Molecular characterization and genetic diversity study of Vibrio parahaemolyticus isolated from aquaculture farms in India

Aquaculture 509 (2019) 104–111

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Molecular characterization and genetic diversity study of Vibrio parahaemolyticus isolated from aquaculture farms in India

T

⁎

Prasenjit Pariaa,b, Swaraj Priyaranjan Kunalc, Bijay Kumar Beheraa, , Pradeep Kumar Das Mohapatrad, Abhishek Dasa, Pranaya Kumar Paridaa, Basanta Kumar Dasa a

ICAR-Central Inland Fisheries Research Institute, Barrackpore, Kolkata 700120, India Vidyasagar University, Midnapore, West Bengal, India c Department of Zoology, Goa University, Taleigao Plateau, Goa 403206, India d Department of Microbiology, Rajganj University, Uttar Dinajpur, West Bengal, India b

A R T I C LE I N FO

A B S T R A C T

Keywords: Vibrio parahaemolyticus 16S rRNA gene T3SS1 T3SS2 Genetic diversity

Vibrio parahaemolyticus is known to cause disease and infection in humans. This study was conducted to understand the prevalence of V. parahaemolyticus and the presence of virulence factors in environmental isolates of V. parahaemolyticus, collected from three major shrimp producing states viz, West Bengal, Andhra Pradesh and Gujarat of India during February 2014 to June 2017. Total 183 V. parahaemolyticus were isolated from moribund shrimp and identified using toxR and 16S rRNA gene. Polymerase Chain Reaction (PCR) was performed to detect virulence genes under T3SS1 and T3SS2 along with AHPND. All the isolates showed presence of vcrD1, vp1680 and vopD1 gene under T3SS1 but negative for AHPND. Only 3% of isolates showed presence of all the virulence genes (vcrD2, vopD2, vopB2 and vopC) used in the present study under T3SS2. The isolates were also tested for the presence of tdh, trh or both the genes; 8% of the isolates had trh gene and 3% of the isolates had tdh gene. The genetic diversity within and between V. parahaemolyticus isolated from three different geographical locations, was analyzed by using 16S rRNA gene. Though the biotype diversity (h) was high for all three populations, phylogenetic study of V. phaemolyticus revealed an admixture of biotypes. Tajima's D (−2.59470; p < .001) test of selective neutrality and Fu's Fs (−32.422; p < .001) test were negative and significant, suggesting a sudden population expansion with limited time for population differentiation.

1. Introduction Vibrio parahaemolyticus is a halophillic, gram - negative bacterium, distributed in marine and estuarine environment worldwide and is responsible for gastrointestinal infection in human after consumption of contaminated seafood or raw undercooked seafood (Zhang and Orth, 2013). Symptoms from V. parahaemolyticus infection in humans includes abdominal pain, vomiting, headache, fever and chills (Zhang and Orth, 2013). High prevalence of V. parahaemolyticus in environmental samples like water, sediment, fish and shellfish were reported worldwide (FAO and WHO, 2011). V. parahaemolyticus is one of the twelve known pathogenic Vibrio spp. associated with vibriosis in finfish and shellfish (Khouadja et al., 2013) causing high economic loss to aquaculture industries (Kumaran and Citarasu, 2016). A newly emerging disease in shrimp, called acute hepatopancreatic necrosis disease (AHPND) is also caused by V. parahaemolyticus encoding PirvpA and PirvpB toxins (Lee et al., 2015; Sirikharin et al., 2015). Fish and shellfish

⁎

mainly cultured under brackish or salt water in coastal and estuarine environments is a natural habitat for diverse halophilic bacteria including V. parahaemolyticus, thereby acting as a vehicle for transmission to human population (DePaola et al., 2003). V. parahaemolyticus carry multiple virulence factors including Thermo Stable Direct Haemolysin (tdh), tdh-Related Hemolysin (trh) and Thermolabile Hemolysin (tlh). The tdh and trh are major virulence factors responsible for haemolysis of erythrocytes, cardiotoxicity and enterotoxicity (Raghunath, 2015). Numerous researches conducted on whole genome sequencing of the pathogenic strain of V. parahaemolyticus indicated that it contains two set of pathogenic island; Type III secretion system I (T3SS1) within chromosome I and Type III secretion system II (T3SS2) within chromosome II encoding various effector proteins which are transferred into the cytoplasm of the host cell, using a syringe like apparatus (Park et al., 2004). These effector proteins modify the host innate immunity, cytoskeleton and signal transduction system which helps in colonization and persistence of

Corresponding author. E-mail address: [email protected] (B.K. Behera).

https://doi.org/10.1016/j.aquaculture.2019.04.076 Received 17 October 2018; Received in revised form 25 April 2019; Accepted 27 April 2019 Available online 04 May 2019 0044-8486/ © 2019 Published by Elsevier B.V.

Aquaculture 509 (2019) 104–111

P. Paria, et al.

2.4. DNA sequencing

bacteria in the host cell (Burdette et al., 2008). Existence of virulence genes in the environmental strains of V. parahaemolyticus was previously unknown until recently, when studies indicated that V. parahaemolyticus can be a highly diversified species both genetically and serotypically. This diversity within the species is due to recombination (González-Escalona et al., 2008; Yan et al., 2011) and changing environmental conditions (Baker-Austin et al., 2010). The environmental strains are more diversified than the pathogenic strains due to acquisition of virulence genes, mobile genetic elements and genetic islands, thereby increasing their fitness and their virulence potential (Gennari et al., 2012). The presence of virulence genes, or their homologoues were confirmed in the environmental strains (Caburlotto et al., 2009), emphasizing the potential threat of environmental strains to human health (Turner et al., 2013). In the present study, V. parahaemolyticus was isolated from the shrimp farms of three major shrimp producing states of India and were characterized using virulence associated genes under T3SS1 (vcrD1, vp1680, vopD), T3SS2 (vcrD2, vopD2, vopB2, vopC) and three hemolysin genes tlh, tdh, trh. Further, the population structure of V. parahaemolyticus isolated from three different geographical locations was analyzed using 16S rRNA gene to understand their genetic diversity.

