Effect of Metals on Polycyclic Aromatic Hydrocarbon Induction of CYP1A1 and CYP1A2 in Human Hepatocyte Cultures

Toxicology and Applied Pharmacology 170, 93–103 (2001) doi:10.1006/taap.2000.9087, available online at http://www.idealibrary.com on

Effect of Metals on Polycyclic Aromatic Hydrocarbon Induction of CYP1A1 and CYP1A2 in Human Hepatocyte Cultures Dilip D. Vakharia,* Ning Liu,* Ronald Pause,* Michael Fasco,* ,† Erin Bessette,† Qing-Yu Zhang,* and Laurence S. Kaminsky* ,† ,1 *New York State Department of Health, Wadsworth Center, P.O. Box 509, Albany, New York 12201-0509; and †Department of Environmental Health and Toxicology, University at Albany, State University of New York, Albany, New York 12201-0509 Received August 16, 2000; accepted October 11, 2000

The majority of published studies of polycyclic aromatic hydrocarbon (PAH) 2 carcinogenicity has been conducted using individual PAH forms, yet human exposure is usually to mixtures of PAHs and other xenobiotics, most notably metals. Several recent reports highlight the ubiquity of PAH/metal mixtures in the global environment. Both PAHs and metals are ranked highly on the 1997 list of the most hazardous substances in the environment, prepared by the Agency for Toxic Substances and Disease Registry and the Environmental Protection Agency (ATSDR, 1997). Based on the three criteria of frequency of occurrence in the environment, toxicity, and potential exposure to humans, the top listed metals are arsenic, lead, mercury, and cadmium, and the toplisted PAHs are benzo[a]pyrene (BaP), benzo[b]fluoranthene (BbF), dibenzo[a,h]anthracene (DBahA), benzo[a]anthracene (BaA), and benzo[k]fluoranthene (BkF). These hazard priorities were the basis for the selection of the compounds for this study. The carcinogenicity of PAHs is based on their bioactivation to yield carcinogenic intermediates (Miller, 1998). Numerous studies of PAH carcinogenicity have revealed roles for cytochromes P450 (P450) (Guengerich, 1988), particularly CYP1A and 1B (Guengerich and Shimada, 1998), for microsomal epoxide hydrolase (Guengerich et al., 1996), and for specific structural features of the PAHs (Wood et al., 1981). In the case of BaP, a series of reactions catalyzed by P450, epoxide hydrolase, and P450 again, produced the ultimate carcinogenic form, the dihydrodiol epoxide (⫹)-(7R,8S)-dihydroxy-(9S,10R)epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (Beuning et al., 1978). The majority of studies designed to elucidate mechanisms of PAH bioactivation have been performed with rodent systems. The applicability of the results of such studies to humans has been addressed only recently (Kawajiri and Fujii-Kuriyama, 1991). Thus, human cDNA-expressed CYP1A1 and purified

Effect of Metals on Polycyclic Aromatic Hydrocarbon Induction of CYP1A1 and CYP1A2 in Human Hepatocyte Cultures. Vakharia, D. D., Liu, N., Pause, R., Fasco, M., Bessette, E., Zhang, Q-Y., and Kaminsky, L. S. (2001). Toxicol. Appl. Pharmacol. 170, 93–103. Environmental cocontamination by polycyclic aromatic hydrocarbons (PAHs) and metals could affect the carcinogenic consequences of PAH exposure by modifying PAH induction of PAHbioactivating CYP1A. The effect of As, Pb, Hg, or Cd (ranked as the most hazardous environmental metals by EPA and ATSDR) on CYP1A1 and 1A2 induction by benzo[a]pyrene (BaP), benzo[b]fluoranthene (BbF), dibenzo[a,h]anthracene (DBahA), benzo[a]anthracene (BaA), and benzo[k]fluoranthene (BkF) has thus been investigated in fresh human hepatocyte cultures. Induction was probed by ethoxyresorufin-O-deethylase activity, by immunoblots, and by RT–PCR. Uptake of PAHs into the hepatocytes varied according to PAH and liver donor: 84% of 5 ␮M BaA and 25– 40% of 5 ␮M DBahA was taken up in 24 h. Hepatocytes retained viability up to 1 ␮M Cd and 5 ␮M Pb, Hg, or As and 5 ␮M PAHs. PAH induction of CYP1A in hepatocytes was variable, some cultures expressed CYP1A1 and others CYP1A1 and 1A2, and to variable extents. Induction efficiency (relative to DMSO controls) at 2.5 ␮M PAH concentration was in the order BkF (7.6-fold) > DBahA (6.1 fold) > BaP (5.7 fold) > BbF (3.9-fold) > BaA (2.5-fold). All four metals (1–5 ␮M) decreased CYP1A1/1A2 induction by some of the PAHs with dose-, metal-, and PAHdependency. Arsenic (5 ␮M) decreased induction by 47% for BaP, 68% for BaA, 45% for BbF, 79% for BkF, and 53% for DBahA. Induced CYP1A2 protein was much more extensively decreased than 1A1 protein, and CYP1A2 mRNA and, to variable extents, CYP1A1 mRNA were decreased by As. Thus the metals in PAH/ metal mixtures could diminish PAH carcinogenicity by decreasing induction of their bioactivation by CYP1A1/1A2. © 2001 Academic Press Key Words: mercury; cadmium; arsenite; lead; mixtures; induction; human hepatocytes; CYP1A1; CYP1A2; polycyclic aromatic hydrocarbons.

2

Abbreviations used: BaA, benzo[a]anthracene; BaP, benzo[a]pyrene; BbF, benzo[b]fluoranthene; BkF, benzo[k]fluoranthene; CYP or P450, cytochrome P450; DBahA, dibenzo[a,h]anthracene; EROD, ethoxyresorufin-Odeethylase; ␣EW, ␣-modified Eagle’s and Waymouth medium; MTT, 3-[4,5dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; PAH, polycyclic aromatic hydrocarbon.

1

To whom correspondence should be addressed. E-mail: kaminsky@ wadsworth.org. 93

0041-008X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

94

VAKHARIA ET AL.

human CYP1A1 enhanced the genotoxicity of a proximate carcinogenic form of BaP (Shimada et al., 1992, 1994). cDNAexpressed CYP1A1 and CYP1A2 both catalyzed stereoselective epoxidation of a series of PAHs (Shou et al., 1996). A third member of the CYP1 family, human CYP1B1, has also recently been demonstrated to be capable of bioactivating PAH procarcinogens (Shimada et al., 1996; Kim et al., 1998). Several reports have implicated metals as modifiers of P450 function, thus implying that such metals could alter P450mediated PAH mutagenicity and carcinogenicity. The known effects of the listed metals on P450 function and regulation are limited primarily to rodent P450s. Data on metal effects on human P450s are extremely limited—CdCl 2 has been reported to induce human CYP1 transcription in HepG2 cell lines (Vincent et al., 1997) and Pb body burdens in children decreased 6␤-hydroxycortisol excretion, presumably due to decreased P450 activity (Saenger et al., 1984). In rats, CdCl 2 decreased total hepatic P450 levels and testosterone hydroxylase activity (Iszard et al., 1995; Clark et al., 1994). CdCl 2 also diminished hepatic CYP1A1 activity in rats (Iscan and Coban et al., 1992), mice (Iscan et al., 1995), and guinea pigs (Iscan et al., 1993). HgCl 2 decreased rat liver P450 levels in both phenobarbitaland 3-methylcholanthrene-treated mice, suggesting that several P450 forms were affected (Abbas-Ali, 1980). Lead has been reported to induce P450s in cultured rat hepatocytes (Canepa et al., 1985), but it decreased hepatic P450 and CYP1A1 mRNA in vivo in rats (Degawa et al., 1993; Roomi et al., 1986). Pb(NO 3) 2 prevented CYP1A2 induction in rat liver (Degawa et al., 1995). NaAsO 3 decreased total hepatic P450 levels in rats but did not affect 3-methylcholanthrene induction of CYP1A1 (Albores et al., 1989, 1992). We are undertaking an extensive investigation of the effects of PAH/metal mixtures on PAH mutagenicity and carcinogenicity. PAHs can enhance their carcinogenic potency by inducing the bioactivating P450s, thereby enhancing levels of bioactivated PAHs. Thus, any influence of metals in PAH/metal mixtures on the capacity of PAHs to induce bioactivating enzymes will influence their carcinogenicity. Investigations of such effects in human systems can be conducted only with human cell cultures, organ slices, or cell lines. We have previously reported on the effects of metals on the induction of CYP1A1 by PAHs in HepG2 cells (Vakharia et al., 2001). Primary cultures of human hepatocytes offer the principal model for investigations of the regulation mechanisms of human CYP1A, and this system has been extensively reviewed (Maurel, 1996; Ferrini et al., 1997). Despite the fact that CYP1A2 is the predominant CYP1A detected in human liver (Zhang et al., 1995; Pelkonen et al., 1998), reports on the forms of CYP1A expressed in human hepatocytes following induction by a variety of compounds, including PAHs, have been ambiguous. Recent reports have concluded either that only CYP1A2 was expressed (Ferrini et al., 1997; Greuet et al., 1997; George et al., 1997; Guille´n, 1998; Xu et al., 2000) or that only CYP1A1 was expressed (Delescluse et al., 1998;

