nucleotide sequence of the gyrB gene of Vibrio parahaemolyticus and its application in detection of this pathogen in shrimp. Applied and Environmental Microbiology, 64, 681e687. Wong, H. C., Ho, C. Y., Kuo, L. P., Wang, T. K., Lee, C. L., & Shih, D. Y. (1999). Ribotyping of Vibrio parahaemolyticus isolates obtained from food poisoning outbreaks in Taiwan. Microbiology and Immunology, 43, 631e636.
Wong, H. C., Liu, C. C., Pan, T. M., Wang, T. K., Lee, C. L., & Shih, D. Y. (1999). Molecular typing of Vibrio parahaemolyticus isolates, obtained from patients involved in food poisoning outbreaks in Taiwan, by random amplified polymorphic DNA analysis. Journal of Clinical Microbiology, 37, 1809e1812. Wong, H. C., Liu, S. H., Ku, L. W., Lee, I. Y., Wang, T. K., Lee, Y. S., et al. (2000). Characterization of Vibrio parahaemolyticus isolates obtained from foodborne illness outbreaks during 1992 through 1995 in Taiwan. Journal of Food Protection, 63, 900e906. Zhang, W., Pan, J. C., Meng, D. M., & Chen, K. (2006). Molecular typing of Vibrio parahaemolyticus isolates from Hangzhou, China, during 2000e2002. Chinese Journal of Epidemiology, 27, 343e346.