The PCR samples were sequenced in both directions using an ABI 3730xl capillary sequencer (Applied Biosystems, Foster City, CA) to validate the sequence data. The forward and reverse sequences were aligned using the software DNA Baser. The sequence of forward strand was proofread using the sequence of the complementary strand. Approximately 1450 bp of 16S rRNA sequences were then compared to sequences available in GenBank using the NCBI–BLAST program facility (http://www.ncbi.nlm.nih.gov/BLAST). After trimming from both sides, 1416 bp sequence was used for phylogenetic analysis. 2.5. Virulence-related gene detection PCR of individual isolates of V. parahaemolyticus were performed to detect virulence genes including tlh, tdh, trh and representative genes of T3SS1 (vcrD1, vp1680, vopD) and T3SS2 (vcrD2, vopD2, vopB2 and vopC). All isolates were further screened for AHPND disease using specific primers. The details of all primers used in this study are included in Table 1. Thermal-cycling program for PCR were as follows: denaturation at 95 °C for 2 min, followed by 35 cycles consisting of 95 °C for 30 s, annealing temperature for 30 s, and 72 °C for 45 s, and a final elongation of 72 °C for 3 min. PCR product of different genes were visualized on 1.8% agarose gel.

2. Materials and methods 2.1. Sample collection

2.6. Gene association study of T3SSα and tdh A total of 350 shellfish (Litopenaeus vannamei) samples were collected during 25–90 days of culture (DOC) with average size of 1.5–22 g depending on DOC from aquaculture farms of three different states viz, Andhra Pradesh, West Bengal and Gujarat of India with sampling period between February to October 2014 to 2017 (Fig. 1). Hundred and fifty samples were collected from three different districts of West Bengal including East Midnapore, North 24 Parganas and South 24 Parganas. Hundred samples were collected from three different district of Andhra Pradesh which are East Godavori, West Godavari and Nellore. Hundred samples were collected from three different districts of Gujarat viz, Surat, Navsari and Valsad. The samples were immediately brought to the laboratory under ice. Hepatopancreas was aseptically taken out and transferred into tube containing Alkaline Peptone Water (APW) and were incubated at 37 °C for 24 h.

To understand the association between T3SSα and tdh gene in the V. parahaemolyticus, PCR was carried out for all the tdh and trh positive stains isolated in the present study. Four different genes viz, VPA1327 (vopT), VPA1335 (vscS2), VPA1339 (vscC2) and VPA1362 (vopB2) were used as a representative gene under T3SS2α. The primer details and PCR amplification was performed following the protocol describe by Noriea III et al. (2010). 2.7. Phylogenetic analysis The 16S rRNA gene sequences were edited using BioEdit (version 7.0.1) and aligned using ClustalW algorithm (Thompson et al., 1994) as implemented in MEGA 7 (Kumar et al., 2016). DnaSP 4.0 (Rozas et al., 2003) was used to calculate the number of biotypes, polymorphic sites, nucleotide diversity (p) and biotype diversity (h) from sequence data. The evolutionary history was inferred using the Neighbor-Joining (NJ) (Saitou and Nei, 1987) method as implemented in MEGA7 (Kumar et al., 2016). The evolutionary distances were computed using the Tamura-Nei method (Tamura and Nei, 1993) and depicted as units of the number of base substitutions per site. The percentage of replicate trees in which the associated taxa is clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Felsenstein, 1985). Only nodes with bootstrap support of > 50% are shown in the final tree. All positions containing alignment gaps and missing data were eliminated by invoking the Pairwise deletion option for indels. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA7 (Kumar et al., 2016). The demographic history contained in the 16S rRNA gene sequence data was inferred using two approaches. One was to reject the null hypothesis of neutrality when a population has experienced population expansion (Tajima, 1989). Second, Tajima's D statistical test (Tajima, 1989) was implemented in DnaSP 4.0 (Rozas et al., 2003) to examine whether the populations from different regions are at genetic equilibrium. When analyzing large samples, the Fu's Fs test is preferred over other tests in detecting population growth (Ramos-Onsins and Rozas, 2002). The Fs test of Fu was used to tests deviations from neutrality as expected under population expansion (Fu, 1997). Under the assumption of selective neutrality, DnaSP 4.0 (Rozas et al., 2003) mismatch

2.2. Bacterial isolation One millilitre of each APW-enriched culture was serially diluted to 1:10,000 times in sterile PBS solution. Hundred millilitre of diluted samples were spreaded on Thiosulphate Citrate Bile Salts Sucrose (TCBS) agar plate and were incubated at 37 °C for 24 h. Green or bluegreen colonies on TCBS plate were presumptively selected as V. parahaemolyticus colonies, transferred aseptically to HiCrome Vibrio Agar (M1682, himedia) plate and were incubated at 37 °C for 24 h, where V. parahaemolyticus colonies appeared as bluish green colour. Bluish green colonies were picked and re-plated on CHROMagar Vibrio (CHROMagar Microbiology, Paris, France) for further confirmation. Finally, the bacterial colony was transferred into sterile TSB supplemented with 2% NaCl and maintained as glycerol stock at -20 °C. 2.3. Molecular identification Genomic DNA was extracted from isolated bacterial culture by Sarkosyl method (Sambrook and Russel, 2001). The DNA concentrations were estimated by spectrophotometer. The PCR amplification of the 16S rRNA gene was performed using the primers UFF2 5′-GTTGA TCATGGCTCAG-3′ and URF2 5′-GGTTCACTTGTTACGACTT-3′ following the protocol described by Behera et al. (2017). PCR product was visualized on 1.8% agarose gel. 105

Aquaculture 509 (2019) 104–111

P. Paria, et al.

Fig. 1. Map showing the geographical locations of sampling sites in the states of West Bengal Andhra Pradesh and Gujarat. Different colour within different states represented the different district from where sample had been collected. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

highest prevalence of V. parahaemolyticus was detected in Andhra Pradesh followed by Gujarat and West Bengal.

distribution analyses were used to evaluate possible historical events of population growth and decline. A population which has experienced a rapid expansion in recent past shows smooth wave-like mismatch distribution.

