- Email: [email protected]
Effect of troglitazone on CYP1A1 induction
Available online at www.sciencedirect.com
Toxicology 246 (2008) 166–171
Effect of troglitazone on CYP1A1 induction Hyung Gyun Kim 1 , Eun Hee Han 1 , Hye Gwang Jeong ∗ BK21 Project Team, Department of Pharmacy, College of Pharmacy, Research Center for Proteineous Materials, Chosun University, 375 Seosuk-dong, Gwangju 501-759, South Korea Received 11 December 2007; received in revised form 5 January 2008; accepted 7 January 2008 Available online 16 January 2008
Abstract Several peroxisome proliferators enhance CYP1A1 activity, but the mechanisms involved in this enhancement remain unknown. In this study, we examined the effect of troglitazone, a peroxisome proliferator-activated receptor-␥ (PPAR-␥) agonist, on CYP1A1 gene expression and explored the mechanisms involved in these effects. Troglitazone increased gene expression of CYP1A1 mRNA and also increased CYP1A1-specific 7ethoxyresorufin-O-deethylase (EROD) activity in a dose-dependent manner. Moreover, concomitant treatment with troglitazone and GW9662, a PPAR antagonist, markedly reduced the troglitazone-inducible EROD activity. Luciferase reporter assays using Hepa-1c1c7 cells showed a significant transactivation by troglitazone with a reporter plasmid containing a region from −1395 to +7 of the CYP1A1 gene. We found that a putative peroxisome proliferator-response element (PPRE) between −521 and −500 is located in the CYP1A1 gene promoter. Their inactivation by deletion mutagenesis suppressed the inductive effect of troglitazone on CYP1A1 promoter activation. Electrophoretic mobility shift assay revealed that troglitazone induced the activation of the PPAR-␥ to a form capable of binding specifically to the PPRE sequence of the CYP1A1 gene promoter. Furthermore, troglitazone increased the formation of the benzo[a]pyrene (BaP)–DNA adduct. Overall, our results suggest that troglitazone induces CYP1A1 enzyme activity and gene expression through PPAR-␥ activation, and may be involved in carcinogenesis. © 2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Troglitazone; CYP1A1; PPRE
1. Introduction Cytochrome P-450 (CYP) comprises a superfamily of enzymes that catalyze oxidation of numerous xenobiotic chemicals including drugs, toxic chemicals, and carcinogens, as well as endobiotic chemicals (Guengerich, 1995). Among these CYP enzymes, CYP1A1 is important in the metabolism of carcinogens such as polycyclic aromatic hydrocarbons (PAHs) and heterocyclic amines (Minsavage et al., 2004). Since overexpression of CYP1A1 induces metabolites of carcinogens such as benzo[a]pyrene (BaP), and these metabolites can covalently bind to DNA, potentially inducing mutagenesis and contributing to cancer susceptibility (Schwarz et al., 2001).
Abbreviations: AhR, aryl hydrocarbon receptor; ␣-NF, ␣-naphthoflavone; BaP, benzo[a]pyrene; CYP1A1, cytochrome P450 1A1; DRE, dioxin responsive element; EROD, 7-ethoxyresorufin-O-deethylase; PPAR-␥, peroxisome proliferator-activated receptor-␥; PPRE, peroxisome proliferator-responsive elements; PAHs, polycyclic aromatic hydrocarbons; RXR, retinoid X receptor. ∗ Corresponding author. Tel.: +82 62 230 6639; fax: +82 62 230 6639. E-mail address: [email protected] (H.G. Jeong). 1 These authors contributed equally to this work. 0300-483X/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.tox.2008.01.003
It is known that the induction of CYP1A1 transcription by PAHs such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is mediated by the cytosolic aryl hydrocarbon receptor (AhR), which is a ligand-activated transcription factor (Brotons et al., 1995). However, it has been reported that activation of AhR transcription factor cannot always explain the observed CYP1A1 induction. For instance, WY-14643, a specific peroxisome proliferator-activated receptor (PPAR)-␣ ligand, induces CYP1A1 gene regulation through AhR independent pathway (Seree et al., 2004). Moreover, recent some papers supported that PPAR-␥, belongs to the nuclear hormone receptor superfamily and functions as a ligand-dependent transcription factor (Willson et al., 2000), participates the biological mechanisms of the carcinogenic evolution by affecting proliferation and differentiation of various cancer cells, such as breast cancer, prostate cancer, and small cell lung carcinoma (Fajas et al., 2001; Theocharis et al., 2002; Watkins et al., 2004). The aim of this study was to evaluate the effect of troglitazone, a specific PPAR-␥ ligand, on CYP1A1 expression in Hepa-1c1c7 cells and tao BpRc1 cells. Since tao BpRc1 cells express low levels of cytosolic and nuclear AhR complex,
H.G. Kim et al. / Toxicology 246 (2008) 166–171
it may be a good model system for screening that CYP1A1 induction of AhR independent pathway (Swanson et al., 1995). Here, we found that CYP1A1 is highly induced by troglitazone. This induction specifically involves the transcription factor PPAR-␥ and requires peroxisome proliferator-response element (PPRE) sites located within the CYP1A1 promoter. 2. Materials and methods 2.1. Chemicals and materials Troglitazone, ellipticine, GW9662, and ␣-naphthoflavone (␣-NF) were obtained from Sigma Chemicals Co. 7-Ethoxyresorufin and resorufin were obtained from Pierce Chemical Co. TCDD was from Chemsyn Science Lab. MTT-based colorimetric assay kit from Roche Co. Lipofectamine Plus, ␣-minimal essential medium (␣-MEM), fetal bovine serum, and penicillin–streptomycin solution were from Life Technologies Inc. pCMV--gal was obtained from Clontech. [3 H]benzo[a]pyrene was purchased from Amersham Biosciences.
2.2. Cell culture, treatment, and cell viability assay The mouse hepatoma cell lines Hepa-1c1c7 and tao BpRc1 were obtained from the American Type Culture Collection (Rockville, MD). Non-responsive tao BpRc1 mutant cells are characterized by relatively low levels of cytosolic AhR and nuclear AhR complex (Miller et al., 1983). The cells were cultured in ␣-MEM supplemented with 10% fetal bovine serum at 37 ◦ C in a humidified 5% CO2 incubator. Both troglitazone and TCDD were dissolved in dimethylsulfoxide (DMSO). Stock solutions of these chemicals were added directly to the culture media for incubations. The control cells were treated with DMSO alone. The final concentration of these solvents never exceeded 0.2%, and did not have any noticeable effect on the assay systems. The cell viability was examined using a MTT assay according to the manufacturer’s instructions.
2.3. Plasmid constructs and vectors Plasmid pGL3-CYP1A1-Luc was created by inserting mouse CYP1A1 upstream regulatory region (−1395 to +7) PCR product into the pGL3 basic vector (Promega). Mouse genomic DNA was used as the template for the PCR reaction. The PCR product was first cloned into the pGEMT Easy Vector (Promega) and then subcloned into the pGL3 luciferase reporter plasmid. A deletion mutant of the CYP1A1 promoter-luciferase plasmid, pGL-CYP1A1 mPPRE (−500 to +7), in which the putative PPRE binding site was deleted, was also constructed by PCR-based methods.
2.4. 7-Ethoxyresorufin-O-deethylase (EROD) assay Hepa-1c1c7 cells were either untreated or treated with various concentrations of troglitazone for 18 h. After incubation, the medium was removed and the wells were washed twice with fresh medium. The EROD activity was determined in intact cells grown in 24-well plates, as described elsewhere (Ciolino et al., 1998). The fluorescence was measured 30 min using a FL600 ELISA reader (BIOTEK), with excitation at 530 nm and emission at 590 nm. A standard curve was constructed using resorufin.
2.5. RNA preparation and CYP1A1 mRNA analysis by RT-PCR Hepa-1c1c7 or tao BpRc1 cells were incubated with troglitazone for 8 h. Total cellular RNA was isolated by the acidic phenol extraction procedure reported by Chomczynski and Sacchi (1987). cDNA synthesis, semi-quantitative RT-PCR for CYP1A1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, and analysis of the results were performed as previously described (Oinonen et al., 1994). Cycle numbers that fell within the
167
exponential range of both CYP1A1 (302 bp, 26 cycles) and GAPDH (983 bp, 21 cycles) amplifications were used.