Fontaine et al., 1999), and some did not differentitate between CYP1A1 and 1A2 (Li et al., 1997; Kern et al., 1997; Donato et al., 1998). We recently determined that the CYP1A forms induced by PAHs in human hepatocytes are dependent on the individual donors and can be CYP1A1 or CYP1A1 and 1A2 (Liu et al., 2001). In this paper we report studies to determine the capacity of the four prominent environmental metal contaminants As, Hg, Cd, and Pb to affect the induction of CYP1A1 and CYP1A2 by the five potential PAH cocontaminants, BaP, BaA, BkF, DBahA, and BbF in human hepatocyte cultures. MATERIALS AND METHODS Materials BaP, BaA, DBahA, BbF, and BkF were 99 –100% pure and were obtained from AccuStandard Inc. (New Haven, CT). A stock solution of each PAH was prepared by dissolving PAHs in dimethyl sulfoxide from Sigma (St. Louis, MO), and concentrations were determined in triplicate analyses with a published method (EPA Method 610; EPA, 1984). Sodium arsenite was obtained from Sigma, and lead nitrate, cadmium chloride, and mercury chloride (anhydrous beads) were obtained from Aldrich (Milwaukee, WI). All metal salts were 99 –100% pure. A 10-mM stock solution of each metal salt was prepared in deionized water, and concentrations of As, Cd, and Pb were determined by inductively coupled argon plasma atomic emission spectroscopy (EPA Method 200.7; EPA 1998), and Hg was determined by cold vapor atomic absorption spectroscopy (EPA Methods 245.1 and 245.2; EPA, 1998b). Stock solutions were stored at room temperature and dilutions were prepared just before use. Human Hepatocytes Fresh human hepatocytes were purchased from In Vitro Technologies (Baltimore, MD) and Tissue Transformation Technologies (Edison, NJ). The cells were plated on a collagen matrix at a cell density of 1 to 1.5 ⫻ 10 6 cells/well in 6-well plates and at a cell density of 3- to 5 ⫻ 10 4 cells/well in 96-well plates, which yielded confluent monolayers. At 48 h after plating, the hepatocyte cultures were treated with serum-free culture medium from In Vitro Technologies (see below) containing either DMSO (0.25%), PAH in DMSO, or PAH and metals in a total volume of 100 ␮l (96-well plates) or 2 ml (6 well plates) and were incubated for 24 h at 37°C under 5% CO 2 and 95% air. For some studies the treated cells were detached from the plates by treatment with trypsin (0.25% in calcium- and magnesium-free phosphate-buffered saline containing 0.05% EDTA). Cells were collected and were ultrasonicated for 3 ⫻ 10 s in 0.5 ml of 0.1 M Tris buffer, pH 7.4, containing 0.15 M NaCl, 15% glycerol, 1 mM EDTA, and 0.5 mM phenylmethyl sulfonyl fluoride. The cell extract was centrifuged at 9000g for 5 min to yield the supernatant S9 fraction. EROD Assay A published EROD activity assay in 96-well plates (Donato et al., 1993) was used with modifications. The culture medium in the wells was replaced with 100 ␮l/well of culture medium containing 8 ␮M 7-ethoxyresorufin from Sigma and a NAD(P)H-(quinone acceptor) oxidoreductase inhibitor (Lubet et al., 1985), dicoumarol (10 ␮M) (Donato et al., 1993), or salicylamide (3 mM) from Sigma. After a 45-min incubation at 37°C in a CO 2 incubator, 75 ␮l of culture media from each well was transferred to white, opaque 96-well plates supplied by Bioworld Lab Essentials, (Dublin, OH). ␤-Glucuronidase/sulfatase from Boehringer Mannheim Corp. (Indianapolis, IN) was diluted 1:100 in phosphate-buffered saline, pH 7.2, and 15 ␮l was added to each well. The plate was covered with SealPlate from Bioworld Lab Essentials to prevent evaporation of media and was incubated for 2 h at 37°C to hydrolyze any hydroxy resorufin conjugates. After 2 h, 100 ␮l of acetonitrile from J. T. Baker Inc.

PAH/METAL MIXTURES: EFFECT ON CYP1A1/1A2 INDUCTION (Phillipsburg, NJ) was added to each well and the plate was centrifuged at 1000g for 5 min. The fluorescence of the content in each well was measured using a luminescence spectrometer, LS50B, purchased from Perkin-Elmer (Norwalk, CT), with 530-nm excitation and 590-nm emission filters. To test the effects of PAHs and metals, the EROD activity assay was carried out using microsomes prepared from baculovirus-infected insect cells (supersomes) expressing human CYP1A2 obtained from Gentest Corp. (Woburn, MA). Reaction mixtures comprised 1 pmol of CYP1A2 in microsomes, 8 ␮M 7-ethoxyresofurin, and 1.3 mM of NADPH and were incubated for 10 min at room temperature. The fluorescence in the wells was read as previously described after reactions were terminated with 100 ␮l acetonitrile. The effects of individual metals (1–100 ␮M) and PAHs (1–10 ␮M) on CYP1A2 activity were determined using the EROD assay as described above. Measurement of Hepatocyte Viability Hepatocyte viability after treatment with PAHs or metals was determined by testing the capability of reducing enzymes present in viable cells to convert 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) to formazan crystals (Liu et al., 1997). Details are provided in a previous paper (Vakharia et al., 2000). Hepatocyte viability was also assessed using calcein AM from Molecular Probes Inc. (Eugene, OR) as substrate to detect esterase activity in the viable cells (Papadopoulos et al., 1994). Details of the method were previously reported (Vakharia et al., 2001). Optimization of PAH Induction of CYP1A1/1A2 in Hepatocytes PAH induction of CYP1A1 and CYP1A2 was optimized by varying the media, PAH concentrations, and incubation times with hepatocyte cells and using EROD activity as a probe. Media. One medium containing 5% fetal bovine serum and three without serum were used. ␣EW supplemented with 5% fetal bovine serum, penicillin (100 U/ml), streptomycin (100 ␮g/ml), and glutamine (2 mM) prepared by the media department of the Wadsworth Center was used. The other three serumfree media were obtained from In Vitro Technologies Inc. (cat. Z90009), Clonetics (San Diego, CA cat. CC3198-HCM Bulletkit), and the International Institute for the Advancement of Medicine (Scranton, PA) (serum-free hepatocyte culture medium). Concentrations of PAHs. Each PAH was tested over a range of micromolar concentrations. Metals. Preliminary experiments were performed to determine the maximum nontoxic concentration of each metal as assessed by the MTT and calcein methods. Subsequently, each metal was tested for its effect on PAH-induced EROD activity at nontoxic metal concentrations. Incubation time. EROD activity of hepatocytes induced by PAHs was tested at 24, 48, and 72 h after addition of PAH. Culture conditions. Cultures of hepatocytes plated in 96-well plates for 36 – 48 h were treated with the appropriate culture media containing DMSO (maximum concentration in media was 0.25%), individual PAHs, metals, or their mixtures in 100 ␮l volume and were incubated at 37°C in an incubator containing 5% CO 2 for the required duration. After the incubation time, the cells were probed for CYP1A induction by the EROD assay as described above. Uptake of PAH into Hepatocytes The uptake of BaA and DBahA present in 120 ␮l of medium by hepatocytes (seeded for 48 h at 3- to 5 ⫻ 10 4 cells/well in a 96-well plate) was determined for 0-, 1-, 3-, 8-, 15-, and 24-h incubations of the cells with PAH. To determine residual PAH, 100 ␮l medium was removed from triplicate wells at each time interval and each sample was solid-phase extracted by direct application to a Sep-Pak C18 cartridge purchased from Waters (Milford, MA). Cartridges were prewashed with methylene chloride (4 ⫻ 10 ml), methanol (4 ⫻ 10 ml), and