3.2. Virulence-related gene detection 3. Results

All isolates were subjected to PCR for detection of virulence genes like vcrD1, vopD and vp1680 under T3SS1 and vcrD2, vopD2, and vopB2 under T3SS2. vcrD1 (vp1662) encode an inner membrane protein comprising the TT3SS1 apparatus, while the other two genes vopD (vp1656) and vp1680 encodes effector proteins (Ono et al., 2006; Shimohata et al., 2011). All isolates carried vcrD1, vopD and vp1680 genes which suggested that these genes are well conserved in V. parahaemolyticus (Table 2). Further, all the isolates were screened for the presence of four genes under T3SS2, including an inner membrane protein vcrD2 (vpa1335), a translocon protein associated with enterotoxicity vopD2 (vap1361), a putative C-ring component involved in translocation vopB2 (vpa1362), and a protein linked to internalization of V. parahaemolyticus vopC; (vpa1321). Out of total isolates examined, six resulted positive for vrcD2, vopD2, vopB2 and vopC2 (Table 2). The presence of the tdh and trh genes were indicative of pathogenicity of V. parahaemolyticus. Only six of the 183 strains (3%), amplified the

3.1. Isolation and molecular identification A total of 350 shrimp samples (150 from West Bengal, 100 from Andhra Pradesh and 100 from Gujarat) were collected from aquaculture farms and were screened for V. parahaemolyticus. A total of 183 isolates (71 from West Bengal, 61 from Andhra Pradesh and 51 from Gujarat) were identified by using three different media. The blue green colonies on TCBS agar plate were transferred aseptically to HiCrome Vibrio Agar plate (M1682, Himedia) and CHROMagar Vibrio plate where it grown as bluish green and mauve colour colonies, respectively. For further confirmation, all the isolates were screened using toxR primer and were positive for the toxR gene amplifying the 368 bp fragment. The prevalence of V. parahaemolyticus was calculated by number of V. parahaemolyticus colonies in total number of shrimp tested. The 106

Aquaculture 509 (2019) 104–111

P. Paria, et al.

Table 1 List of primers used in this study. Target (Locus)

Sequence

Annealing temperature

Amplicon (bp)

Source

vcrD1 (VP1662)

CTGCTGGTCTTGTTCGCTCT TCTGGTCGCTTCCTTCTGTG AATTTTGGAAGTGGTGAGCCTA TTCTTTTGCTATCGGCGTAACT GCGACACTATCAAAACAACCAA TGCCATCTCGGTCTTAATTTCT GTTGGTGCTCGCTTCTCTCT CCCATCCCCTACTGTCAAGA TTCTGTAAATCTAGCGCAACCA TGTATTTGGCAGTACGACCTTG GGGGGCAAGCTAATAAAGAGAT GTTAAAGCTGAGCAACATCGTG AGTCAAGGGACTAATTTAGCAA TACCATTATTCAACGAATCAGA GTAAAGGTCTCTGACTTTTGGAC TGGAATAGAACCTTCATCTTCACC TTGGCTTCGATATTTTCAGTATCT CATAACAAACATATGCCCATTTCCG AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGC GTCTTCTGACGCAATCGTTG ATACGAGTGGTTGCTGTCATG ATGAGTAACAATATAAAACATGAAAC ACGATTTCGACGTTCCCCAA TTGAGAATACGGGACGTGGG GTTAGTCATGTGAGCACCTTC

53.8

439

Tsai et al. (2013)

51.1

502

Tsai et al. (2013)

51.1

515

Tsai et al. (2013)

53.8

300

Tsai et al. (2013)

51.1

476

Tsai et al. (2013)

53

527

Tsai et al. (2013)

47.4

576

Tsai et al. (2013)

58.0

269

Bej et al. (1999)

58.0

500

Bej et al. (1999)

58.0

450

Bej et al. (1999)

63.0

368

Kim et al. (1999)

55

1269

Dangtip et al. (2015)

55

230

VP1680 vopD (VP1656) vcrD2 (VPA1355) vopD2 (VPA1361) vopB2 (VPA1362) vopC (VPA1321) tdh trh tlh toxR AHPND

MG762012 MG190871-MG190873, MG383934-MG383936, MG525090-MG525119, MG548337-MG548364. Sixty-one sequences are from Andhra Pradesh with the accession numbers MG564725MG564754, MG575435-MG575461 and rest 51 sequences are from Gujarat with accession numbers MG593201-MG593230, MG970576MG970596.