2.6. Transfection and luciferase and β-galactosidase assays Hepa-1c1c7 cells (2.5 × 105 ) were plated in each well of a 12-well plate in ␣-MEM supplemented with 10% FBS. After 12 h, the cells were then transfected using Lipofectamine Plus. Subsequently, the cells were co-transfected with 0.2 g of pCMV--gal and 1 g pGL3-CYP1A1-Luc or pGL-CYP1A1 mPPRE-Luc per well. Four hours after transfection, fresh ␣-MEM medium containing 10% FBS was added to the cells, which were treated with vehicle or troglitazone as indicated in the figures. Following 18 h exposure, the cells were washed once with 2-ml PBS and lysed. The lysed cell preparations were then centrifuged at 12,000 rpm for 10 min, and the supernatant was assayed for both luciferase and -galactosidase activity. Luciferase activity was determined using the luciferase assay system (Promega) according to the manufacturer’s instructions using a luminometer. The -galactosidase assay was carried out in 250 l of assay buffer containing 0.12 M Na2 HPO4, 0.08 M NaH2 PO4, 0.02 M KCl, 0.002 M MgCl2 , 0.1 M -mercaptoethanol, 50 g o-nitrophenyl--galactoside, and 100 g cell extract. The luciferase activity was normalized using the galactosidase activity, and was expressed as a proportion of the activity detected with the vehicle controls.
2.7. Electrophoretic mobility shift analysis Nuclear extracts were prepared and electrophoretic mobility shift analyses (EMSA) were performed as previously described (Jeong and Lee, 1998; Han et al., 2007). EMSA was performed with a typical PPAR response element (5 -CCGGCAAAACTAGGTCAAAGGTCA) or a putative PPAR response element derived from the mouse CYP1A1 gene (5 TGTCCTGTGACCTCTGGGCTGGGGTCGTTGCG). The bold face letters represent the PPRE binding sequence. Briefly, nuclear extract (5 l/10 mg protein) was mixed with 15 l HEDG, containing 1 mM dithiothreitol and 0.1 mM PMSF, and 1.0 g of poly(dI dC), and incubated for 20 min at 20 ◦ C before the addition of 1.0 l 32 P-labeled synthetic oligonucleotide (100,000 dpm). After additional 20 min incubation, samples were run on a 4% polyacrylamide gel with recirculating 1× TAE buffer (6.7 mM Tris–HCl (pH 8) containing 3.3 mM sodium acetate and 1.0 mM EDTA). The gel was vacuum dried and exposed at −80 ◦ C to X-ray film.
2.8. Measurement of BaP–DNA adduct formation Hepa-1c1c7 cells or tao BpRc1 cells were pretreated with troglitazone or TCDD and/or ellipticine for 18 h and then treated for the following 3 h with 0.5 M [3 H]BaP. The cells were washed twice with cold PBS, and trypsinized and pelleted. The nuclei were separated by incubating the cells for 10 min on ice in lysis buffer A (10 mM Tris–HCl pH 7.5, 320 mM sucrose, 5 mM magnesium chloride and 1% Triton X-100). The nuclei were collected after incubation by centrifugation at 5000 rpm for 10 min at 4 ◦ C. The nuclei were then lysed by adding 400 l lysis buffer B (1% SDS in 0.5 M Tris, 20 mM EDTA and 10 mM NaCl, pH 9), followed by treatment with 20 l proteinase K (20 mg/ml) for 2 h at 48 ◦ C. The samples were then allowed to cool to room temperature, and the residual protein was salted out by adding 150 l saturated NaCl. The samples were centrifuged at 13,000 rpm for 30 min at 4 ◦ C. The DNA was extracted, quantified and the amount of tritiated metabolite bound to the DNA was measured using a method described elsewhere (Sharma et al., 1994). The amount and purity of the extracted DNA was determined by measuring the absorbance at 260 nm/280 nm. DNA samples attaining a 260 nm/280 nm ratio of >1.9 were used for scintillation counting.
2.9. Statistical analysis All experiments were repeated at least three times to ensure reproducibility. The results are reported as means ± S.D. The data was analyzed using oneway ANOVA followed by Dunnett’s test for significance. A P-value <0.05 was considered significant.
168
H.G. Kim et al. / Toxicology 246 (2008) 166–171
3. Results 3.1. Cell viability of troglitazone on Hepa-1c1c7 cells and tao BpRc1 cells To determine the optimal concentrations to use in our studies, troglitazone was tested for potential cytotoxicity in Hepa-1c1c7 cells and tao BpRc1 cells. Fig. 1 shows that troglitazone at concentrations of 2, 10, 20 M did not affect cell viability. However, 50 and 80 M, the highest concentration tested, caused a 30 and 55% decrease in the cell viability. Therefore, all subsequent studies were conducted using concentrations of 2–20 M. 3.2. Induction of CYP1A1 gene expression and activity by troglitazone We investigated whether CYP1A1 induction by troglitazone in mouse hepatoma cells occurs through activation of PPAR-␥. In addition, the inducibilities of CYP1A1 mRNA by troglitazone in Hepa-1c1c7 cells and in the mutant cell line tao BpRc1, which expresses low levels of cytosolic and nuclear AhR complex, were compared to determine if troglitazone requires an AhR independent system to induce CYP1A1. Exposure to troglitazone increased CYP1A1 mRNA levels in both Hepa-1c1c7 and tao BpRc1 cells (Fig. 2A and B). However, TCDD, a typical AhR, increased CYP1A1 mRNA levels in Hepa-1c1c7 cells, but not in tao BpRc1 cells. These results imply that troglitazone does not induce CYP1A1 through an AhR-dependent pathway since troglitazone induces CYP1A1 mRNA in the mutant cell line to the same extent as in the wild-type cell line. To determine whether the induction of CYP1A1 by troglitazone occurs through a PPAR-␥-dependent pathway, we examined the effect of the PPAR-␥ antagonist GW9662 on CYP1A1 induction. GW9662 is a potent, selective antagonist that binds irreversibly to the PPAR-␥ receptor. As shown in Fig. 3A, EROD activity increased significantly in cells treated with troglitazone. However, co-treatment with troglitazone and GW9662 significantly inhibited EROD activity compared to troglitazone alone. To study whether specific inhibitors or an
Fig. 2. Induction of CYP1A1 mRNA expression by troglitazone. (A) RT-PCR analysis of CYP1A1. Hepa-1c1c7 cells and tao BpRc1 mouse hepatoma cells were treated with troglitazone (M) or TCDD (5 nM) for 8 h, total RNA was prepared and RT-PCR was performed. The results shown are representative of three independent experiments. (B) Densitometric readings of CYP1A1 mRNA were normalized to GAPDH RNA and the average of three readings expressed as a percent of control mRNA. Each bar shows the mean ± S.D. of three independent experiments, performed in triplicate. *P < 0.05; significantly different from the control.
antagonist of either CYP1A1 or AhR are capable of reducing troglitazone-induced EROD activity, the cells were treated with either ellipticine, a specific CYP1A1 inhibitor (Chung et al., 2007), or ␣-NF, a specific AhR antagonist, before troglitazone exposure. As shown in Fig. 3B, troglitazone-induced EROD activity was only inhibited by ellipticine. However, TCDD-induced EROD activity was inhibited by both ␣-NF and ellipticine. Therefore, these results suggest that the induction of CYP1A1 gene expression and enzyme activity by troglitazone is PPAR-␥-dependent. 3.3. The role of troglitazone-induced transcriptional activation of CYP1A1 expression
Fig. 1. Effects of troglitazone on cell viability. The cell viability was tested 24 h after treatment of Hepa-1c1c7 cells and tao BpRc1 cells with troglitazone (0, 2, 10, 20, 50, and 80 M), by measuring the conversion of MTT to formazan crystals. Each bar shows the mean ± S.D. of three independent experiments, performed in triplicate. *P < 0.05; significantly different from the control.