95

water (2 ⫻ 10 ml). The PAH-bound cartridge was then dried by drawing air through under vacuum and washed with water (10 ml); the PAH then was eluted with methylene chloride (10 ml). The methylene chloride extract was dried with sodium sulfate and evaporated to 1.0 ml under a stream of dry nitrogen. Acetonitrile (3.0 ml) was added to the methylene chloride extract, which was further concentrated under nitrogen to 0.5 ml. The extract was brought to 1.0 ml with acetonitrile. This solution was analyzed for PAH content by a HPLC method (EPA Method 610; EPA, 1984). Culture medium without PAH served as a negative control and the PAH-containing medium added directly to the Sep-Pak served as a positive control. To determine the uptake of PAHs into hepatocytes from the medium, the cells at the selected time intervals after removal of medium were washed with fresh PAH-free medium (120 ␮l). Cells were then incubated at 37°C for 5 min with 0.25% trypsin in PBS. Trypsinized cell suspension was transferred to a microtube with 100 ␮l medium and centrifuged at 13,800g for 5 min. The cell pellet was suspended in acetonitrile (500 ␮l) and ultrasonicated for 3 ⫻ 5 s. The cell lysate were centrifuged again at 13,800g for 5 min. The supernatant was analyzed for PAH concentration by HPLC (EPA Method 610; EPA 1984).

Immunoblot Analysis S9 fractions of human hepatocytes and cDNA-expressed CYP1A1 and -1A2 microsomal standards were separated by the NOVEX NuPAGE Bis–Tris Electrophoresis System using the Bis–Tris–HCl buffered polyacrylamide gel (with 10% acrylamide) as described by the manufacturer (NOVEX, San Diego, CA). Quantities of CYP1A1, CYP1A2, and S9 samples loaded are provided in the figure legends. The resolved proteins were electrophoretically transferred to PVDF membrane sheets, which were then treated with a blocking solution (5% Carnation nonfat dry milk in 0.2 M Tris buffer, pH 7.4, containing 0.15 M NaCl and 0.25% Tween-20) for 45 min at room temperature or overnight at 4°C. Membranes were incubated with a polyclonal goat anti-human CYP1A1/ 1A2 antibody (Gentest) or with a polyclonal rabbit anti-human selective rat CYP1A2 (Oxford Biomedical Res., Oxford, MI) in the blocking solution for an additional hour at room temperature or overnight at 4°C, washed with the buffer, and then incubated with a secondary antibody at 1:7500 dilution in the blocking solution. The secondary antibody was peroxidase-labeled rabbit antigoat IgG or goat anti-rabbit IgG and was detected with an enhanced chemiluminescence kit as described by the manufacturer (Pierce, Rockford, IL). Data were quantified with a Personal Densitometer SI (Molecular Dynamics, Sunnyvale, CA).

Reverse Transcriptase–Polymerase Chain Reaction Conditions used for the isolation of RNA and reverse transcription (OdT priming of 5 ␮g total RNA in a 20-␮l reaction) with Superscript II were as described previously (Fasco et al., 1995). Preparation of the CYP1A1 and CYP1A2 nucleotide sequences used as primer sets were also as described (Fasco et al., 1995). Primers for the “housekeeping gene” 36B4 were TGCTCAACATCTCCCCCTTCTC (forward primer) and ACCAAATCCCATATCCTGCTCC (reverse primer). Master mixes were used throughout. Amplifications were done in 25-␮l aliquots that contained 2.5 ␮l of a 10⫻ buffer (supplied); 2 ␮l MgCl 2 (supplied); 0.25 ␮l primer mixture (25 ␮M each in stock solution); 0.5 ␮l dNTP mixture (10 mM each base in stock solution); 0.5 ␮l Perkin–Elmer Taq⫹ Antibody (0.25 ␮l Perkin–Elmer Taq ⫹ 0.25 ␮l Clontech TaqStart Antibody); 0.125 ␮l Taq Extender (Stratagene); 0.25 ␮l 36B4 cDNA, or 0.5 ␮l CYP1A1 or CYP1A2 cDNA (from 0.125 ␮g total RNA); and water to 25 ␮l. Amplification mixtures were heated at 95°C for 1 min followed by 30 cycles of 95°C denaturation for 15 s, annealing at 65°C for 15 s, and extension at 72°C for 30 s. A 5-min incubation at 68°C followed the last cycle. Aliquots (10 ␮l) were separated in 1.5% agarose gels. The gel and separation buffer was 0.6% TBE containing 0.5 ␮g ethidium bromide/ml. A Kodak Digital EDAS 120 System was used to digitize and quantitate the bands. A low-mass DNA ladder (Gibco BRL) was employed as the external standard.

96

VAKHARIA ET AL.

FIG. 1. Effects of 100 ␮M sodium arsenite (As), cadmium chloride (Cd), mercury chloride (Hg), and lead nitrate (Pb) individually on the rate of human CYP1A2-catalyzed EROD activity. (Inset) Hg concentration (1.2 to 20 ␮M) dependence of the rate of CYP1A2-catalyzed EROD activity. CYP1A2 was cDNA-expressed in supersomes. Experimental details are provided under Materials and Methods. Values represent the mean ⫾ SD of triplicate determinations.

Calculations The fold induction of CYP1A activity following PAH stimulation was expressed as EROD activity (induced/control) and was calculated by determining the mean and standard deviations of the ratios of fluorescence values in wells treated with PAHs to wells treated with DMSO. Results were analyzed by Student’s t test (one tailed) at a level of significance of p ⬍ 0.05 using SigmaStat software from SPSS Inc. (Chicago, IL), as indicated in the figure legends.