Table 2 Molecular characterization of environmental V. parahaemolyticus isolates from the aquaculture environments of India. Gene

Hemolysin tlh tdh trh T3SS1 vcrD1 vp1680 vopD T3SS2 vcrD2 vopD2 vopB2 vopC2 Others toxR AHPND

Environmental isolates West Bengal (n = 71)

Andhra (n = 61)

Gujarat (n = 51)

71(71) 2(71) 6(71)

61(61) 3(61) 5(61)

51(51) 1(51) 3(51)

71(71) 71(71) 71(71)

61(61) 61(61) 61(61)

51(51) 51(51) 51(51)

8(71) 2(71) 2(71) 2(71)

8(61) 3(61) 3(61) 3(61)

4(51) 1(51) 1(51) 1(51)

71(71) 0(71)

61(61) 0(61)

51(51) 0(51)

3.5. Genetic diversity study A total of 214 variable sites (126 parsimony informative), constituting 138 biotypes were detected among 183 16S rRNA gene sequences. Most of the biotypes were unique to particular individual strain. The nucleotide composition was consistent with G-C bias as is the case in 16S rRNA region. Mean base composition was 25.2% A, 20.7% T, 22.1% C and 32.1% G. The biotype diversity (h) was high for all three populations with values ranging from 0.9759 to 0.9943 (Table 3). The nucleotide diversity (pi) for sequence data varied greatly among the samples with values ranging from 0.0056 to 0.0140 (Table 3). Phylogenetic analysis of nucleotide sequences demonstrated that biotypes from individual sites or geographically distinct locations do not form exclusive clades, and biotypes of all regions are spread across phylogenetic tree, hinting an admixture of biotypes (Fig. 2). The biotypes pairwise comparison between nucleotide revealed mismatch distribution for all samples was unimodal . Tajima's D (−2.59470; p < .001) test of selective neutrality and Fu's Fs (−32.422; p < .001) test was highly negative and significant, suggesting a sudden

251 bp tdh gene fragment and 14 stains of V. parahaemolyticus amplified the 488 bp trh gene fragment. All isolates were positive for tlh amplifying 451 bp fragment; however, none were positive for AHPND. 3.3. Gene association study of T3SSα and tdh All the tdh positive strains showed positive amplification for the four genes [VPA1327 (vopT), VPA1335 (vscS2), VPA1339 (vscC2) and VPA1362 (vopB2)] under T3SS2α. None of the trh positive strains showed positive amplification for four genes used in the present study under T3SS2α (Fig. S1).

Table 3 Gene flow and genetic differentiation based on 16S rRNA sequences of V. parahaemolyticus.

3.4. Nucleotide sequence accession numbers Hundred and eighty-three sequences of the 16S rRNA gene of V. parahaemolyticus were submitted to GenBank, out of which 71 sequences are from West Bengal with the accession numbers, MG188672, 107

Population

WB

AP

GU

Overall

No. of sequences No. of segregating sites No. of biotypes (b) Biotype diversity (bd) Average no. of differences Nucleotide diversity

71 188 62 0.9943 19.8503 0.0140

61 66 43 0.9759 8.2530 0.0056

51 201 43 0.9906 13.2902 0.0093

183 340 138 0.9901 14.4898 0.0102

Aquaculture 509 (2019) 104–111

P. Paria, et al.

Fig. 2. Evolutionary relationships among biotypes of V. parahaemolyticus from three populations.Number along the nods indicates bootstrap value. Red shaded rectangular shapes indicate the isolates from West Bengal, Blue shaded triangle indicate the isolates from Andhra Pradesh and Yellow shaded oval shapes indicate the isolates from Gujarat. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

V.parahaemolyticus (Jones et al., 2012). The tlh gene is expressed in both clinical and environmental strains of V. parahaemolyticus (Bej et al., 1999) and is responsible for the lysis of red blood cells (Wang et al., 2013). Gotoh et al. (2010) reported that under simulated intestinal infection conditions the expression of tlh gene is significantly upregulated. The presence of tdh and trh genes in V. parahaemolyticus isolated from environmental samples like fish, shrimp, water, soil and sediment samples has been previously reported by multiple research groups (Deepanjali et al., 2005; Raghunath et al., 2008; Chen et al., 2017). 1–10% of the environmental isolates of V. parahaemolyticus showed the presence tdh and trh gene (DePaola et al., 2000; Johnson et al., 2009). Low density tdh and trh has also been reported from Japan and Chile (Alam et al., 2003; Fuenzalida et al., 2006). In the present study, 3% (2

population expansion with limited time for population differentiation (Fig. 3). 4. Discussion Vibrio parahaemolyticus under Vibrio sp. is responsible for gastrointestinal infection worldwide, (Wang et al., 2017) with both pathogenic and non-pathogenic strains widely distributed in aquatic environments (Gennari et al., 2012). In the present study, V. parahaemolyticus was isolated from aquaculture farms using three different types of media after 24 h of enrichment in APW. All the isolates were further screened using toxR and tlh gene and were found positive. The presence of tlh gene in all the isolates of V. parahaemolyticus reconfirms that it can be used as a marker to identify 108