To assess whether the effects of troglitazone can be attributed to direct action of PPAR-␥ on the CYP1A1 gene, we analyzed the mouse CYP1A1 promoter sequence using the MATCH program. This software is designed to search for potential transcription factor binding sites in the nucleotide sequence. The search revealed a putative PPAR/RXR binding site starting at position −521 relative to the transcription start site. To investigate the transcriptional activation of the CYP1A1 gene by troglitazone, luciferase assays were performed in which reporter plasmids containing the 5 -flanking region of the CYP1A1 gene were transiently transfected into Hepa-1c1c7 cells. The reporter activity
H.G. Kim et al. / Toxicology 246 (2008) 166–171
Fig. 3. Induction of EROD activity by troglitazone. Hepa-1c1c7 cells were treated with troglitazone (M) or TCDD (5 nM) in the absence or presence of (A) GW9662 (10 M), (B) ellipticine (5 M), or ␣-naphthoflavone (10 M) for 18 h. EROD activity was determined. Each bar shows the mean ± S.D. of three independent experiments performed in triplicate. *P < 0.05; significantly different from control. **P < 0.05; significantly different from troglitazone treatment alone.
of the −1395/+7 CYP1A1 promoter construct was induced by troglitazone treatment (Fig. 4A). In contrast, transcriptional activation was not observed with the −500/+7 CYP1A1 promoter construct (Fig. 4B), although TCDD induced transcriptional activation of this construct via the AhR signaling pathway. These results suggest that PPAR-␥ may be involved in the transcriptional activation of CYP1A1 by troglitazone.
169
Fig. 4. The effects of troglitazone on CYP1A1 promoter activity. Hepa-1c1c7 cells were transfected with pGL3-CYP1A1-Luc (A) or pGL-CYP1A1 mPPRE (B), and then treated with troglitazone (M) or TCDD (5 nM) for 18 h. Cells were then harvested and assayed for luciferase activity. Each bar shows the mean ± S.D. of three independent experiments performed in triplicate. *P < 0.05; significantly different from control.
3.4. Troglitazone associates with PPAR-γ–DNA complexes In order to demonstrate that troglitazone-induced activation of PPAR-␥ results in PPAR-␥ binding to the PPRE in the enhancer region of the CYP1A1 promoter, we performed EMSA experiments. We used a typical consensus PPRE and
Fig. 5. Effect of troglitazone on PPAR-␥ DNA-binding activity. Hepa-1c1c7 cells were treated with troglitazone (M). After 3-h treatment, nuclear extracts were isolated and used in electromobility shift assays with 32 P-labeled probes of a typical PPRE and the putative PPRE derived from the CYP1A1 promoter gene. COLD: 200-fold molar excess of non-labeled typical or putative PPRE.
170
H.G. Kim et al. / Toxicology 246 (2008) 166–171
the putative consensus PPRE sequence from the CYP1A1 gene, along with nuclear extracts from Hepa-1c1c7 cells. As shown in Fig. 5, troglitazone increased the binding of PPAR-␥ to both the typical consensus PPRE sequence and the putative PPRE consensus sequence from the CYP1A1 promoter. These results indicate that troglitazone-activated PPAR-␥ binds to the putative PPRE in the CYP1A1 gene.
cantly increased the BaP–DNA adduct formation in tao BpRc1 cells; however, TCDD did not affect BaP–DNA adduct formation in these cells (Fig. 6B). These results indicate that troglitazone increases BaP–DNA adduct formation by increasing CYP1A1 gene expression and enzyme activity.
3.5. Effects of troglitazone on BaP–DNA adduct formation
In this study, we investigated the effect of troglitazone, a PPAR-␥ agonist, on CYP1A1 gene expression and activity. We found that troglitazone increased CYP1A1 gene transcription and EROD activity through PPAR-␥ activation. To confirm that the effects of troglitazone treatment on CYP1A1 expression in Hepa-1c1c7 cells are PPAR-␥ dependent, we utilized the potent and selective PPAR-␥ antagonist GW9662. In the previous study, EROD activity is a convenient measure of CYP1A1 gene activity; indeed, EROD activity is commonly used to monitor CYP1A1 induction (Ciolino et al., 1998; Han et al., 2006). In our experiments, GW9662 significantly inhibited troglitazone-induced CYP1A1 gene expression and EROD activity. As evidence that AhR is not involved in troglitazoneinduced CYP1A1 upregulation, CYP1A1 mRNA expression was increased to the same extent in Hepa-1c1c7 cells and in the mutant cell line tao BpRc1, which expresses low levels of cytosolic AhR and nuclear AhR complex. To gain further insights into the mechanism of troglitazoneinduced CYP1A1 expression, we searched for PPAR-␥ binding sites in the mouse CYP1A1 promoter. By computational means, we identified a putative PPAR-␥ binding site that has not previously been reported; this putative site is between −530 and −500 relative to the transcription start site. The functionality of this potential binding site was verified by EMSA using the region of the CYP1A1 promoter that contains the putative PPRE as a probe. Troglitazone increased the binding of PPAR-␥ to the PPRE in the CYP1A1 promoter. Furthermore, sequence alignment of the CYP1A1 promoter from various species shows that the PPRE site is highly conserved in human, rat, and mouse species. Our results do not rule out the possibility that other mechanisms may also participate in CYP1A1 induction by troglitazone. Obviously, more studies are needed to fully elucidate the mechanism mediating troglitazone-induced CYP1A1 expression. There have been reports of liver toxicity in humans treated with troglitazone (Gitlin et al., 1998; Herrine and Choudhary, 1999). The mechanism of PPAR-␥ ligand-induced liver toxicity is not clear. Since troglitazone induces CYP3A4 (Ramachandran et al., 1999; Dimaraki and Jaffe, 2003), it has been hypothesized that potentially toxic quinones derived from CYP3A4-dependent metabolism could cause liver damage (Yamamoto et al., 2002). PPAR-␥ agonists have also been shown to induce terminal differentiation, cell-cycle arrest, and apoptosis in several types of cancer cells (DuBois et al., 1998; Mueller et al., 1998; Yamamoto et al., 2002 Heaney et al., 2002). However, the potential therapeutic value of PPAR-␥ agonists for treating cancers is controversial. PPAR-␥ activation by PPAR-␥ agonists enhances the development of colonic tumors in mice that have a mutation in the adenomatosis polyposis coli tumor
The formation of carcinogen–DNA adducts is a crucial step in the carcinogenic process. CYP1A1 is a key enzyme in the metabolism of BaP to DNA-binding metabolites (Whitlock, 1999). In order to test the effect of troglitazone on BaP metabolism, the formation of [3 H]BaP–DNA adducts were measured in Hepa-1c1c7 and tao BpRc1 cells. As shown in Fig. 6A, treatment with troglitazone and TCDD dosedependently increased the formation of BaP–DNA adducts in Hepa-1c1c7 cells. However, co-treatment with troglitazone and ellipticine, a specific CYP1A1 inhibitor, significantly inhibited BaP–DNA adduct formation. Similarly, troglitazone signifi-
Fig. 6. Effects of troglitazone on the formation of [3 H]BaP–DNA adducts. Hepa1c1c7 (A) and tao BpRc1 (B) cells were pretreated with troglitazone (M) or TCDD (5 nM) in the absence or presence of ellipticine (5 M) for 18 h and then treated for the next 3 h with [3 H]BaP. Genomic DNA was extracted, and [3 H]BaP–DNA adduct formation was determined by scintillation counting. Each bar shows the mean ± S.D. of three independent experiments performed in triplicate. *P < 0.05; significantly different from control. **P < 0.05; significantly different from troglitazone or TCDD treatment alone.