RESULTS

Throughout these studies the metal ions investigated were administered as AsO 2⫺, Cd 2⫹, Hg 2⫹, and Pb 2⫹. For simplicity they are referred to as “metals” in the text. In all cases the salts were readily soluble in aqueous solution at the concentrations used.

ually on the CYP1A2-catalyzed EROD rates are shown in Fig. 1. As, Pb, and Cd each inhibited the reaction by approximately 10%, and Hg inhibited it by 98%. In Fig. 1 (inset), the inhibition of CYP1A2 EROD activity as a function of lower Hg concentrations is shown. At 1 ␮M Hg the CYP1A2 EROD reaction was inhibited by approximately 40%. The inhibitory effect of the five PAHs individually on CYP1A2 EROD activity as a function of PAH concentration (1 to 10 ␮M) is shown in Fig. 2. The PAHs exhibited varying inhibitory effects, with BaA yielding the greatest extent of inhibition (60% at 5 ␮M) and DBahA yielding the lowest (14% at 5 ␮M). Comparable data have previously been reported for the effects of metals and PAHs on the EROD activity of human CYP1A1 (Vakharia et al., 2001). PAH Uptake into Hepatocyte Cultures

EROD Assay To optimize the EROD assay and to determine the potential of the PAHs and the metals to inhibit CYP1A2 activity in the EROD assay in hepatocytes, CYP1A2 supersomes were used as a model system. EROD rates were saturated at 4 ␮M substrate concentration, and 8 ␮M ethoxyresorufin was used as substrate in subsequent studies. The effects of 100 ␮M concentrations of the metals individ-

Studies were conducted to determine the time dependence of PAH remaining in media after uptake by hepatocyte cultures and the PAH concentrations within hepatocytes. We demonstrated previously (Vakharia et al., 2001) that there was essentially no PAH uptake by the walls of the wells of the 96-well plates. The results are presented in Fig. 3 with BaA and DBahA as examples of PAHs. In a representative hepatocyte culture, approximately 84% of the BaA added to the medium

PAH/METAL MIXTURES: EFFECT ON CYP1A1/1A2 INDUCTION

FIG. 2. Effects of PAHs on the rates of human CYP1A2-catalyzed EROD activity over a range (0 –10 ␮M) of PAH concentrations. CYP1A2 was cDNA-expressed in supersomes. Experimental methods are provided under Materials and Methods. Values represent the mean ⫾ SD of triplicate determinations and are relative to rates in the presence of the PAH vehicle DMSO.

was taken up by the hepatocytes after 24 h in culture at 37°C. The maximum BaA level determined in the cells was 30% of the total in the medium, which was achieved after 3 h of incubation. Levels dropped thereafter, probably reflective of CYP1A-catalyzed metabolism. In the case of DBahA, in the same hepatocyte culture, only 25% was taken up by the hepatocytes after 24 h in culture, and the highest level achieved after 24 h that was determined in the hepatocytes was 10% of the DBahA added. Similar results were obtained with two

97

FIG. 4. Effect of sodium arsenite (As), cadmium chloride (Cd), mercury chloride (Hg), and lead nitrate (Pb) on human hepatocyte cell viability as a function of metal concentration. Viability was tested 24 h after treatment with a range (1–25 ␮M) of metal concentrations using the MTT assay. Values represent the mean ⫾ SD of triplicate determinations on hepatocytes from a representative donor. Experimental methods are presented under Materials and Methods. At 5 ␮M, As, Hg, or Pb cell viability was 72, 81, and 77%, respectively, and, at 1 ␮M, Cd cell viability was 111%. Triplicate control values varied by 2%.

other hepatocyte preparations. In one of these preparations, which provided a greater extent of PAH-mediated CYP1A induction than in the preparation described above, 40% of the DBahA was taken up by the hepatocytes, and the highest level of DBahA detected in the hepatocytes was 25% of the total added to the medium. Effect of Metals and PAHs on Hepatocyte Viability

FIG. 3. Uptake of BaA and DBahA from the medium by a representative batch of human hepatocytes in 96-well plate cultures incubated at 37°C, as a function of incubation period. Percent of added BaA (E) or DBahA (ƒ) remaining in the medium in the presence of hepatocytes; percent of added BaA (F) or DBahA () present in hepatocytes. Experimental methods are provided under Materials and Methods. Values represent the mean ⫾ SD of triplicate determinations.

The effects of the metals on hepatocyte viability were tested at 1, 5, 10, and 25 ␮M after a 24-h incubation using the MTT assay. The metals differentially affected viability (Fig. 4), but at a 1 ␮M concentration none of the metals affected hepatocyte viability. With the exception of Cd, which caused viability to decrease below 20%, the metals did not markedly affect hepatocyte viability at 5 ␮M concentrations. Subsequent studies were conducted at 5 ␮M As, Pb, and Hg, and 1 ␮M Cd. Viability studies with PAHs were limited to PAH concentrations of up to 10 ␮M—in excess of the highest level of subsequent hepatocyte exposure to PAH. Hepatocytes incubated for 24 h with 5 ␮M concentrations of each of the PAHs individually exhibited ⬎95% viability (data not shown). Cell viability studies with calcein AM yielded essentially the same results as with MTT, and the data are thus not shown. Induction of Hepatocyte CYP1A by PAHs Preliminary studies were conducted to optimize CYP1A induction in hepatocytes as probed by EROD activity. Two NAD(P)H-(quinone acceptor) oxidoreductase inhibitors were

98

VAKHARIA ET AL.

TABLE 1 Interindividual Variation (n ⴝ 5) in Human Hepatocyte CYP1A Induction by PAHs as Determined by EROD Activity PAH

Concentration (␮M)

Fold induction a

BaP BaA BbF BkF DBahA

8.1 2.3 6.1 3.5 1.5

5.7 ⫾ 4.2 (1.56–11.72) 3.8 ⫾ 1.4 (2.20–5.84) 2.1 ⫾ 2.3 (1.21–5.98) 9.7 ⫾ 8.3 (2.91–21.72) 7.4 ⫾ 3.8 (2.88–12.85)

a

FIG. 5. CYP1A1 and CYP1A2 induction in a representative culture of human hepatocytes by BaP, BaA, BbF, BkF, and DBahA individually over a range of concentrations (0 –5 ␮M) as determined by EROD activities after 24 h incubation at 37°C. Values represent mean ⫾ SD of triplicate determinations and are relative to values determined in the presence of the PAH vehicle DMSO. Experimental methods are presented under Materials and Methods. Triplicate vehicle controls varied by 3%.

tested; salicylamide at 3 mM inhibited EROD activity induced by BkF and BaP, relative to the activity in the presence of the inhibitor dicumarol at 10 ␮M. With BkF and BaP as inducing agents, ␤-glucuronidase/sulfatase produced no significant increase in EROD product, confirming that phase II conjugation was not a significant factor, and this hydrolysis step was thus not applied subsequently. Three of the four media tested with hepatocytes for PAH induction studies yielded essentially the same extent of induction, while one (International Institute for the Advancement of Medicine) appeared to suppress induction. Of the functionally equivalent media, the one supplemented with fetal bovine serum (␣EW) was not more effective than those that were serum free. The time course of induction at 24, 48, and 72 h of incubation showed no increase after 24 h, as exemplified with BbF induction, and, in fact, extents of induction decreased slightly after 24 h. Based on the data provided above, PAH induction studies of CYP1A1 and CYP1A2 in hepatocytes were conducted for 24 h with serum-free medium from In Vitro Technologies. The extent of CYP1A1 and CYP1A2 induction was determined using EROD activity. However, to more accurately gauge the relative CYP1A1 and CYP1A2 induction potencies of the PAHs in hepatocytes, quantitative immunoblotting was also undertaken. The apparent extent of CYP1A induction in one individual hepatocyte culture by the five PAHs as a function of PAH concentration, as gauged by EROD activity, is shown in Fig. 5. Induction efficiency (relative to DMSO controls) at 2.5 ␮M PAH concentration is in the order BkF (7.6-fold) ⬎ DBahA (6.1-fold) ⬎ BaP (5.7-fold) ⬎ BbF (3.9-fold) ⬎ BaA

Values are means ⫾ SD with ranges in parentheses.