Aquaculture 509 (2019) 104–111

P. Paria, et al.

under T3SS2α in all the tdh positive strains clearly indicated that T3SSα is closely associated with tdh gene. The result of this study reconfirms the findings of earlier worker (Noriea III et al., 2010). These genes were previously reported in both environmental and clinical isolates (Tey et al., 2015). Most of the virulence genes tested in this study are responsible for cytotoxicity and endotoxicity in fish, mouse, pig and human (Zhang et al., 2016; Piñeyro et al., 2010). The cytotoxicity of these genes was also tested in animal cell lines (Kodama et al., 2008; Zhou et al., 2010). All the V. parahaemolyticus strains isolated in this study were from moribund shrimp samples and are PirvpAB negative (virulence factor for AHPND). The clinical symptoms include reddish hepatopancreas and empty gut. In addition to that continuous mortality (0.1–0.5% per day) was noticed in the infected pond. Similarly, AHPND negative strains of V. parahaemolyticus from moribund shrimp samples were also isolated by Kumar et al. (2014) but were positive for T3SS1. Recently, 47% motility in shrimp was reported by Phiwsaiya et al. (2017) after challenge with V. parahaemolyticus which do not produce Pirvp toxins, responsible for AHPND in shrimp, indicated the secretion of other potentiating toxin(s). In the absence of pirvpAB genes, mortalities were observed in shrimp farms which are probably due to the presence of genes of different secretory systems of V. parahaemolyticus. The study in addition to biological diversity in nature is a result of the evolutionary dynamics of populations and the history of the regions in which populations occur (Lomolino et al., 2006). An appropriate approach to unveil the influence of historical factors is to analyze current genetic variation to reconstruct the demographic history of populations (Hope et al., 2014). In microorganisms, genetic studies looking at historical demography have primarily focused on host-associated bacteria to gain insight into disease epidemics (Wirth et al., 2006; Comas et al., 2013; Holt et al., 2013). In the present study, the population analysis of V. parahaemolyticus isolated from three different geographical locations was analyzed using 16S rRNA gene to understand their genetic diversity. However, in studies involving bacterial populations, caution should be taken in the delimitation of populations, which has to consider key aspects such as the degree of genetic and ecological diversity (Avitia et al., 2014). It is also important to consider the molecular resolution at which populations are defined (Kopac and Cohan, 2011). It is possible to identify newer population when study was expanded to more variable loci. In the present study, conserved loci 16S rRNA gene region was investigated to understand phylogenetic pattern that may result in coarse population delimitation. Nonetheless, to include both genetic and ecological aspects in the delimitation of populations, we defined individual populations for each lineage by analyzing genetic structure of V. parahaemolyticus across sampling sites. The genetic diversity within the sampled populations (θ & π = Table 3) is in the range of values reported for natural bacterial populations (Vos and Velicer, 2006), meaning that the observed diversity is within the range of normal polymorphism in bacterial populations. Tajima's D was designed to provide a test of neutrality, which depends on the assumption of mutation-drift equilibrium (Tajima, 1989; Nei and Kumar, 2000). For example, a recent population bottleneck can yield a negative value of Tajima's D in the absence of purifying selection. In present study, Tajima's D test was highly negative and significant, suggesting a sudden population expansion with limited time for population differentiation. Similarly, Fu's F statistics proposes a different statistic based on the infinite sites model of mutation. He suggests estimating the probability of observing a random sample with a number of alleles equal to or smaller than the observed value given under the observed level of diversity and the assumption that all of the alleles are selectively neutral. A negative value of F is evidence for an excess number of alleles, as would be expected from a recent population expansion and the present study confirms this pattern. The 16S rRNA gene sequences used to reconstruct phylogeny of V.parahaemolyticus revealed an admixture of biotypes, a typical case of lack of genetic differentiation among different localities, which may be attributed to the limited time available for populations to differentiate.

Fig. 3. Mismatch distribution of 183 16S rRNA sequences of V. parahaemolyticus from three populations (West Bengal, Andhra Pradesh, Gujarat) representing the observed and expected pairwise differences under the sudden population expansion model.

isolates out of 71 isolates from West Bengal; 3 out of 61 isolates from Andhra Pradesh and 1 out of 51 isolates from Gujarat) of environmental isolates showed the presence of tdh gene. Study by DePaola et al. (1988) and Deepanjali et al. (2005) indicated a higher prevalence of tdh and trh positive V. parahaemolyticus in oyster which may occur due to the preferential selection of tdh positive stains. Research by Jones et al. (2012) indicated that 27% of clinical V. parahaemolyticus stains though pathogenic, tested negative for tdh and trh, thereby indicating the presence of other virulence factors. A different study by Mahoney et al. (2010) reported that environmental isolates of V. parahaemolyticus lacking tdh and/or trh, produced putative virulence factors like extracellular proteases, biofilm, siderophore, which is cytotoxic to human gastrointestinal cells. Park et al. (2004) reported that deletion of both copies of tdh did not affect the cytotoxicity to HeLa cells and lowered enterotoxicity effect was observed in rabbit ileal loop. Ming et al. (1994) reported that deletion of trh gene resulted in partial but apparent fluid accumulation in ligated rabbit small intestine. These results clearly indicate that cytotoxicity and enterotoxicity of pathogenic V. parahaemolyticus are not explained by tdh and trh alone and suggested that an unkown virulence factor(s) could be responsible for pathogenicity (Caburlotto et al., 2010). Extensive study on virulence gene of V. parahaemolyticus in the last two decades revealed presence of three pathogenic islands (T3SS1, T3SS2 and T3SS6), which secretes multiple effector proteins performing a range of functions. For example, these proteins can modify and suppress host defense system (Matlawska-Wasowska et al., 2010), dysregulate actin network (Zhou et al., 2010), play a role in pathogen survival and replication inside the host cell and also help in the colonization within the cell (Zhang et al., 2012). Presence of these virulence genes, or their homologoues, acquired in the aquatic environments, may convert nonpathogenic strain into pathogenic strain. Therefore, researchers have included pandemic markers, as well as genes belonging to the secretion system with tdh and trh (Caburlotto et al., 2009; Caburlotto et al., 2010; Gennari et al., 2012). In line with previous research we have included virulence genes under T3SS1 (vcrD1, vopD, vp1680) and T3SS2 (vcrD2, vopB, vopD2, vopC) to understand their distribution within the environmental isolates. All isolates carried vcrD1, vopD and vp1680 genes suggesting that these genes are well conserved in V. parahaemolyticus. Amplification of four genes 109

