- Email: [email protected]
Effect of Vasocation Intestinal Peptide on Immune Privilege of the Rat Testis
Journal of Reproduction & Contraception
http://www.RandC.cn
2008 Mar; 19(1):1-8
[email protected]
·ORIGINAL PAPER·
Effect of Vasocation Intestinal Peptide on Immune Privilege of the Rat Testis Wei WANG, Ye-bin XI, Guang-jie CHEN, Jing HAO, Bao-guo WANG, Tian-wei SHEN, Li-hua JIANG, Wei-yi LI Shanghai Institute of Immunology, Shanghai Jiaotong University School of Medicine, Shanghai 200025, China
Objective To study the effect of vasocation intestinal peptide (VIP) on immune privilege of the rat testis. Methods The UU infected SD rats and Leydig cells were intervened by VIP, the secretion of TGF- β and the expression of FasL in rat Leydig cells were compared between VIP-intervened group and control group to test the effect of VIP on immune privilege of the rat testis in vitro and in vivo. Results In vitro, the secretion of TGF-β in Leydig cells could be increased by low dosage of VIP while inhibitited by high dosage of VIP; expression of FasL mRNA in Leydig cells could be decreased by VIP. In vivo, increased expression of TGF-β mRNA and decreased FasL mRNA were observed in VIP group in 2- 3 weeks after infected by UU. In addition, the apoptosis of Jurkat cells mediated by Leydig cells could be prevented by VIP. Conclusion When Leydig cells or testis infected by UU, VIP could regulate the immune function of rat Leydig cells and participate in the regulation of immune privilege of testis through the regulation of TGF- β secretion and FasL expression pattern of Leydig cells. Key words: vasocation intestinal peptide (VIP); Leydig cell; FasL; TFG-β; immune privilege Leydig cell, a kind of endocrine cell secreting androgen, plays an important physiological role in modulating the development and maturation of mankind sexual organs, in maintaining This study was supported by Shanghai Education Committee Science and Research Funds (04BB21) Corresponding author: Wei-yi LI; Tel: +86-21-63846590*776442; E-mail: [email protected] 1
the procreative, sexual function and secondary sexual characteristic of mankind[1,2]. Furthermore, Leydig cell could secret cytokines[3,4] and express surface molecules[5] which are crucial in maintaining and modulating the immune privilege of partial testicle. In addition, Leydig cell has important immune functions[6]. Vasocation intestinal peptide (VIP) is a transmitter of central and peripheral nervous system with important physiological role. As a multifunctional neurotransmitter and nervous regulatory factor in nervous and endocrine system, VIP plays complex role in immune microenvironment. And as an effective anti-inflammation factor, VIP could inhibite activated macrophage and monocyte. VIP could be produced by antigen-stimulated Th2 cell and mainly shows a anti-inflammatory action in adaptive immunity[7]. In recent years, many researches showed that VIP widely dispersed over the mucous membrane sufface of gastrointestinal tract, upper respiratory tract and genital meatus and play important immune regulatory functions. Our work is conducted to test the effect of VIP on immune privilege of the rat testis. We used VIP to intervene the UU infected SD rats and rat Leydig cells and compared the secretion of TGF-β and the expression of FasL in rat Leydig cells in VIP group and control group to evaluate the effect of VIP on immune privilege of the rat testis in vitro and in vivo.