(2.5-fold). The apparent decreases in induction at 5 ␮M relative to 2.5 ␮M PAH concentrations is due to PAH inhibition of EROD activity. There is extensive interindividual variation in the relative PAH inducibility of hepatocyte cultures and the extent of this variation can be gauged by the mean and standard deviations of induction data for five different hepatocyte cultures (Table 1). The extent of induction by 5 ␮M PAH as gauged by quantitation of immunoblots is shown in Fig. 6. The immunoblots are shown in Fig. 6 (inset). Induction efficiency at 5 ␮M PAH was in the order DBahA (11.7-fold) ⬎ BkF (6.7-fold) ⬎ BaP (3.3-fold) ⬎ BbF (2.0-fold) ⬎ BaA (1.0fold). With this hepatocyte culture, only induced CYP1A1 was detected by immunoblots. Since CYP1A was not detected by immunoblot analysis in cells that were treated with DMSO only, all PAH-mediated induction is reported relative to that induced by BaA set at 1. The effects of the metals (5 ␮M As, Pb, and Hg; 1 ␮M Cd)

FIG. 6. CYP1A1 induction in a representative culture of human hepatocytes by BaP, BaA, BbF, BkF, and DBahA individually at 5 ␮M as determined by quantitative immunoblot analysis of S9 fractions after 24 h incubation at 37°C. Experimental methods are presented under Materials and Methods. Data represent extents of induction relative to that achieved with BaA. (Inset) Immunoblots of CYP1A1 in hepatocytes treated with the PAHs individually at 5 ␮M. CYP1A1 and CYP1A2 were loaded at 0.010 and 0.013 pmol/well, respectively. S9 fractions were loaded at 25 ␮g protein/well.

PAH/METAL MIXTURES: EFFECT ON CYP1A1/1A2 INDUCTION

FIG. 7. Effects of sodium arsenite (5 ␮M), cadmium chloride (1 ␮M), mercury chloride (5 ␮M), or lead nitrate (5 ␮M) on levels of BaP-, BaA-, BbF-, BkF-, and DBahA-induced CYP1A1 and CYP1A2 in a representative culture of human hepatocytes after incubation for 24 h at 37°C. CYP1A1 and CYP1A2 induction was probed by EROD activity determinations. Values represent the mean ⫾ SD of triplicate determinations. Experimental methods are presented under Materials and Methods. *Significantly lower than rates in the absence of metals (p ⬍ 0.05). Control data were determined in the presence of PAH vehicle DMSO. PAH concentration, 5 ␮M.

on PAH-mediated induction of CYP1A in a representative hepatocyte culture, as determined by EROD activities, are shown in Fig. 7. All of the metals decreased the inductive capacity of some of the PAHs in a dose-dependent (data not shown), and metal- and PAH-dependent manner. The relative efficiency of decrease of EROD activity, and thus of CYP1A induction by all five PAHs, was in the order As ⬎ Pb ⬎ Hg. Note that, in Fig. 7, Cd is at a fivefold lower concentration than the other metals and thus cannot be ranked with them. Only Cd and Hg with BbF and BkF, and Cd with DBahA, did not significantly (p ⬍ 0.05) decrease the extents of CYP1A1 and CYP1A2 induction by the five PAHs. In the case of As (5 ␮M), the extents of PAH-mediated induction of CYP1A1 and CYP1A2 were decreased by 47% for BaP, 68% for BaA, 45% for BbF, 79% for BkF, and 53% for DBahA. The corresponding values for Pb (5 ␮M) were 39, 47, 29, 32, and 24%, respectively; for Hg (5 ␮M) they were 17, 26, 8, 1, and 20%, respectively; and for Cd (1 ␮M) they were 21, 19, 6, 0, and 0%, respectively. The effects of each of the four metals (1 ␮M) on the extent of induction of CYP1A1 in a different hepatocyte culture by BkF (5 ␮M), as determined by EROD activity and immunoblot analysis, is shown in Fig. 8. The effects of the metals on CYP1A1 protein and activity measurements are in close agreement and indicate that, in this hepatocyte culture, As is more effective than Cd, Hg, or Pb in decreasing PAH induction effects. In another hepatocyte culture, As (1 or 5 ␮M) exhibited a dose-related decrease in the extent of CYP1A1 and CYP1A2 induction, as determined by immunoblot analysis (Fig. 9). In this hepatocyte culture, which expressed both CYP1A1 and 1A2 after PAH induction, CYP1A2

99

FIG. 8. Effects of sodium aresenite (As), cadmium chloride (Cd), mercury chloride (Hg), or lead nitrate (Pb) at 1 ␮M concentration on BkF (5 ␮M)induced levels of CYP1A1 in a representative culture of human hepatocytes as assessed by EROD activity and quantitation of CYP1A1 immunoblot analyses. EROD activity data are reported relative to values determined in the presence of the PAH vehicle DMSO. Experimental methods are presented under Materials and Methods. S9 fractions from the treated hepatocytes were loaded at 30 ␮g protein/well. *Significantly decreased relative to no metal treatment (p ⬍ 0.05) for EROD data only.

induction was decreased to a greater extent than CYP1A1. All of these studies were conducted with PAHs and metals coadministered. In studies where metals were administered at the time of addition of the 7-ethoxyresorufin substrate, no inhibitory effects of the metals on EROD activities were observed.

FIG. 9. Effects of sodium arsenite (As) at 1 and 5 ␮M on BkF (5 ␮M)-induced CYP1A1 and CYP1A2 levels in a representative culture of human hepatocytes, as assessed by immunoblot analysis. Experimental methods are presented under Materials and Methods. (Inset) Immunoblots of S9 fractions from BkF-induced hepatocytes with and without As (1 and 5 ␮M) treatment for 24 h. S9 fractions were loaded at 30 ␮g protein/well. CYP1A1 and CYP1A2 microsomes were loaded at 0.015 pmol/well.

100

VAKHARIA ET AL.

FIG. 10. Effects of BkF (3.5 ␮M) on CYP1A1 and CYP1A2 mRNA induction and of concomitantly administered As (5 ␮M) on this induction in a representative culture of human hepatocytes, as assessed by RT–PCR analysis. Control values are in the presence of the BkF vehicle DMSO. The concentrations of the mRNA of the “housekeeping” gene 36B4 are provided. Experimental methods are presented under Materials and Methods. *Significantly increased relative to levels in control hepatocytes (p ⬍ 0.05). **Significantly decreased relative to BkF-induced hepatocyte without As treatment (p ⬍ 0.05).

RT–PCR Analysis Triplicate RT–PCR analysis revealed that BkF (3.5–5 ␮M) for 24 h at 37°C induced CYP1A1 mRNA or CYP1A1 and CYP1A2 mRNA in the six hepatocyte cultures studied. The results for a representative hepatocyte culture are shown in Fig. 10. CYP1A1 mRNA was induced 2.6-fold and CYP1A2 mRNA was induced 3-fold. Sodium arsenite (5 ␮M) significantly (p ⬍ 0.05) decreased CYP1A2 mRNA levels by 49%, but did not significantly affect CYP1A1 mRNA levels when administered concomitantly with BkF in the medium. The data are presented in Fig. 10. Very similar results were obtained when mRNA levels were determined using CYP1A1 and -1A2 competitors with the same hepatocyte culture. In two other cultures, 3.5 ␮M BkF induced both CYP1A1 and CYP1A2 mRNAs. However, for these cultures the addition of 5 ␮M As to the medium significantly decreased both CYP1A1 and CYP1A2 mRNA in one case and did not significantly alter either in the other case. In three hepatocyte cultures, which did not exhibit CYP1A2 on immunoblotting after exposure to 5 ␮M BkF, no CYP1A2 mRNA was detected by RT–PCR. In all three cultures, 5 ␮M BkF strongly induced CYP1A1 mRNA and, when 5 ␮M As was also added, CYP1A1 mRNA was significantly and variably decreased. DISCUSSION