Aquaculture 509 (2019) 104–111

P. Paria, et al.

5. Conclusion

2013. Out-of-Africa migration and neolithic coexpansion of Mycobacterium tuberculosis with modern humans. Nat. Genet. 45 (10), 1176–1182. Dangtip, S., Sirikharin, R., Sanguanrut, P., Thitamadee, S., Sritunyalucksana, K., Taengchaiyaphum, S., Mavichak, R., Proespraiwong, P., Flegel, T.W., 2015. AP4 method for two-tube nested PCR detection of AHPND isolates of Vibrio parahaemolyticus. Aquacult. Rep. 2, 158–162. Deepanjali, A., Kumar, H.S., Karunasagar, I., 2005. Seasonal variation in abundance of total and pathogenic Vibrio parahaemolyticus bacteria in oysters along the southwest coast of India. Appl. Environ. Microbiol. 71 (7), 3575–3580. DePaola, A., Hopkins, L.H., McPhearson, R.M., 1988. Evaluation of four methods for enumeration of Vibrio parahaemolyticus. Appl. Environ. Microbiol. 54 (2), 617–618. DePaola, A., Kaysner, C.A., Bowers, J., Cook, D.W., 2000. Environmental investigations of Vibrio parahaemolyticus in oysters after outbreaks in Washington, Texas, and New York (1997 and 1998). Appl. Environ. Microbiol. 66 (11), 4649–4654. DePaola, A., Nordstrom, J.L., Bowers, J.C., Wells, J.G., Cook, D.W., 2003. Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Appl. Environ. Microbiol. 69 (3), 1521–1526. FAO/WHO [Food and Agriculture Organization of the United Nations/World Health Organization], 2011. Risk Assessment of Vibrio parahaemolyticus in Seafood: Interpretative Summary and Technical Report. Microbiological Risk Assessment Series No. 16. Rome. pp. 193. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fu, Y.X., 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147 (2), 915–925. Fuenzalida, L., Hernández, C., Toro, J., Rioseco, M.L., Romero, J., Espejo, R.T., 2006. Vibrio parahaemolyticus in shellfish and clinical samples during two large epidemics of diarrhoea in southern Chile. Environ. Microbiol. 8 (4), 675–683. Gennari, M., Ghidini, V., Caburlotto, G., Lleo, M.M., 2012. Virulence genes and pathogenicity islands in environmental Vibrio strains nonpathogenic to humans. FEMS Microbiol. Ecol. 82 (3), 563–573. González-Escalona, N., Martinez-Urtaza, J., Romero, J., Espejo, R.T., Jaykus, L.A., DePaola, A., 2008. Determination of molecular phylogenetics of Vibrio parahaemolyticus strains by multilocus sequence typing. J. Bacteriol. 190 (8), 2831–2840. Gotoh, K., Kodama, T., Hiyoshi, H., Izutsu, K., Park, K.S., Dryselius, R., Akeda, Y., Honda, T., Iida, T., 2010. Bile acid-induced virulence gene expression of Vibrio parahaemolyticus reveals a novel therapeutic potential for bile acid sequestrants. PLoS One 5 (10), e13365. Holt, K.E., Vu, T., Nga, T., Pham, D., Vinh, H., Wook, D., Phan, M., Tra, V., 2013. Tracking the establishment of local endemic populations of an emergent enteric pathogen. Proc. Natl. Acad. Sci. U. S. A. 110 (43), 17522–17527. Hope, A.G., Ho, S.Y.W., Malaney, J.L., Cook, J.A., Talbot, S.L., 2014. Accounting for rate variation among lineages in comparative demographic analyses. Evolution 68 (9), 2689–2700. Johnson, C.N., Flowers, A.R., Young, V.C., Gonzalez-Escalona, N., DePaola, A., Noriea, N.F., Grimes, D.J., 2009. Genetic relatedness among tdh+ and trh+ Vibrio parahaemolyticus cultured from Gulf of Mexico oysters (Crassostrea virginica) and surrounding water and sediment. Microb. Ecol. 57 (3), 437. Jones, J.L., Lüdeke, C.H., Bowers, J.C., Garrett, N., Fischer, M., Parsons, M.B., Bopp, C.A., DePaola, A., 2012. Biochemical, serological, and virulence characterization of clinical and oyster Vibrio parahaemolyticus isolates. J. Clin. Microbiol. 50 (7), 2343–2352. Khouadja, S., Lamari, F., Bakhrouf, A., 2013. Characterization of Vibrio parahaemolyticus isolated from farmed sea bass (Dicentrarchus labrax) during disease outbreaks. Int. Aquat. Res. 5 (1), 13. Kim, Y.B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., Nishibuchi, M., 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. J. Clin. Microbiol. 37, 1173–1177. Kodama, T., Hiyoshi, H., Gotoh, K., Akeda, Y., Matsuda, S., Park, K.S., Cantarelli, V.V., Iida, T., Honda, T., 2008. Identification of two translocon proteins of Vibrio parahaemolyticus type III secretion system 2. Infect. Immun. 76 (9), 4282–4289. Kopac, S., Cohan, F.M., 2011. A theory-based pragmatism for discovering and classifying newly divergent bacterial species. In: Tibayrenc, M. (Ed.), Genetics and Evolution of Infectious Diseases. Elsevier, Burlington, MA, pp. 21–41. Kumar, B.K., Deekshit, V.K., Raj, J.R.M., Rai, P., Shivanagowda, B.M., Karunasagar, I., Karunasagar, I., 2014. Diversity of Vibrio parahaemolyticus associated with disease outbreak among cultured Litopenaeus vannamei (Pacific white shrimp) in India. Aquaculture 433, 247–251. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Kumaran, T., Citarasu, T., 2016. Isolation and characterization of Vibrio species from shrimp and Artemia culture and evaluation of the potential virulence factor. Intel. Prop. Rights. 4 (153), 2. Lee, C.T., Chen, I.T., Yang, Y.T., Ko, T.P., Huang, Y.T., Huang, J.Y., Huang, M.F., Lin, S.J., Chen, C.Y., Lin, S.S., Lightner, D.V., 2015. The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin. Proc. Natl. Acad. Sci. U. S. A. 112 (34), 10798–10803. Lomolino, M.V., Riddle, B.R., Brown, J.H., 2006. Biogeography. Sinauer Associates, Inc, Sunderland, Massachussetts. Mahoney, J.C., Gerding, M.J., Jones, S.H., Whistler, C.A., 2010. Comparison of the pathogenic potentials of environmental and clinical Vibrio parahaemolyticus strains indicates a role for temperature regulation in virulence. Appl. Environ. Microbiol. 76, 7459–7465. Matlawska-Wasowska, K., Finn, R., Mustel, A., O'Byrne, C.P., Baird, A.W., Coffey, E.T., Boyd, A., 2010. The Vibrio parahaemolyticus type III secretion systems manipulate host cell MAPK for critical steps in pathogenesis. BMC Microbiol. 10 (1), 329. Ming, X., Yamamoto, K., Honda, T., 1994. Construction and characterization of an