4. Discussion
H.G. Kim et al. / Toxicology 246 (2008) 166–171
suppressor gene (Lefebvre et al., 1998). Furthermore, PPAR-␥ signaling can reportedly act as a tumor promoter in mammary gland tumor (Saez et al., 2004). Interestingly, a recent report suggests that WY-14643, a specific PPAR-␣ ligand, can induce CYP1A1 in the CaCo2 and HepG2 cell lines and in human keratinocytes (Seree et al., 2004). In this study, we demonstrated that troglitazone increases CYP1A1 expression and enzyme activity through PPAR-␥ activation. It is well known that CYP1A1 is largely involved in carcinogen bioactivation. Therefore, troglitazone may increase the genotoxic effect of carcinogens that are bioactivated by CYP1A1, such as PAH or arylamines (Voskoboinik et al., 1997). Moreover, cells that express higher levels of CYP1A1 might be more susceptible to the genotoxicity of CYP1A1-bioactivated carcinogens. In corroboration, our data indicate that troglitazone increases the formation of BaP–DNA adducts through increased CYP1A1 gene expression and enzyme activity. In conclusion, CYP1A1 is induced by troglitazone through PPAR-␥ binding to PPRE sites in the CYP1A1 promoter. This upregulation of CYP1A1 expression may be involved in PPAR-␥-mediated carcinogenesis. Acknowledgment This study was supported by research funds from Chosun University, 2008. References Brotons, J.A., Olea-Serrano, M.F., Villalobos, M., Pedraza, V., Olea, N., 1995. Xenoestrogens released from lacquer coatings in food cans. Environ. Health Perspect. 103, 608–612. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Chung, J.Y., Kim, J.Y., Kim, W.R., Lee, S.G., Kim, Y.J., Park, J.E., Hong, Y.P., Chun, Y.J., Park, Y.C., Oh, S., Yoo, K.S., Yoo, Y.H., Kim, J.M., 2007. Abundance of aryl hydrocarbon receptor potentiates benzo[a]pyreneinduced apoptosis in Hepa1c1c7 cells via CYP1A1 activation. Toxicology 235, 62–72. Ciolino, H.P., Wang, T.T., Yeh, G.C., 1998. Diosmin and diosmetin are agonists of the aryl hydrocarbon receptor that differentially affect cytochrome P450 1A1 activity. Cancer Res. 58, 2754–2760. Dimaraki, E.V., Jaffe, C.A., 2003. Troglitazone induces CYP3A4 activity leading to falsely abnormal dexamethasone suppression test. J. Clin. Endocrinol. Metab. 88, 3113–3116. DuBois, R.N., Gupta, R., Brockman, J., Reddy, B.S., Krakow, S.L., Lazar, M.A., 1998. The nuclear eicosanoid receptor, PPARgamma, is aberrantly expressed in colonic cancers. Carcinogenesis 19, 49–53. Fajas, L., Debril, M.B., Auwerx, J., 2001. Peroxisome proliferator-activated receptor-␥: from adipogenesis to carcinogenesis. J. Mol. Endocrinol. 27, 1–9. Gitlin, N., Julie, N.L., Spurr, C.L., Lim, K.N., Juarbe, H.M., 1998. Two cases of severe clinical and histologic hepatotoxicity associated with troglitazone. Ann. Intern. Med. 129, 36–38. Guengerich, F.P., 1995. Cytochrome P450 proteins and potential utilization in biodegradation. Environ. Health Perspect. 103 (S5), 25–28. Han, E.H., Kim, J.Y., Jeong, H.G., 2006. Effect of biochanin A on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells. Arch. Pharm. Res. 29, 570–576. Han, E.H., Hwang, Y.P., Jeong, T.C., Lee, S.S., Shin, J.G., Jeong, H.G., 2007. Eugenol inhibit 7,12-dimethylbenz[a]anthracene-induced genotoxicity in
171
MCF-7 cells: bifunctional effects on CYP1 and NAD(P)H:quinone oxidoreductase. FEBS Lett. 581, 749–756. Heaney, A.P., Fernando, M., Yong, W.H., Melmed, S., 2002. Functional PPARgamma receptor is a novel therapeutic target for ACTH-secreting pituitary adenomas. Nat. Med. 8, 1281–1287. Herrine, S.K., Choudhary, C., 1999. Severe hepatotoxicity associated with troglitazone. Ann. Intern. Med. 130, 163–164. Jeong, H.G., Lee, S.S., 1998. Suppressive effects of estradiol on 2,3,7,8tetrachlorodibenzo-p-dioxin-mediated transcriptional activation of murine Cyp1a-1 in mouse hepatoma Hepa 1c1c7 cells. Cancer Lett. 133, 177–184. Lefebvre, A.M., Chen, I., Desreumaux, P., Najib, J., Fruchart, J.C., Geboes, K., Briggs, M., Heyman, R., Auwerx, J., 1998. Activation of the peroxisome proliferator-activated receptor gamma promotes the development of colon tumors in C57BL/6J-APCMin/+ mice. Nat. Med. 4, 1053–1057. Miller, A.G., Israel, D., Whitlock Jr., J.P., 1983. Biochemical and genetic analysis of variant mouse hepatoma cells defective in the induction of benzo(a)pyrene-metabolizing enzyme activity. J. Biol. Chem. 258, 3523–3527. Minsavage, G.D., Park, S.K., Gasiewicz, T.A., 2004. The aryl hydrocarbon receptor (AhR) tyrosine 9, a residue that is essential for AhR DNA binding activity, is not a phosphoresidue but augments AhR phosphorylation. J. Biol. Chem. 279, 20582–20593. Mueller, E., Sarraf, P., Tontonoz, P., Evans, R.M., Martin, K.J., Zhang, M., Fletcher, C., Singer, S., Spiegelman, B.M., 1998. Terminal differentiation of human breast cancer through PPAR gamma. Mol. Cell 1, 465–470. Oinonen, T., Saarikoski, S., Husgafvel-Pursiainen, K., Hirvonen, A., Lindros, K.O., 1994. Pretranslational induction of cytochrome P4501A enzymes by beta-naphthoflavone and 3-methylcholanthrene occurs in different liver zones. Biochem. Pharmacol. 48, 2189–2197. Ramachandran, V., Kostrubsky, V.E., Komoroski, B.J., Zhang, S., Dorko, K., Esplen, J.E., Strom, S.C., Venkataramanan, R., 1999. Troglitazone increases cytochrome P-450 3A protein and activity in primary cultures of human hepatocytes. Drug Metab. Dispos. 27, 1194–1199. Saez, E., Rosenfeld, J., Livolsi, A., Olson, P., Lombardo, E., Nelson, M., Banayo, E., Cardiff, R.D., Izpisua-Belmonte, J.C., Evans, R.M., 2004. PPAR gamma signaling exacerbates mammary gland tumor development. Genes Dev. 18, 528–540. Schwarz, D., Kisselev, P., Cascorbi, I., Schunck, W.H., Roots, I., 2001. Differential metabolism of benzo[a]pyrene and benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 variants. Carcinogenesis 22, 453–459. Seree, E., Villard, P.H., Pascussi, J.M., Pineau, T., Maurel, P., Nguyen, Q.B., Fallone, F., Martin, P.M., Champion, S., Lacarelle, B., Savouret, J.F., Barra, Y., 2004. Evidence for a new human CYP1A1 regulation pathway involving PPAR-alpha and 2 PPRE sites. Gastroenterology 127, 1436–1445. Sharma, S., Stutzman, J.D., Kelloff, G.J., Steele, V.E., 1994. Screening of potential chemopreventive agents using biochemical markers of carcinogenesis. Cancer Res. 54, 5848–5855. Swanson, H.I., Chan, W.K., Bradfield, C.A., 1995. DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins. J. Biol. Chem. 270, 26292–26302. Theocharis, S., Kanelli, H., Politi, E., Margeli, A., Karkandaris, C., Philippides, T., Koutselinis, A., 2002. Expression of peroxisome proliferator activated receptor-␥ in non-small cell lung carcinoma: correlation with histological type and grade. Lung Cancer 36, 249–255. Voskoboinik, I., Ooi, S.G., Drew, R., Ahokas, J.T., 1997. Peroxisome proliferators increase the formation of BPDE–DNA adducts in isolated rat hepatocytes. Toxicology 122, 81–91. Watkins, G., Douglas-Jones, A., Mansel, R.E., Jiang, W.G., 2004. The localisation and reduction of nuclear staining of PPAR ␥ and PGC-1 in human breast cancer. Oncol. Rep. 12, 483–488. Whitlock Jr., J.P., 1999. Induction of cytochrome P4501A1. Ann. Rev. Pharmacol. Toxicol. 39, 103–125. Willson, T.M., Brown, P.J., Sternbach, D.D., Henke, B.R., 2000. The PPARs: from orphan receptors to drug discovery. J. Med. Chem. 43, 527–550. Yamamoto, Y., Yamazaki, H., Ikeda, T., Watanabe, T., Iwabuchi, H., Nakajima, M., Yokoi, T., 2002. Formation of a novel quinone epoxide metabolite of troglitazone with cytotoxicity to HepG2 cells. Drug Metab. Dispos. 30, 155–160.