Since the carcinogenicity of PAHs is predicted on their bioactivation by CYPs, factors that influence this bioactivation will affect PAH carcinogenicity. This study was designed to

determine whether environmental cocontaminant metals alter the capacity of PAHs to induce human CYP1A subfamily members, which are the principal CYP enzymes involved in PAH bioactivation, although other CYPs, such as CYP3A4, play some role. Human hepatocytes offer the best vehicle to undertake studies on induction of human CYP1A, but they also suffer from several negative attributes. We have previously demonstrated that PAHs induce both CYP1A1 and CYP1A2 in human hepatocytes but to variable relative extents; many of the induced hepatocyte cultures tested only expressed immunblot-detectable CYP1A1 (Liu et al., 2001). This is at variance with the corresponding published data on fresh human liver in vitro, where CYP1A2 is usually the only CYP1A detected while CYP1A1 is additionally detected only very rarely. The hepatocyte CYP1A expression patterns in this study are induced patterns, while liver expression patterns are probably constitutive. Since there are no available data on induced CYP1A profiles in vivo in human liver, it cannot currently be determined whether hepatocytes model the liver in vivo. However, despite the fact that human hepatocytes lose constitutive CYP1A expression upon culturing, they clearly retain the capacity to be induced. There is no evidence to indicate that the mechanism of induction of CYP1A in hepatocytes is different from that in the liver in vivo, thus the metal effects observed here in the hepatocytes should represent the corresponding effects in vivo. The extent of PAH inducibility of CYP1A in human hepatocyte cultures also exhibits substantial interindividual variability, which impedes analysis of data. Additionally, fresh hepatocytes are usually available infrequently and unpredictably. EROD activity was selected as a probe for CYP1A1 and CYP1A2 induction because it provides a functional and specific assessment of CYP1A induction and because it is readily amenable to rapid throughput analysis (Donato et al., 1993; Kennedy and Jones, 1994). The assessment of CYP1A1 and CYP1A2 induction by EROD activity can, however, be confounded by the inducing agent or other test compounds inhibiting EROD activity (Petrulis and Bunce, 1999; Willet et al., 1998). Our data supported this and thus inhibitory effects of residual PAHs in hepatocytes after 24-h incubation do occur, and thereby give the impression of diminished inductive potency of the PAHs. However, at 1.25 ␮M PAH, the relative extents of induction by various PAHs of CYP1A, as assessed by EROD activity and immunoblot analysis, are very similar. The uptake from the medium of PAHs, over the 24-h incubation, varied as a function of specific hepatocyte culture and PAH. The hepatocyte preparation that exhibited the greatest uptake also exhibited the greatest extent of CYP1A induction as assessed by EROD activity, suggesting that interindividual variations in CYP1A inducibility by PAHs could possibly be caused by variable extents of PAH uptake. However, despite the much greater uptake of BaA than of DBahA by the hepatocyte cultures, DBahA was markedly more effective than

PAH/METAL MIXTURES: EFFECT ON CYP1A1/1A2 INDUCTION

BaA in inducing CYP1A in all of the hepatocyte preparations studied. This suggests that the inherent CYP1A induction capacity of DBahA is even higher than the relative induction data provided here would suggest. All of the PAHs used in this study induced CYP1A in the human hepatocytes. Even for this limited set of PAHs, the range in the extents of induction, as assessed by immunoblot analysis, was greater than 10-fold, with DBahA and BkF producing the greatest extents of induction and BaP, BaA, and BbF all being less effective. The induction potency of PAHs for CYP1A1 in rat hepatocyte cultures has been reported to vary in the order BkF ⬎ DBahA ⬎ BbF ⬎ BaP ⬎ BaA, with relative potencies of approximately 100:50:15:10:1 (Till et al., 1999). The rat and human systems thus display similar relative susceptibilities to CYP1A induction by PAHs, although the rat hepatocytes exhibit approximately 3- to 15-fold greater extents of CYP1A1 induction (relative to BaA induction set at 1) than was detected in the human hepatocytes. All four metals decreased the extent of CYP1A1 and CYP1A2 induction by some of the five PAHs in human hepatocytes as assessed by EROD activity. Arsenic was the most effective, followed by Pb, Cd, and Hg. As and Pb produced substantial decreases in the extents of induction, while Cd and Hg produced lower and more variable effects. With BkF as an example of a PAH inducer, all of the metals decreased the extent of induction of CYP1A as assessed by EROD activity and immunoblot analysis to similar extents. For the hepatocyte culture used for this latter study, only CYP1A1 protein, and not CYP1A2, was detected by immunoblot analysis. In another hepatocyte culture, which expressed both CYP1A and CYP1A2 protein on induction by BkF, both CYP1A1 and CYP1A2 protein levels were decreased dose dependently by As. For this hepatocyte culture, CYP1A2 protein was affected to a greater extent than CYP1A1. Clearly, the metals act to diminish PAH induction of human hepatocyte CYP1A1 and CYP1A2 by ultimately decreasing the levels of CYP1A protein normally attainable through PAH induction. The fact that CYP1A2 protein levels were decreased by a much greater extent implies that the two P450s are affected via differing mechanisms. We plan to conduct extensive studies to determine the mechanisms of metal-mediated decreases in the extent of PAH induction of human CYP1A1 and CYP1A2. To provide some preliminary insights, we determined the effect of As on BkFinduced levels of CYP1A1 mRNA and CYP1A2 mRNA in human hepatocytes using quantitative RT–PCR techniques. The results varied considerably between hepatocyte cultures. In all cases, BkF, as an example of a PAH, induced CYP1A1 mRNA and, in some cases, also CYP1A2 mRNA. In three hepatocyte cultures, the absence of detectable CYP1A2 protein 24 h after treatment with BkF coincided with the absence of detectable CYP1A2 mRNA. The variability in expression of CYP1A1 and CYP1A2 following treatment by BkF is thus probably a consequence of transcriptional variability.

101

The effect of concomitantly administered As (5 ␮M) on the capacity of BkF to induce hepatocyte CYP1A1 and CYP1A2 mRNAs was also highly variable. Thus, for the representative culture shown in Fig. 10, only CYP1A2 mRNA levels and not CYP1A1 were decreased by As. However, in cultures where BkF did not induce CYP1A2 mRNA, As did significantly decrease the extent of BkF induction of CYP1A1 mRNA. These results suggest that, at least for As, the decrease in PAH induction of CYP1A2 is partially associated with decreased extents of transcription and that this could apply to CYP1A1 mRNA in some hepatocyte cultures. Published studies on CYP1A1 induction in chick embryo hepatocytes and rat hepatocytes suggest alternative mechanisms. Sodium arsenite inhibits 3-methylcholanthrene-mediated CYP1A induction in primary cultures of chick embryo hepatocytes (Jacobs et al., 1998). In this system the arsenite induced heme oxygenase, which could decrease CYP1A levels via degradation of its heme. We have recently demonstrated that, in human cells, As markedly induces heme oxygenase protein levels (unpublished data), and this offers another putative mechanism, in addition to transcriptional down-regulation, for decreased PAH induction by As. In a similar study, arsenite inhibited 3-methycholanthrene-mediated CYP1A induction in primary cultures of rat hepatocytes (Jacobs et al., 1999). Arsenite (5 ␮M) caused a 55% decrease in CYP1A1 protein and activity and a 25% decrease in CYP1A1 mRNA levels. It was concluded that arsenite-mediated increases in heme oxygenase were not solely responsible for CYP1A1 decreases (Jacobs et al., 1999). The latter study suggests a possible role for As-mediated regulation of CYP1A1 induction at the transcriptional level consistent with our data, but further studies are required to resolve these mechanisms. Based on the marked decreases in PAH-mediated CYP1A1 and CYP1A2 induction in human hepatocyte cultures brought about by concomitant exposure of the cells to the metals under investigation, it is reasonable to conclude that exposure to mixtures of PAHs and metals would be less effective in inducing CYP1A1, and to a greater extent CYP1A2, than exposure to PAHs alone. Since increased levels of CYP1A1 and CYP1A2 will lead to increased extents of bioactivation of PAHs with increased carcinogenic consequences, it is likely that chronic exposure to metal/PAH mixtures could diminish the carcinogenicity of the PAHs in the mixtures.