The dataset presented here indicate distribution of virulence genes under T3SS of V. parahaemolyticus isolated from environmental samples in India. We have reconfirmed that T3SS1 is well conserved in all V. parahaemolyticus strainsthough, the presence of genes under T3SS2 is sporadic and present in all tdh positive V. parahaemolyticus, isolated in the present study from moribund shrimp samples. It showed negative for AHPND and were positive for other virulence factor genes like tlh, vcrD1, vopD, vp1680 suggesting the association of some unknown virulence factor in shrimp mortality. 16S rRNA gene sequence analysis study further revealed that high genetic diversity in V. parahaemolyticus but a lack of genetic structure, a typical case of admixture of different population possibly due to interconnectivity of sampling localities or limited time for population to differentiate. Further, bacterial reproduction is rapid with a short generation time which along with random mutations and genetic recombination possibly helps V. parahaemolyticus evolve quickly and thereby increasing genetic diversity. Furthermore, the rapid evolution suggests that V. parahaemolyticus may adapt to new environments and drugs quickly. Conflict of interest The authors declare no conflict of interest. Acknowledgments This work was funded by the National Fisheries Development Board [NFDB] [G/Nat. Surveillance/2013 dated 16.08.2013], Hyderabad under “National Surveillance Program for Aquatic Animal Diseases [NSPAAD]” Project. The authors are also thankful to Mr. Asim Kumar Jana for helping in sampling and laboratory assistance. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2019.04.076. References Alam, M.J., Miyoshi, S.I., Shinoda, S., 2003. Studies on pathogenic Vibrio parahaemolyticus during a warm weather season in the Seto Inland Sea, Japan. Environ. Microbiol. 5 (8), 706–710. Avitia, M., Escalante, A.E., Rebollar, E.A., Moreno-Letelier, A., Eguiarte, L.E., Souza, V., 2014. Population expansions shared among coexisting bacterial lineages are revealed by genetic evidence. Peer J. 2, e696. Baker-Austin, C., Stockley, L., Rangdale, R., Martinez-Urtaza, J., 2010. Environmental occurrence and clinical impact of Vibrio vulnificus and Vibrio parahaemolyticus: a European perspective. Environ. Microbiol. Rep. 2 (1), 7–18. Behera, B.K., Paria, P., Das, A., Bhowmick, S., Sahoo, A.K., Das, B.K., 2017. Molecular characterization and pathogenicity of a virulent Acinetobacter baumannii associated with mortality of farmed Indian Major Carp Labeo Rohita (Hamilton 1822). Aquaculture 471, 157–162. Bej, A.K., Patterson, D.P., Brasher, C.W., Vickery, M.C., Jones, D.D., Kaysner, C.A., 1999. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. J. Microbiol. Methods 36 (3), 215–225. Burdette, D.L., Yarbrough, M.L., Orvedahl, A., Gilpin, C.J., Orth, K., 2008. Vibrio parahaemolyticus orchestrates a multifaceted host cell infection by induction of autophagy, cell rounding, and then cell lysis. Proc. Natl. Acad. Sci. U. S. A. 105, 12497–12500. Caburlotto, G., Gennari, M., Ghidini, V., Tafi, M., Lleo, M.M., 2009. Presence of T3SS2 and other virulence-related genes in tdh-negative Vibrio parahaemolyticus environmental strains isolated from marine samples in the area of the Venetian Lagoon, Italy. FEMS Microbiol. Ecol. 70 (3), 506–514. Caburlotto, G., Lleò, M.M., Hilton, T., Huq, A., Colwell, R.R., Kaper, J.B., 2010. Effect on human cells of environmental Vibrio parahaemolyticus strains carrying type III secretion system 2. Infect. Immun. 78 (7), 3280–3287. Chen, A.J., Hasan, N.A., Haley, B.J., Taviani, E., Tarnowski, M., Brohawn, K., Johnson, C.N., Colwell, R.R., Huq, A., 2017. Characterization of pathogenic Vibrio parahaemolyticus from the Chesapeake Bay, Maryland. Front. Microbiol. 8, 2460. Comas, I., Coscolla, M., Luo, T., Borrell, S., Holt, K.E., Kato-Maeda, M., Parkhill, J., Malla, B., Berg, S., Thwaites, G., Yeboah-Manu, D., Bothamley, G., Mei, J., Wei, L., Bentley, S., Harris, S.R., Niemann, S., Diel, R., Aseffa, A., Gao, Q., Young, D., Gagneux, S.,