Toxicology 246 (2008) 166–171
Effect of troglitazone on CYP1A1 induction Hyung Gyun Kim 1 , Eun Hee Han 1 , Hye Gwang Jeong ∗ BK21 Project Team, Department of Pharmacy, College of Pharmacy, Research Center for Proteineous Materials, Chosun University, 375 Seosuk-dong, Gwangju 501-759, South Korea Received 11 December 2007; received in revised form 5 January 2008; accepted 7 January 2008 Available online 16 January 2008
Abstract Several peroxisome proliferators enhance CYP1A1 activity, but the mechanisms involved in this enhancement remain unknown. In this study, we examined the effect of troglitazone, a peroxisome proliferator-activated receptor-␥ (PPAR-␥) agonist, on CYP1A1 gene expression and explored the mechanisms involved in these effects. Troglitazone increased gene expression of CYP1A1 mRNA and also increased CYP1A1-specific 7ethoxyresorufin-O-deethylase (EROD) activity in a dose-dependent manner. Moreover, concomitant treatment with troglitazone and GW9662, a PPAR antagonist, markedly reduced the troglitazone-inducible EROD activity. Luciferase reporter assays using Hepa-1c1c7 cells showed a significant transactivation by troglitazone with a reporter plasmid containing a region from −1395 to +7 of the CYP1A1 gene. We found that a putative peroxisome proliferator-response element (PPRE) between −521 and −500 is located in the CYP1A1 gene promoter. Their inactivation by deletion mutagenesis suppressed the inductive effect of troglitazone on CYP1A1 promoter activation. Electrophoretic mobility shift assay revealed that troglitazone induced the activation of the PPAR-␥ to a form capable of binding specifically to the PPRE sequence of the CYP1A1 gene promoter. Furthermore, troglitazone increased the formation of the benzo[a]pyrene (BaP)–DNA adduct. Overall, our results suggest that troglitazone induces CYP1A1 enzyme activity and gene expression through PPAR-␥ activation, and may be involved in carcinogenesis. © 2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Troglitazone; CYP1A1; PPRE
1. Introduction Cytochrome P-450 (CYP) comprises a superfamily of enzymes that catalyze oxidation of numerous xenobiotic chemicals including drugs, toxic chemicals, and carcinogens, as well as endobiotic chemicals (Guengerich, 1995). Among these CYP enzymes, CYP1A1 is important in the metabolism of carcinogens such as polycyclic aromatic hydrocarbons (PAHs) and heterocyclic amines (Minsavage et al., 2004). Since overexpression of CYP1A1 induces metabolites of carcinogens such as benzo[a]pyrene (BaP), and these metabolites can covalently bind to DNA, potentially inducing mutagenesis and contributing to cancer susceptibility (Schwarz et al., 2001).
Abbreviations: AhR, aryl hydrocarbon receptor; ␣-NF, ␣-naphthoflavone; BaP, benzo[a]pyrene; CYP1A1, cytochrome P450 1A1; DRE, dioxin responsive element; EROD, 7-ethoxyresorufin-O-deethylase; PPAR-␥, peroxisome proliferator-activated receptor-␥; PPRE, peroxisome proliferator-responsive elements; PAHs, polycyclic aromatic hydrocarbons; RXR, retinoid X receptor. ∗ Corresponding author. Tel.: +82 62 230 6639; fax: +82 62 230 6639. E-mail address: [email protected] (H.G. Jeong). 1 These authors contributed equally to this work. 0300-483X/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.tox.2008.01.003
It is known that the induction of CYP1A1 transcription by PAHs such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is mediated by the cytosolic aryl hydrocarbon receptor (AhR), which is a ligand-activated transcription factor (Brotons et al., 1995). However, it has been reported that activation of AhR transcription factor cannot always explain the observed CYP1A1 induction. For instance, WY-14643, a specific peroxisome proliferator-activated receptor (PPAR)-␣ ligand, induces CYP1A1 gene regulation through AhR independent pathway (Seree et al., 2004). Moreover, recent some papers supported that PPAR-␥, belongs to the nuclear hormone receptor superfamily and functions as a ligand-dependent transcription factor (Willson et al., 2000), participates the biological mechanisms of the carcinogenic evolution by affecting proliferation and differentiation of various cancer cells, such as breast cancer, prostate cancer, and small cell lung carcinoma (Fajas et al., 2001; Theocharis et al., 2002; Watkins et al., 2004). The aim of this study was to evaluate the effect of troglitazone, a specific PPAR-␥ ligand, on CYP1A1 expression in Hepa-1c1c7 cells and tao BpRc1 cells. Since tao BpRc1 cells express low levels of cytosolic and nuclear AhR complex,
H.G. Kim et al. / Toxicology 246 (2008) 166–171
it may be a good model system for screening that CYP1A1 induction of AhR independent pathway (Swanson et al., 1995). Here, we found that CYP1A1 is highly induced by troglitazone. This induction specifically involves the transcription factor PPAR-␥ and requires peroxisome proliferator-response element (PPRE) sites located within the CYP1A1 promoter. 2. Materials and methods 2.1. Chemicals and materials Troglitazone, ellipticine, GW9662, and ␣-naphthoflavone (␣-NF) were obtained from Sigma Chemicals Co. 7-Ethoxyresorufin and resorufin were obtained from Pierce Chemical Co. TCDD was from Chemsyn Science Lab. MTT-based colorimetric assay kit from Roche Co. Lipofectamine Plus, ␣-minimal essential medium (␣-MEM), fetal bovine serum, and penicillin–streptomycin solution were from Life Technologies Inc. pCMV--gal was obtained from Clontech. [3 H]benzo[a]pyrene was purchased from Amersham Biosciences.
2.2. Cell culture, treatment, and cell viability assay The mouse hepatoma cell lines Hepa-1c1c7 and tao BpRc1 were obtained from the American Type Culture Collection (Rockville, MD). Non-responsive tao BpRc1 mutant cells are characterized by relatively low levels of cytosolic AhR and nuclear AhR complex (Miller et al., 1983). The cells were cultured in ␣-MEM supplemented with 10% fetal bovine serum at 37 ◦ C in a humidified 5% CO2 incubator. Both troglitazone and TCDD were dissolved in dimethylsulfoxide (DMSO). Stock solutions of these chemicals were added directly to the culture media for incubations. The control cells were treated with DMSO alone. The final concentration of these solvents never exceeded 0.2%, and did not have any noticeable effect on the assay systems. The cell viability was examined using a MTT assay according to the manufacturer’s instructions.
2.3. Plasmid constructs and vectors Plasmid pGL3-CYP1A1-Luc was created by inserting mouse CYP1A1 upstream regulatory region (−1395 to +7) PCR product into the pGL3 basic vector (Promega). Mouse genomic DNA was used as the template for the PCR reaction. The PCR product was first cloned into the pGEMT Easy Vector (Promega) and then subcloned into the pGL3 luciferase reporter plasmid. A deletion mutant of the CYP1A1 promoter-luciferase plasmid, pGL-CYP1A1 mPPRE (−500 to +7), in which the putative PPRE binding site was deleted, was also constructed by PCR-based methods.
2.4. 7-Ethoxyresorufin-O-deethylase (EROD) assay Hepa-1c1c7 cells were either untreated or treated with various concentrations of troglitazone for 18 h. After incubation, the medium was removed and the wells were washed twice with fresh medium. The EROD activity was determined in intact cells grown in 24-well plates, as described elsewhere (Ciolino et al., 1998). The fluorescence was measured 30 min using a FL600 ELISA reader (BIOTEK), with excitation at 530 nm and emission at 590 nm. A standard curve was constructed using resorufin.
2.5. RNA preparation and CYP1A1 mRNA analysis by RT-PCR Hepa-1c1c7 or tao BpRc1 cells were incubated with troglitazone for 8 h. Total cellular RNA was isolated by the acidic phenol extraction procedure reported by Chomczynski and Sacchi (1987). cDNA synthesis, semi-quantitative RT-PCR for CYP1A1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, and analysis of the results were performed as previously described (Oinonen et al., 1994). Cycle numbers that fell within the
167
exponential range of both CYP1A1 (302 bp, 26 cycles) and GAPDH (983 bp, 21 cycles) amplifications were used.