Materials & Methods UU culture and titer confirmation Serum type 8 standard lines (T960) was donated by Doctor Robeston from the Institute of Microbiology and Infection of Canada Alberta University. Standard UU bacteria T960 (freeze-dried product) was resuscitated, then inoculated into UU medium (Shanghai Enkang) under germfree condition and incubated for 18-24 h at 37℃. The cultured UU (as described above) was double diluted in the period of logarithmic growth, inoculated into the 40- well plate for 48 h at 37℃, then the result was observed. The titer of UU was expressed as color-changing units(CCU/ml). The maximal dilution with color turned red was the titer of UU, which in our test was 1 × 105 CCU/ml. Induction of testis partial infection and VIP involvement protocol in vivo Male SD rats(weighted 150±7.4 g) were obtained from the Apartment of Science and Animal of Fudan University. The rat testis partial infection operation was processed as discribed with 0.3 ml UU suspending liquid [8]. In vivo experiments, rats were stochastically divided into 2 groups and there were 4 rats per group. One group was control group, in which the rats had been infected by UU. The other group was VIP group, in this group, the rats were also infected by UU, and before the day when were infected by UU, the rats had been intraperitoneally injected with 10 nmol VIP. 2
VIP preparation Each 300 µg VIP(Shanghai Boiasia Company) was dissolved into 9 ml PBS with glacial acetic acid（the ratio was 20∶1）, so the concentration of VIP solution was 0.033 g/L. Seperation and culture of Leydig cell The Leydig cell was seperated from male SD rats of 35 d old and cultured as discribed[8]. Stained with 3β-HSD, Leydig cells were observed through optical microscope and the results showed high pure rate and lively Leydig cells. After the density of cells was adjusted into 5 × 105/ml, 5 ml cell suspension was inoculated into cell culture flasks and cultured in LCM medium(Gibco BRL) and in the condition of 37℃ and 5% CO2 . Leydig cell could be cultured for 7 d continuously in vitro and growed well. Measurement of TGF-β Leydig cells were divided into 4 groups: control(UU infected group) and VIP group of high dosage (10-6mol/L), middle dosage (10-7 mol/L) and low dosage (10-8 mol/L), that is to add 100 µl, 10µl and 1 µl of prepared VIP solution into the cell suspension of each group separately. The cells were cultured for 8 hwith or without VIP, then added with 50 µl of UU(50 µl/ml of UU culture medium) and cultured for 56 h. The secration of TGF-β of Legdig cells was measured by ELISA( ELISA kit, R&D, lot:790129.2) in various group, respectively The result was analysed by SOFTmaxPRO analytical system. Flow cytometric analysis of FasL The Leydig cells were cultured for 8 h with(10-7 mol/L and 10-8 mol/L, respectively) or without VIP, then added with 50 µl of UU (50 µl/ml of UU culture medium) and cultured for 56 h. Washed with 20 g/L neonatal bovine serum(NBS, Hangzhou Sijiqing Biological Engineering Materials Co. LTD) and digested by tryspin, Leydig cells were then transfered into EP tubes. After incubated with anti-FasL mAb(4℃, 45 min) and FITC-conjugated IgG (4℃, 30 min)(both Santa Cruz), cell suspensions were fixed in 1% paraformaldehyde and analyzed on a FACSCalibur flow cytometer (FCM). mRNA analysis of TGF-β and FasL Total RNA was isolated from Leydig cells using TRIzol reagent box (Life Technology Company). Reverse transfer-PCR was used to determine TGF-β and FasL mRNA expression in isolated Leydig cells. Primer sequences were as follows: for β-actin (GenBank, GI: 55574), 5'-AGGCATCCTGACCCTGAAGTAC-3' (forward), 5'-TCTTCATGAGGTAGTCTGTCAG-3' (reverse); for TGF-β (GenBank, GI:55574), 5'- CCGCAACAACGCAATCTAT -3' (forward), 5'- GAAAGCCCTGTATTCCGTCTC -3'(reverse); for FasL (GenBank, GI:6978524), 5'-GGAATGGGAAGACACATATGGAACTGC-3'(forward), 5'CATATCTGG CCAGTAGTGCAGTAATTC-3'(reverse). The all primers were synthesized by the Shanghai SBSBio Company. Reverse transfer-copy reaction was processed following the instruction of First strand cDNA synthesis kit(Fermentas Company), total volume of RT reaction system was 20 µl. PCR reaction condition is shown in Table 1. 3
Table 1 PCR reaction condition cDNA
Quantity
β-actin
10.0 pmol
Condition 94℃ 20 s, 65℃ 30 s, 72℃1.5 min, 30 cycle, 72℃ 10 min
Length 389 bp
FasL
12.5 pmol
94℃ 20 s, 66℃ 30 s, 72℃1.5 min, 35 cycle, 72℃ 10 min
238 bp
TGF-β
10.0 pmol
94℃ 20 s, 65℃ 20 s, 72℃1.5 min, 30 cycle, 72℃ 10 min
308 bp
PCR-expanding products of β-actin, TGF-β and FasL of each group were added into a same piece of 1.5% gelose-gel and electrophoreseed for 45 min in the condition of l.5 V/cm, 0.5 × TBE buffer. The gelose-gel was then putted in GDS-UVP8000 gel imaging system (UVP, USA) gel-scanner to get the grey degree value and the ratio of FasL/β-actin and TGFβ/β-actin of each group were calculated to represent the expression of FasL and TGF-β. Culture of Jurkat cell with Leydig cell Jurkat cells(Shanghai Institute of Immunology) were cultured in RPMI-1640 (Gibco BRL)with 10% fetus serum(Hangzhou Sijiqing Biological Engineering Materials Co. LTD). Leydig cells were separated and infected with UU for 72 h, then the supernatants were discarded. Jurkat cells were cocultured with Leydig cells in the ratio of 2∶3 for 14 h in LCM medium(Gibco BRL) without fetus serum. Apoptosis test of Jurkat cell The apoptosis of Jurkat cells was tested following the instruction of the kit of AnnexinV/PI(BD), Jurkat cells were aspirated and washed twice with cooling PBS. The cells were suspended in 1×binding buffer and the density was adjusted into 1×106 cells/ml, 100 µl of the suspension (1×105 cells) was transferred to a 5 ml culture tube, then 5 µl Annexin V-FITC and 5 µl PI were added. The cells were then gently eddied and cultured in darkroom for 15 min at 25℃. Finally, 400 µl 1×binding buffer was added to each tube and do Fluorescence Activated Cell Sorter(FACS) within 1 h. All datas were analysed by Cellquest software. Statistic analysis The t-test by SAS6.04 software was applied to compare two samples’s average for statistical significance in all experiments. P<0.05 was considered to be significant difference.