110

Aquaculture 509 (2019) 104–111

P. Paria, et al.

polymorphism. Genetics 123 (3), 585–595. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Tey, Y.H., Jong, K.J., Fen, S.Y., Wong, H.C., 2015. Genetic variation in Vibrio parahaemolyticus isolated from the aquacultural environments. Lett. Appl. Microbiol. 60 (4), 321–327. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22 (22), 4673–4680. Tsai, S.E., Jong, K.J., Tey, Y.H., Yu, W.T., Chiou, C.S., Lee, Y.S., Wong, H.C., 2013. Molecular characterization of clinical and environmental Vibrio parahaemolyticus isolates in Taiwan. Int. J. Food Microbiol. 165, 18–26. Turner, J.W., Paranjpye, R.N., Landis, E.D., Biryukov, S.V., González-Escalona, N., Nilsson, W.B., Strom, M.S., 2013. Population structure of clinical and environmental Vibrio parahaemolyticus from the Pacific Northwest coast of the United States. PLoS One 8 (2), e55726. Vos, M., Velicer, G.J., 2006. Genetic population structure of the soil bacterium Myxococcus Xanthus at the centimeter scale. Appl. Environ. Microbiol. 72 (5), 3615–3625. Wang, R., Xiang, S., Feng, Y., Srinivas, S., Zhang, Y., Lin, M., Wang, S., 2013. Engineering production of functional scFv antibody in E. coli by co-expressing the molecule chaperone Skp. Front. Cell. Infect. Microbiol. 3, 72. Wang, H., Tang, X., Su, Y.C., Chen, J., Yan, J., 2017. Characterization of clinical Vibrio parahaemolyticus strains in Zhoushan, China, from 2013 to 2014. PLoS One 12 (7) p. e0180335. Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L.H., Karch, H., Reeves, P.R., Maiden, M.C.J., Ochman, H., Achtman, M., 2006. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol. 60 (5), 1136–1151. Yan, Y., Cui, Y., Han, H., Xiao, X., Wong, H.C., Tan, Y., Guo, Z., Liu, X., Yang, R., Zhou, D., 2011. Extended MLST-based population genetics and phylogeny of Vibrio parahaemolyticus with high levels of recombination. Int. J. Food Microbiol. 145 (1), 106–112. Zhang, L., Orth, K., 2013. Virulence determinants for Vibrio parahaemolyticus infection. Curr. Opin. Microbiol. 16 (1), 70–77. Zhang, L., Krachler, A.M., Broberg, C.A., Li, Y., Mirzaei, H., Gilpin, C.J., Orth, K., 2012. Type III effector VopC mediates invasion for Vibrio species. Cell Rep. 1 (5), 453–460. Zhang, Q., Dong, X., Chen, B., Zhang, Y., Zu, Y., Li, W., 2016. Zebrafish as a useful model for zoonotic Vibrio parahaemolyticus pathogenicity in fish and human. Dev. Comp. Immunol. 55, 159–168. Zhou, X., Konkel, M.E., Call, D.R., 2010. Vp1659 is a Vibrio parahaemolyticus type IIIsecretion system 1 protein that contributes to translocation of effector proteins needed to induce cytolysis, autophagy, and disruption of actin structure in HeLa cells. J. Bacteriol. 192 (13), 3491–3502.

isogenic mutant of Vibrio parahaemolyticus having a deletion in the thermostable direct hemolysin-related hemolysin gene (trh). J. Bacteriol. 176, 4757–4760. Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. Oxford University Press, New York. Noriea III, N.F., Johnson, C.N., Griffitt, K.J., Grimes, D.J., 2010. Distribution of type III secretion systems in Vibrio parahaemolyticus from the northern Gulf of Mexico. J. Appl. Microbiol. 109 (3), 953–962. Ono, T., Kwon-Sam, P., Ueta, M., Iida, T., Honda, T., 2006. Identification of proteins secreted via Vibrio parahaemolyticus type III secretion system 1. Infect. Immun. 74, 1032–1042. Park, K.S., Ono, T., Rokuda, M., Jang, M.H., Okada, K., Iida, T., Honda, T., 2004. Functional characterization of two type III secretion systems of Vibrio parahaemolyticus. Infect. Immun. 72 (11), 6659–6665. Phiwsaiya, K., Charoensapsri, W., Taengphu, S., Dong, H.T., Sangsuriya, P., Nguyen, G.T., Pham, H.Q., Amparyup, P., Sritunyalucksana, K., Taengchaiyaphum, S., Chaivisuthangkura, P., 2017. A natural Vibrio parahaemolyticus PirvpA−B+ mutant kills shrimp but produces no Pirvp toxins or AHPND lesions. Appl. Environ. Microbiol. 83 (16), e00680–17 (AEM-00680). Piñeyro, P., Zhou, X., Orfe, L.H., Friel, P.J., Lahmers, K., Call, D.R., 2010. Development of two animal models to study the function of Vibrio parahaemolyticus type III secretion systems. Infect. Immun. 78 (11), 4551–4559. Raghunath, P., 2015. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Front. Microbiol. 5, 805. Raghunath, P., Acharya, S., Bhanumathi, A., Karunasagar, I., Karunasagar, I., 2008. Detection and molecular characterization of Vibrio parahaemolyticus isolated from seafood harvested along the southwest coast of India. Food Microbiol. 25, 824–830. Ramos-Onsins, S.E., Rozas, J., 2002. Statistical properties of new neutrality tests against population growth. Mol. Biol. Evol. 19, 2092–2100. Rozas, J., Sánchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19 (18), 2496–2497. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd edn. CSH Laboratory Press, Cold Spring Harbor, pp. 62. Shimohata, T., Nakano, M., Lian, X., Shigeyama, T., Iba, H., Hamamoto, A., Yoshida, M., Harada, N., Yamamoto, H., Yamato, M., Mawatari, K., 2010. Vibrio parahaemolyticus infection induces modulation of IL-8 secretion through dual pathway via VP1680 in Caco-2 cells. J. Infect. Dis. 203 (4), 537–544. Sirikharin, R., Taengchaiyaphum, S., Sanguanrut, P., Chi, T.D., Mavichak, R., Proespraiwong, P., Nuangsaeng, B., Thitamadee, S., Flegel, T.W., Sritunyalucksana, K., 2015. Characterization and PCR detection of binary, Pir-like toxins from Vibrio parahaemolyticus isolates that cause acute hepatopancreatic necrosis disease (AHPND) in shrimp. PLoS One 10 (5), e0126987. Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA

111