2.6. Transfection and luciferase and β-galactosidase assays Hepa-1c1c7 cells (2.5 × 105 ) were plated in each well of a 12-well plate in ␣-MEM supplemented with 10% FBS. After 12 h, the cells were then transfected using Lipofectamine Plus. Subsequently, the cells were co-transfected with 0.2 g of pCMV--gal and 1 g pGL3-CYP1A1-Luc or pGL-CYP1A1 mPPRE-Luc per well. Four hours after transfection, fresh ␣-MEM medium containing 10% FBS was added to the cells, which were treated with vehicle or troglitazone as indicated in the figures. Following 18 h exposure, the cells were washed once with 2-ml PBS and lysed. The lysed cell preparations were then centrifuged at 12,000 rpm for 10 min, and the supernatant was assayed for both luciferase and -galactosidase activity. Luciferase activity was determined using the luciferase assay system (Promega) according to the manufacturer’s instructions using a luminometer. The -galactosidase assay was carried out in 250 l of assay buffer containing 0.12 M Na2 HPO4, 0.08 M NaH2 PO4, 0.02 M KCl, 0.002 M MgCl2 , 0.1 M -mercaptoethanol, 50 g o-nitrophenyl--galactoside, and 100 g cell extract. The luciferase activity was normalized using the galactosidase activity, and was expressed as a proportion of the activity detected with the vehicle controls.
2.7. Electrophoretic mobility shift analysis Nuclear extracts were prepared and electrophoretic mobility shift analyses (EMSA) were performed as previously described (Jeong and Lee, 1998; Han et al., 2007). EMSA was performed with a typical PPAR response element (5 -CCGGCAAAACTAGGTCAAAGGTCA) or a putative PPAR response element derived from the mouse CYP1A1 gene (5 TGTCCTGTGACCTCTGGGCTGGGGTCGTTGCG). The bold face letters represent the PPRE binding sequence. Briefly, nuclear extract (5 l/10 mg protein) was mixed with 15 l HEDG, containing 1 mM dithiothreitol and 0.1 mM PMSF, and 1.0 g of poly(dI dC), and incubated for 20 min at 20 ◦ C before the addition of 1.0 l 32 P-labeled synthetic oligonucleotide (100,000 dpm). After additional 20 min incubation, samples were run on a 4% polyacrylamide gel with recirculating 1× TAE buffer (6.7 mM Tris–HCl (pH 8) containing 3.3 mM sodium acetate and 1.0 mM EDTA). The gel was vacuum dried and exposed at −80 ◦ C to X-ray film.
2.8. Measurement of BaP–DNA adduct formation Hepa-1c1c7 cells or tao BpRc1 cells were pretreated with troglitazone or TCDD and/or ellipticine for 18 h and then treated for the following 3 h with 0.5 M [3 H]BaP. The cells were washed twice with cold PBS, and trypsinized and pelleted. The nuclei were separated by incubating the cells for 10 min on ice in lysis buffer A (10 mM Tris–HCl pH 7.5, 320 mM sucrose, 5 mM magnesium chloride and 1% Triton X-100). The nuclei were collected after incubation by centrifugation at 5000 rpm for 10 min at 4 ◦ C. The nuclei were then lysed by adding 400 l lysis buffer B (1% SDS in 0.5 M Tris, 20 mM EDTA and 10 mM NaCl, pH 9), followed by treatment with 20 l proteinase K (20 mg/ml) for 2 h at 48 ◦ C. The samples were then allowed to cool to room temperature, and the residual protein was salted out by adding 150 l saturated NaCl. The samples were centrifuged at 13,000 rpm for 30 min at 4 ◦ C. The DNA was extracted, quantified and the amount of tritiated metabolite bound to the DNA was measured using a method described elsewhere (Sharma et al., 1994). The amount and purity of the extracted DNA was determined by measuring the absorbance at 260 nm/280 nm. DNA samples attaining a 260 nm/280 nm ratio of >1.9 were used for scintillation counting.
2.9. Statistical analysis All experiments were repeated at least three times to ensure reproducibility. The results are reported as means ± S.D. The data was analyzed using oneway ANOVA followed by Dunnett’s test for significance. A P-value <0.05 was considered significant.
168
H.G. Kim et al. / Toxicology 246 (2008) 166–171
3. Results 3.1. Cell viability of troglitazone on Hepa-1c1c7 cells and tao BpRc1 cells To determine the optimal concentrations to use in our studies, troglitazone was tested for potential cytotoxicity in Hepa-1c1c7 cells and tao BpRc1 cells. Fig. 1 shows that troglitazone at concentrations of 2, 10, 20 M did not affect cell viability. However, 50 and 80 M, the highest concentration tested, caused a 30 and 55% decrease in the cell viability. Therefore, all subsequent studies were conducted using concentrations of 2–20 M. 3.2. Induction of CYP1A1 gene expression and activity by troglitazone We investigated whether CYP1A1 induction by troglitazone in mouse hepatoma cells occurs through activation of PPAR-␥. In addition, the inducibilities of CYP1A1 mRNA by troglitazone in Hepa-1c1c7 cells and in the mutant cell line tao BpRc1, which expresses low levels of cytosolic and nuclear AhR complex, were compared to determine if troglitazone requires an AhR independent system to induce CYP1A1. Exposure to troglitazone increased CYP1A1 mRNA levels in both Hepa-1c1c7 and tao BpRc1 cells (Fig. 2A and B). However, TCDD, a typical AhR, increased CYP1A1 mRNA levels in Hepa-1c1c7 cells, but not in tao BpRc1 cells. These results imply that troglitazone does not induce CYP1A1 through an AhR-dependent pathway since troglitazone induces CYP1A1 mRNA in the mutant cell line to the same extent as in the wild-type cell line. To determine whether the induction of CYP1A1 by troglitazone occurs through a PPAR-␥-dependent pathway, we examined the effect of the PPAR-␥ antagonist GW9662 on CYP1A1 induction. GW9662 is a potent, selective antagonist that binds irreversibly to the PPAR-␥ receptor. As shown in Fig. 3A, EROD activity increased significantly in cells treated with troglitazone. However, co-treatment with troglitazone and GW9662 significantly inhibited EROD activity compared to troglitazone alone. To study whether specific inhibitors or an
Fig. 2. Induction of CYP1A1 mRNA expression by troglitazone. (A) RT-PCR analysis of CYP1A1. Hepa-1c1c7 cells and tao BpRc1 mouse hepatoma cells were treated with troglitazone (M) or TCDD (5 nM) for 8 h, total RNA was prepared and RT-PCR was performed. The results shown are representative of three independent experiments. (B) Densitometric readings of CYP1A1 mRNA were normalized to GAPDH RNA and the average of three readings expressed as a percent of control mRNA. Each bar shows the mean ± S.D. of three independent experiments, performed in triplicate. *P < 0.05; significantly different from the control.
antagonist of either CYP1A1 or AhR are capable of reducing troglitazone-induced EROD activity, the cells were treated with either ellipticine, a specific CYP1A1 inhibitor (Chung et al., 2007), or ␣-NF, a specific AhR antagonist, before troglitazone exposure. As shown in Fig. 3B, troglitazone-induced EROD activity was only inhibited by ellipticine. However, TCDD-induced EROD activity was inhibited by both ␣-NF and ellipticine. Therefore, these results suggest that the induction of CYP1A1 gene expression and enzyme activity by troglitazone is PPAR-␥-dependent. 3.3. The role of troglitazone-induced transcriptional activation of CYP1A1 expression
Fig. 1. Effects of troglitazone on cell viability. The cell viability was tested 24 h after treatment of Hepa-1c1c7 cells and tao BpRc1 cells with troglitazone (0, 2, 10, 20, 50, and 80 M), by measuring the conversion of MTT to formazan crystals. Each bar shows the mean ± S.D. of three independent experiments, performed in triplicate. *P < 0.05; significantly different from the control.