ACKNOWLEDGMENTS The authors are grateful to Ms. Jill Panetta for preparation of the manuscript. Although the research described in this article has been funded in part by the United States Environmental Protection Agency through Grant R827180010 to Laurence S. Kaminsky, it has not been subjected to the Agency’s required peer and policy review and therefore does not necessarily reflect the views of the Agency and no official endorsement should be inferred. N. Liu, who is affiliated with the Division of Environmental Health, Department of Preventive Medicine, Jiangxi Medical College, Nanchang, China, is grateful to The World

102

VAKHARIA ET AL.

Health Organization for support. The Molecular Genetics Core of the Wadsworth Center is acknowledged for the preparation of oligonucleotide primers.

REFERENCES Abbas-Ali, B. (1980). Effect of mercuric chloride on microsomal enzyme system in mouse liver. Pharmacology 21, 59 – 63. Albores, A., Cebrian, M. E., Bach, P. H., Connelly, J. C., Hinton, R. H., and Bridges, J. W. (1989). Sodium arsenite induced alterations in bilirubin excretion and heme metabolism. J. Biochem. Toxicol. 4, 73–78. Albores, A., Cebrian, M. E., Connelly, J. C., Bach, P. H., and Bridges, J. W. (1992). Effects of arsenite on hepatic mixed-function oxidase activity in rats. Xenobiotica 22, 591–597. ATSDR (1997). www.atsdr.cdc.gov/97list.html. Buening, M. K., Wislocki, P. G., Levin, W., Yagi, H., Thakker, D. R., Akagi, H., Koreeda, M., Jerina, D. M., and Conney, A. H. (1978). Tumorigenicity of the optical enantiomers of the diastereomeric benzo[a]pyrene 7,8-diol9,10-epoxides in newborn mice: Exceptional activity of (⫹)-7beta,8alphadihydroxy-9alpha,10alpha-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene. Proc. Natl. Acad. Sci. USA 75, 5358 –5361. Canepa, E. T., Llambias, E. B., and Grinstein, M. (1985). Effect of glucose on induction of delta-aminolevulinic acid synthase, ferrochelatase and cytochrome P-450 hemoproteins in isolated rat hepatocytes by phenobarbital and lead. Biochim. Biophys. Acta 841, 186 –194. Clark, J. T., Jimenez, B., Evans, S. L., Barrow, R., Winfree, M., and Mrotek, J. J. (1994). Cadmium-induced sexual dysfunction does not involve increased hepatic metabolism of testosterone nor increased circulating levels of corticosterone. Physiol. Behav. 56, 975–981. Degawa, M., Arai, H., Kubota, M., and Hashimoto, Y. (1995). Ionic lead, but not other ionic metals (Ni 2⫹, Co 2⫹ and Cd 2⫹), suppresses 2-methoxy-4aminoazobenzene-mediated cytochrome P450IA2 (CYP1A2) induction in rat liver. Biol. Pharm. Bull. 18, 1215–1218. Degawa, M., Arai, H., Miura, S., and Hashimoto, Y. (1993). Preferential inhibitions of hepatic P4501A2 expression and induction by lead nitrate in the rat. Carcinogenesis 14, 1091–1094. Delescluse, C., Ledirac, N., De Sousa, G., Pralavorio, M., Lesca, P., and Rahmani, R. (1998). Cytotoxic effects and induction of cytochromes P450 1A1/2 by insecticides, in hepatic or epidermal cells: Binding capability to the Ah receptor. Toxicol. Letts. 96 –97, 33–39. Donato, M. T., Go´mez-Lecho´n, M. J., and Castell, J. V. (1993). A microassay for measuring cytochrome P450IA1 and P450IIB1 activities in intact human and rat hepatocytes cultured on 96-well plates. Anal. Biochem. 213, 29 –33. Donato, M. T., Go´mez-Lecho´n, M. J., Jover, R., Nakamura, T., and Castell, J. V. (1998). Human hepatocyte growth factor down-regulates the expression of cytochrome P450 isozymes in human hepatocytes in primary culture. J. Pharmacol. Exp. Ther. 284, 760 –767. EPA (1984). Polynuclear aromatic hydrocarbons. EPA method 610. Fed. Reg. 49, 112–120. EPA (1998a). Determination of metals and trace elements in water and wastes by inductively coupled plasma-atomic emission spectrometry. EPA method 200.7. Approved Methods for Inorganic Chemicals. www.epa.gov/ OGWDW/methods.

primary cultures of adult human hepatocytes. Chem.–Biol. Interact. 107, 31– 45. Fontaine, F., Delescluse, C., De Sousa, G., Lesca, P., and Rahmani, R. (1999). Cytochrome 1A1 induction by primaquine in human hepatocytes and HepG2 cells: Absence of binding to the aryl hydrocarbon receptor. Biochem. Pharmacol. 57, 255–262. George, J., Goodwin, B., Liddle, C., Tapner, M., and Farrell, G. C. (1997). Time-dependent expression of cytochrome P450 genes in primary cultures of well-differentiated human hepatocytes. J. Lab. Clin. Med. 129, 638 – 648. Greuet, J., Pichard, L., Ourlin, J. C., Bonfils, C., Domergue, J., Le Treut, P., and Maurel, P. (1997). Effect of cell density and epidermal growth factor on the inducible expression of CYP3A and CYP1A genes in human hepatocytes in primary culture. Hepatology 25, 1166 –1175. Guengerich, F. P. (1988). Roles of cytochrome P-450 enzymes in chemical carcinogenesis and cancer chemotherapy. Cancer Res. 48, 2946 –2954. Guengerich, F. P., Johnson, W. W., Ueng, Y. F., Yamazaki, H., and Shimada, T. (1996). Involvement of cytochrome P450, glutathione S-transferase, and epoxide hydrolase in the metabolism of aflatoxin B 1 and relevance to risk of human liver cancer. Environ. Health Perspect. 104, 557–562. Guengerich, F. P., and Shimada, T. (1998). Activation of procarcinogens by human cytochrome P450 enzymes. Mutat. Res. Fundam. Mol. Mech. Mutagen. 400, 201–213. Guille´n, M. I., Donato, M. T., Jover, R., Castell, J. V., Fabra, R., Trullenque, R., and Go´mez-Lecho´n, M. J. (1998). Oncostatin M down-regulates basal and induced cytochromes P450 in human hepatocytes. J. Pharmacol. Exp. Ther. 285, 127–134. Iscan, M., and Coban, T. (1992). Combined effect of cadmium and nickel on rat hepatic monooxygenases: Possible stimulation of certain cytochrome P-450 isozymes. Toxicol. Lett. 62, 191–199. Iscan, M., Coban, T., and Eke, B. C. (1993). The responses of hepatic monooxygenases of guinea pig to cadmium and nickel. Biol. Trace Elem. Res. 38, 129 –137. Iscan, M., Coban, T., and Eke, B. C. (1995). Differential responses of hepatic monooxygenases and glutathione S-transferases of mice to a combination of cadmium and nickel. Comp. Biochem. Physiol. Part C Pharmacol. Toxicol. Endocrinol. 111, 61– 68. Iszard, M. B., Liu, J., and Klaassen, C. D. (1995). Effect of several metallothionein inducers on oxidative stress defense mechanisms in rats. Toxicology 104, 25–33. Jacobs, J., Roussel, R., Roberts, M., Marek, D., Wood, S., Walton, H., Dwyer, B., Sinclair, P., and Sinclair, J. (1998). Effect of arsenite on induction of CYP1A and CYP2H in primary cultures of chick hepatocytes. Toxicol. Appl. Pharmacol. 150, 376 –382. Jacobs, J. M., Nichols, C. E., Andrew, A. S., Marek, D. E., Wood, S. G., Sinclair, P. R., Wrighton, S. A., Kostrubsky, V. E., and Sinclair, J. F. (1999). Effect of arsenite on induction of CYP1A, CYP2B, and CYP3A in primary cultures of rat hepatocytes. Toxicol. Appl. Pharmacol. 157, 51–59. Kawajiri, K., and Fujii-Kuriyama, Y. (1991). P450 and human cancer. Jpn. J. Cancer Res. 82, 1325–1335. Kennedy, S. W., and Jones, S. P. (1994). Simultaneous measurement of cytochrome P4501A catalytic activity and total protein concentration with a fluorescence plate reader. Anal. Biochem. 222, 217–223.