To assess whether the effects of troglitazone can be attributed to direct action of PPAR-␥ on the CYP1A1 gene, we analyzed the mouse CYP1A1 promoter sequence using the MATCH program. This software is designed to search for potential transcription factor binding sites in the nucleotide sequence. The search revealed a putative PPAR/RXR binding site starting at position −521 relative to the transcription start site. To investigate the transcriptional activation of the CYP1A1 gene by troglitazone, luciferase assays were performed in which reporter plasmids containing the 5 -flanking region of the CYP1A1 gene were transiently transfected into Hepa-1c1c7 cells. The reporter activity
H.G. Kim et al. / Toxicology 246 (2008) 166–171
Fig. 3. Induction of EROD activity by troglitazone. Hepa-1c1c7 cells were treated with troglitazone (M) or TCDD (5 nM) in the absence or presence of (A) GW9662 (10 M), (B) ellipticine (5 M), or ␣-naphthoflavone (10 M) for 18 h. EROD activity was determined. Each bar shows the mean ± S.D. of three independent experiments performed in triplicate. *P < 0.05; significantly different from control. **P < 0.05; significantly different from troglitazone treatment alone.
of the −1395/+7 CYP1A1 promoter construct was induced by troglitazone treatment (Fig. 4A). In contrast, transcriptional activation was not observed with the −500/+7 CYP1A1 promoter construct (Fig. 4B), although TCDD induced transcriptional activation of this construct via the AhR signaling pathway. These results suggest that PPAR-␥ may be involved in the transcriptional activation of CYP1A1 by troglitazone.
169
Fig. 4. The effects of troglitazone on CYP1A1 promoter activity. Hepa-1c1c7 cells were transfected with pGL3-CYP1A1-Luc (A) or pGL-CYP1A1 mPPRE (B), and then treated with troglitazone (M) or TCDD (5 nM) for 18 h. Cells were then harvested and assayed for luciferase activity. Each bar shows the mean ± S.D. of three independent experiments performed in triplicate. *P < 0.05; significantly different from control.
3.4. Troglitazone associates with PPAR-γ–DNA complexes In order to demonstrate that troglitazone-induced activation of PPAR-␥ results in PPAR-␥ binding to the PPRE in the enhancer region of the CYP1A1 promoter, we performed EMSA experiments. We used a typical consensus PPRE and
Fig. 5. Effect of troglitazone on PPAR-␥ DNA-binding activity. Hepa-1c1c7 cells were treated with troglitazone (M). After 3-h treatment, nuclear extracts were isolated and used in electromobility shift assays with 32 P-labeled probes of a typical PPRE and the putative PPRE derived from the CYP1A1 promoter gene. COLD: 200-fold molar excess of non-labeled typical or putative PPRE.
170
H.G. Kim et al. / Toxicology 246 (2008) 166–171
the putative consensus PPRE sequence from the CYP1A1 gene, along with nuclear extracts from Hepa-1c1c7 cells. As shown in Fig. 5, troglitazone increased the binding of PPAR-␥ to both the typical consensus PPRE sequence and the putative PPRE consensus sequence from the CYP1A1 promoter. These results indicate that troglitazone-activated PPAR-␥ binds to the putative PPRE in the CYP1A1 gene.
cantly increased the BaP–DNA adduct formation in tao BpRc1 cells; however, TCDD did not affect BaP–DNA adduct formation in these cells (Fig. 6B). These results indicate that troglitazone increases BaP–DNA adduct formation by increasing CYP1A1 gene expression and enzyme activity.
3.5. Effects of troglitazone on BaP–DNA adduct formation
In this study, we investigated the effect of troglitazone, a PPAR-␥ agonist, on CYP1A1 gene expression and activity. We found that troglitazone increased CYP1A1 gene transcription and EROD activity through PPAR-␥ activation. To confirm that the effects of troglitazone treatment on CYP1A1 expression in Hepa-1c1c7 cells are PPAR-␥ dependent, we utilized the potent and selective PPAR-␥ antagonist GW9662. In the previous study, EROD activity is a convenient measure of CYP1A1 gene activity; indeed, EROD activity is commonly used to monitor CYP1A1 induction (Ciolino et al., 1998; Han et al., 2006). In our experiments, GW9662 significantly inhibited troglitazone-induced CYP1A1 gene expression and EROD activity. As evidence that AhR is not involved in troglitazoneinduced CYP1A1 upregulation, CYP1A1 mRNA expression was increased to the same extent in Hepa-1c1c7 cells and in the mutant cell line tao BpRc1, which expresses low levels of cytosolic AhR and nuclear AhR complex. To gain further insights into the mechanism of troglitazoneinduced CYP1A1 expression, we searched for PPAR-␥ binding sites in the mouse CYP1A1 promoter. By computational means, we identified a putative PPAR-␥ binding site that has not previously been reported; this putative site is between −530 and −500 relative to the transcription start site. The functionality of this potential binding site was verified by EMSA using the region of the CYP1A1 promoter that contains the putative PPRE as a probe. Troglitazone increased the binding of PPAR-␥ to the PPRE in the CYP1A1 promoter. Furthermore, sequence alignment of the CYP1A1 promoter from various species shows that the PPRE site is highly conserved in human, rat, and mouse species. Our results do not rule out the possibility that other mechanisms may also participate in CYP1A1 induction by troglitazone. Obviously, more studies are needed to fully elucidate the mechanism mediating troglitazone-induced CYP1A1 expression. There have been reports of liver toxicity in humans treated with troglitazone (Gitlin et al., 1998; Herrine and Choudhary, 1999). The mechanism of PPAR-␥ ligand-induced liver toxicity is not clear. Since troglitazone induces CYP3A4 (Ramachandran et al., 1999; Dimaraki and Jaffe, 2003), it has been hypothesized that potentially toxic quinones derived from CYP3A4-dependent metabolism could cause liver damage (Yamamoto et al., 2002). PPAR-␥ agonists have also been shown to induce terminal differentiation, cell-cycle arrest, and apoptosis in several types of cancer cells (DuBois et al., 1998; Mueller et al., 1998; Yamamoto et al., 2002 Heaney et al., 2002). However, the potential therapeutic value of PPAR-␥ agonists for treating cancers is controversial. PPAR-␥ activation by PPAR-␥ agonists enhances the development of colonic tumors in mice that have a mutation in the adenomatosis polyposis coli tumor
The formation of carcinogen–DNA adducts is a crucial step in the carcinogenic process. CYP1A1 is a key enzyme in the metabolism of BaP to DNA-binding metabolites (Whitlock, 1999). In order to test the effect of troglitazone on BaP metabolism, the formation of [3 H]BaP–DNA adducts were measured in Hepa-1c1c7 and tao BpRc1 cells. As shown in Fig. 6A, treatment with troglitazone and TCDD dosedependently increased the formation of BaP–DNA adducts in Hepa-1c1c7 cells. However, co-treatment with troglitazone and ellipticine, a specific CYP1A1 inhibitor, significantly inhibited BaP–DNA adduct formation. Similarly, troglitazone signifi-
Fig. 6. Effects of troglitazone on the formation of [3 H]BaP–DNA adducts. Hepa1c1c7 (A) and tao BpRc1 (B) cells were pretreated with troglitazone (M) or TCDD (5 nM) in the absence or presence of ellipticine (5 M) for 18 h and then treated for the next 3 h with [3 H]BaP. Genomic DNA was extracted, and [3 H]BaP–DNA adduct formation was determined by scintillation counting. Each bar shows the mean ± S.D. of three independent experiments performed in triplicate. *P < 0.05; significantly different from control. **P < 0.05; significantly different from troglitazone or TCDD treatment alone.
4. Discussion
H.G. Kim et al. / Toxicology 246 (2008) 166–171
suppressor gene (Lefebvre et al., 1998). Furthermore, PPAR-␥ signaling can reportedly act as a tumor promoter in mammary gland tumor (Saez et al., 2004). Interestingly, a recent report suggests that WY-14643, a specific PPAR-␣ ligand, can induce CYP1A1 in the CaCo2 and HepG2 cell lines and in human keratinocytes (Seree et al., 2004). In this study, we demonstrated that troglitazone increases CYP1A1 expression and enzyme activity through PPAR-␥ activation. It is well known that CYP1A1 is largely involved in carcinogen bioactivation. Therefore, troglitazone may increase the genotoxic effect of carcinogens that are bioactivated by CYP1A1, such as PAH or arylamines (Voskoboinik et al., 1997). Moreover, cells that express higher levels of CYP1A1 might be more susceptible to the genotoxicity of CYP1A1-bioactivated carcinogens. In corroboration, our data indicate that troglitazone increases the formation of BaP–DNA adducts through increased CYP1A1 gene expression and enzyme activity. In conclusion, CYP1A1 is induced by troglitazone through PPAR-␥ binding to PPRE sites in the CYP1A1 promoter. This upregulation of CYP1A1 expression may be involved in PPAR-␥-mediated carcinogenesis. Acknowledgment This study was supported by research funds from Chosun University, 2008. References Brotons, J.A., Olea-Serrano, M.F., Villalobos, M., Pedraza, V., Olea, N., 1995. Xenoestrogens released from lacquer coatings in food cans. Environ. Health Perspect. 103, 608–612. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Chung, J.Y., Kim, J.Y., Kim, W.R., Lee, S.G., Kim, Y.J., Park, J.E., Hong, Y.P., Chun, Y.J., Park, Y.C., Oh, S., Yoo, K.S., Yoo, Y.H., Kim, J.M., 2007. Abundance of aryl hydrocarbon receptor potentiates benzo[a]pyreneinduced apoptosis in Hepa1c1c7 cells via CYP1A1 activation. Toxicology 235, 62–72. Ciolino, H.P., Wang, T.T., Yeh, G.C., 1998. Diosmin and diosmetin are agonists of the aryl hydrocarbon receptor that differentially affect cytochrome P450 1A1 activity. Cancer Res. 58, 2754–2760. Dimaraki, E.V., Jaffe, C.A., 2003. Troglitazone induces CYP3A4 activity leading to falsely abnormal dexamethasone suppression test. J. Clin. Endocrinol. Metab. 88, 3113–3116. DuBois, R.N., Gupta, R., Brockman, J., Reddy, B.S., Krakow, S.L., Lazar, M.A., 1998. The nuclear eicosanoid receptor, PPARgamma, is aberrantly expressed in colonic cancers. Carcinogenesis 19, 49–53. Fajas, L., Debril, M.B., Auwerx, J., 2001. Peroxisome proliferator-activated receptor-␥: from adipogenesis to carcinogenesis. J. Mol. Endocrinol. 27, 1–9. Gitlin, N., Julie, N.L., Spurr, C.L., Lim, K.N., Juarbe, H.M., 1998. Two cases of severe clinical and histologic hepatotoxicity associated with troglitazone. Ann. Intern. Med. 129, 36–38. Guengerich, F.P., 1995. Cytochrome P450 proteins and potential utilization in biodegradation. Environ. Health Perspect. 103 (S5), 25–28. Han, E.H., Kim, J.Y., Jeong, H.G., 2006. Effect of biochanin A on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells. Arch. Pharm. Res. 29, 570–576. Han, E.H., Hwang, Y.P., Jeong, T.C., Lee, S.S., Shin, J.G., Jeong, H.G., 2007. Eugenol inhibit 7,12-dimethylbenz[a]anthracene-induced genotoxicity in
171
MCF-7 cells: bifunctional effects on CYP1 and NAD(P)H:quinone oxidoreductase. FEBS Lett. 581, 749–756. Heaney, A.P., Fernando, M., Yong, W.H., Melmed, S., 2002. Functional PPARgamma receptor is a novel therapeutic target for ACTH-secreting pituitary adenomas. Nat. Med. 8, 1281–1287. Herrine, S.K., Choudhary, C., 1999. Severe hepatotoxicity associated with troglitazone. Ann. Intern. Med. 130, 163–164. Jeong, H.G., Lee, S.S., 1998. Suppressive effects of estradiol on 2,3,7,8tetrachlorodibenzo-p-dioxin-mediated transcriptional activation of murine Cyp1a-1 in mouse hepatoma Hepa 1c1c7 cells. Cancer Lett. 133, 177–184. Lefebvre, A.M., Chen, I., Desreumaux, P., Najib, J., Fruchart, J.C., Geboes, K., Briggs, M., Heyman, R., Auwerx, J., 1998. Activation of the peroxisome proliferator-activated receptor gamma promotes the development of colon tumors in C57BL/6J-APCMin/+ mice. Nat. Med. 4, 1053–1057. Miller, A.G., Israel, D., Whitlock Jr., J.P., 1983. Biochemical and genetic analysis of variant mouse hepatoma cells defective in the induction of benzo(a)pyrene-metabolizing enzyme activity. J. Biol. Chem. 258, 3523–3527. Minsavage, G.D., Park, S.K., Gasiewicz, T.A., 2004. The aryl hydrocarbon receptor (AhR) tyrosine 9, a residue that is essential for AhR DNA binding activity, is not a phosphoresidue but augments AhR phosphorylation. J. Biol. Chem. 279, 20582–20593. Mueller, E., Sarraf, P., Tontonoz, P., Evans, R.M., Martin, K.J., Zhang, M., Fletcher, C., Singer, S., Spiegelman, B.M., 1998. Terminal differentiation of human breast cancer through PPAR gamma. Mol. Cell 1, 465–470. Oinonen, T., Saarikoski, S., Husgafvel-Pursiainen, K., Hirvonen, A., Lindros, K.O., 1994. Pretranslational induction of cytochrome P4501A enzymes by beta-naphthoflavone and 3-methylcholanthrene occurs in different liver zones. Biochem. Pharmacol. 48, 2189–2197. Ramachandran, V., Kostrubsky, V.E., Komoroski, B.J., Zhang, S., Dorko, K., Esplen, J.E., Strom, S.C., Venkataramanan, R., 1999. Troglitazone increases cytochrome P-450 3A protein and activity in primary cultures of human hepatocytes. Drug Metab. Dispos. 27, 1194–1199. Saez, E., Rosenfeld, J., Livolsi, A., Olson, P., Lombardo, E., Nelson, M., Banayo, E., Cardiff, R.D., Izpisua-Belmonte, J.C., Evans, R.M., 2004. PPAR gamma signaling exacerbates mammary gland tumor development. Genes Dev. 18, 528–540. Schwarz, D., Kisselev, P., Cascorbi, I., Schunck, W.H., Roots, I., 2001. Differential metabolism of benzo[a]pyrene and benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 variants. Carcinogenesis 22, 453–459. Seree, E., Villard, P.H., Pascussi, J.M., Pineau, T., Maurel, P., Nguyen, Q.B., Fallone, F., Martin, P.M., Champion, S., Lacarelle, B., Savouret, J.F., Barra, Y., 2004. Evidence for a new human CYP1A1 regulation pathway involving PPAR-alpha and 2 PPRE sites. Gastroenterology 127, 1436–1445. Sharma, S., Stutzman, J.D., Kelloff, G.J., Steele, V.E., 1994. Screening of potential chemopreventive agents using biochemical markers of carcinogenesis. Cancer Res. 54, 5848–5855. Swanson, H.I., Chan, W.K., Bradfield, C.A., 1995. DNA binding specificities and pairing rules of the Ah receptor, ARNT, and SIM proteins. J. Biol. Chem. 270, 26292–26302. Theocharis, S., Kanelli, H., Politi, E., Margeli, A., Karkandaris, C., Philippides, T., Koutselinis, A., 2002. Expression of peroxisome proliferator activated receptor-␥ in non-small cell lung carcinoma: correlation with histological type and grade. Lung Cancer 36, 249–255. Voskoboinik, I., Ooi, S.G., Drew, R., Ahokas, J.T., 1997. Peroxisome proliferators increase the formation of BPDE–DNA adducts in isolated rat hepatocytes. Toxicology 122, 81–91. Watkins, G., Douglas-Jones, A., Mansel, R.E., Jiang, W.G., 2004. The localisation and reduction of nuclear staining of PPAR ␥ and PGC-1 in human breast cancer. Oncol. Rep. 12, 483–488. Whitlock Jr., J.P., 1999. Induction of cytochrome P4501A1. Ann. Rev. Pharmacol. Toxicol. 39, 103–125. Willson, T.M., Brown, P.J., Sternbach, D.D., Henke, B.R., 2000. The PPARs: from orphan receptors to drug discovery. J. Med. Chem. 43, 527–550. Yamamoto, Y., Yamazaki, H., Ikeda, T., Watanabe, T., Iwabuchi, H., Nakajima, M., Yokoi, T., 2002. Formation of a novel quinone epoxide metabolite of troglitazone with cytotoxicity to HepG2 cells. Drug Metab. Dispos. 30, 155–160.