EPA (1998b). Determination of mercury in water by cold vapor atomic absorption spectrometry. EPA methods 245.1 and 245.2. Approved Methods for Inorganic Chemicals. www.epa.gov/OGWD/methods.

Kern, A., Bader, A., Pichlmayr, R., and Sewing, K. F. (1997). Drug metabolism in hepatocyte sandwich cultures of rats and humans. Biochem. Pharmacol. 54, 761–772.

Fasco, M. J., Treanor, C. P., Spivack, S., Figge, H. L., and Kaminsky, L. S. (1995). Quantitative RNA–polymerase chain reaction–DNA analysis by capillary electrophoresis and laser-induced fluorescence. Anal. Biochem. 224, 140 –147.

Kim, J. H., Stansbury, K. H., Walker, N. J., Trush, M. A., Strickland, P. T., and Sutter, T. R. (1998). Metabolism of benzo[a]pyrene and benzo[a]pyrene7,8-diol by human cytochrome P450 1B1. Carcinogenesis 19, 1847–1853.

Ferrini, J. B., Pichard, L., Domergue, J., and Maurel, P. (1997). Long-term

Li, A. P., Maurel, P., Gomez-Lechon, M. J., Cheng, L. C., and Jurima-Romet, M. (1997). Preclinical evaluation of drug– drug interaction potential: Present

PAH/METAL MIXTURES: EFFECT ON CYP1A1/1A2 INDUCTION status of the application of primary human hepatocytes in the evaluation of cytochrome P450 induction. Chem.–Biol. Interact. 107, 5–16. Liu, N., Zhang, Q-Y., Vakharia, D., Dunbar, D., and Kaminsky, L. S. (2001). Induction of CYP1A1 by benzo[k]fluoranthene in human hepatocytes: CYP1A1 or CYP1A2? In press. Liu, Y., Peterson, D. A., Kimura, H., and Schubert, D. (1997). Mechanism of cellular 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction. J. Neurochem. 69, 581–593. Lubet, R. A., Nims, R. W., Maye, R. T., Cameron, J. W., and Schechtman, L. M. (1985). Measurement of cytochrome P-450 dependent dealkylation of alkoxyphenoxazones in hepatic S9s and hepatocyte homogenates: Effects of dicumarol. Mutat. Res. 142, 127–131. Maurel, P. (1996). The use of adult human hepatocytes in primary culture and other in vitro systems to investigate drug metabolism in man. Adv. Drug Delivery Rev. 22, 105–132. Miller, J. A. (1998). The metabolism of xenobiotics to reactive electrophiles in chemical carcinogenesis and mutagenesis: A collaboration with Elizabeth Cavert Miller and our associates. Drug Metab. Rev. 30, 645– 674. Papadopoulos, N. G., Dedoussis, G. V., Spanakos, G., Gritzapis, A. D., Baxevanis, C. N., and Papamichail, M. (1994). An improved fluorescence assay for the determination of lymphocyte-mediated cytotoxicity using flow cytometry. J. Immunol. Methods 177, 101–111. Pelkonen, O., Ma¨enpa¨a¨, J., Taavitsainen, P., Rautio, A., and Raunio, H. (1998). Inhibition and induction of human cytochrome P450 (CYP) enzymes. Xenobiotica 28, 1203–1253. Petrulis, J. R., and Bunce, N. J. (1999). Competitive inhibition by inducer as a confounding factor in the use of the ethoxyresorufin-O-deethylase (EROD) assay to estimate exposure to dioxin-like compounds. Toxicol. Lett. 105, 251–260. Roomi, M. W., Columbano, A., Ledda-Columbano, G. M., and Sarma, D. S. (1986). Lead nitrate induces certain biochemical properties characteristic of hepatocyte nodules. Carcinogenesis 7, 1643–1646. Saenger, P., Markowitz, M. E., and Rosen, J. F. (1984). Depressed excretion of 6 beta-hydroxycortisol in lead-toxic children. J. Clin. Endocrinol. Metab. 58, 363–367. Shimada, T., Gillam, E. M. J., Sandhu, P., Guo, Z., Tukey, R. H., and Guengerich, F. P. (1994). Activation of procarcinogens by human cytochrome P450 enzymes expressed in Escherichia coli. Simplified bacterial systems for genotoxicity assays. Carcinogenesis 15, 2523–2529.

103

Shimada, T., Hayes, C. L., Yamazaki, H., Amin, S., Hecht, S. S., Guengerich, F. P., and Sutter, T. R. (1996). Activation of chemically diverse procarcinogens by human cytochrome P450 1B1. Cancer Res. 56, 2979 –2984. Shimada, T., Yun, C.-H., Yamazaki, H., Gautier, J.-C., Beaune, P. H., and Guengerich, F. P. (1992). Characterization of human lung microsomal cytochrome P-450 1A1 and its role in the oxidation of chemical carcinogens. Mol. Pharmacol. 41, 856 – 864. Shou, M., Gonzalez, F. J., and Gelboin, H. V. (1996). Stereoselective epoxidation and hydration at the K-region of polycyclic aromatic hydrocarbons by cDNA-expressed cytochromes P450 1A1, 1A2, and epoxide hydrolase. Biochemistry 35, 15807–15813. Till, M., Riebniger, D., Schmitz, H. J., and Schrenk, D. (1999). Potency of various polycyclic aromatic hydrocarbons as inducers of CYP1A1 in rat hepatocyte cultures. Chem.–Biol. Interact. 117, 135–150. Vakharia, D., Liu, N., Pause, R., Fasco, M., Bessette, E., Zhang, Q-Y., and Kaminsky, L. S. (2001). Polycyclic aromatic hydrocarbon (PAH)/metal mixtures: Effect on PAH induction of CYP1A1 in human HepG2 cells. In press. Vincent, R., Goegan, P., Johnson, G., Brook, J. R., Kumarathasan, P., Bouthillier, L., and Burnett, R. T. (1997). Regulation of promoter-cat stress genes in HepG2 cells by suspensions of particles from ambient air. Fundam. Appl. Toxicol. 39, 18 –32. Willett, K. L., Randerath, K., Zhou, G. D., and Safe, S. H. (1998). Inhibition of CYP1A1-dependent activity by the polynuclear aromatic hydrocarbon (PAH) fluoranthene. Biochem. Pharmacol. 55, 831– 839. Wood, A. W., Chang, R. L., Levin, W., Ryan, D. E., Thomas, P. E., Lehr, R. E., Kumar, S., Sardella, D. J., Boger, E., Yagi, H., Sayer, J. M., Jerina, D. M., and Conney, A. H. (1981). Mutagenicity of the bay-region diolepoxides and other benzo-ring derivatives of dibenzo(a,h)pyrene and dibenzo(a,i)pyrene. Cancer Res. 41, 2589 –2597. Xu, L., Li, A. P., Kaminski, D. L., and Ruh, M. F. (2000). 2,3,7,8-Tetrachlorodibenzo-p-dioxin induction of cytochrome P4501A in cultured rat and human hepatocytes. Chem.–Biol. Interact. 124, 173–189. Zhang, Z., Fasco, M. J., Huang, Z., Guengerich, F. P., and Kaminsky, L. S. (1995). Human cytochromes P4501A1 and P4501A2: R-warfarin metabolism as a probe. Drug Metab. Dispos. The Biological Fate of Chemicals 23, 1339 –1345.