Results Regulation of VIP on secretion of TGF-β in Leydig cell The results showed that the secretion of TGF-β in Leydig cells could be significantly increased by low dosage of VIP while inhibitited by high dosage of VIP (Table 2). Regulation of VIP on expression of FasL on Leydig cell After UU infected rat Leydig cell was intervened by VIP for 56 h, the expression of FasL on the cell was significantly changed no matter on protein level or on mRNA level. The PCR 4
Table 2 Regulation of VIP on secretion of TGF-β in Leydig cell Group Control
VIP dose(mol/L )
n
TGF-β contents (pg/ml) 94.75 ± 6.99 59.25 ± 4.35**
4
High
10-6
4
Middle
10-7
4
106.00 ± 2.58*
-8
4
117.75 ± 4.35**
Low
10
*: P<0.05, **: P<0.01, compared with control group
results showed that the expression of FasL was obviously decreased in VIP group with the low dosage of VIP had better inhibitition effect compared with control group (Figure1). The high dosage of VIP had no better inhibitition effect, so the result was not showed. The FCM analysis showed the corespondent results (Figure 2).
1: VIP 10-8 mol/L
2: control
3: β-actin
M: maker
Figure 1 The electrophoresis result of β-actin and FasL PCR product
Figure 2
The flow cytometric analysis
Regulation of VIP on mRNA expression of TGF-β and FasL in Leydig cell (in vivo) Leydig cells from control group and VIP group were isolated to test the mRNA expression of TGF-β and FasL. For TGF-β, the results showed that its expression was decreased in 1 week after infection while in 2 weeks and 3 weeks, it was increased by VIP 5
compared with control group. For FasL, its expression was slightly up-regulated by VIP in 1 week after infection while was significantly down-regulated in 2 weeks and in 3 weeks (Figure 3). 2.0 control The rate of expression
VIP-intervened 1.5
1.0
0.5
0.0 1
2
3
1
TGF-β
2
3
FasL Week post infection
Figure 3 Regulation of VIP on mRNA expression of TGF-β and FasL in Leydig cell in vivo
Regulation of VIP on Jurkat cell apoptosis induced by Leydig cell The apoptosis rate of Jurkat cell induced by UU infected Leydig cell was 44% while the rate was decreased into 37% and 34% in 10-7 mol/L of VIP group and 10-8 mol/L VIP group respectively which indicated that VIP could inhibit the apoptosis of Jurkat cell induced by Leydig cell with the low dosage which had more significant inhibition effect(Figure 4).
Figure 4 Regulation of VIP on Jurkat cell apoptosis induced by Leydig cell
Discussion Testis is an important immune privileged site, the maintainance of its immune privilege relays on the immune prevention function of TGF-β and apoptosis induced by FasL. Leydig 6
cell could secret many kinds of cytokines with biological effects including TGF-β which plays an important physiological role in maintaining and regulating microenvironment and immune previlege of testis. In addition, Leydig cell could express FasL in the natural condition which could induce the apoptosis of the Fas+ cells to regulate and maintain the immune privilege and maintain natural physiological balance. In our work, we used rat infection model to imitate the converse infection way of nature infection (from bladder up to testis)[9-11]. We observed the effect of VIP on regulation of the secretion of TGF-β and expression of FasL of UU infected rats and Leydig cells to test the effect of VIP on immune privilege of the rat testis in vitro and in vivo. In vitro, the secretion of TGF-β of UU infected Leydig cells could be significantly promoted by low dosage of VIP(10-7 mol/L and 10-8 mol/L) , which would indicate that one important mechanism of the regulation of VIP on regulating the immune response and immune privilege of testicular would be promoting the secretion of TGF-β[12]. In contrast, the secretion of TGF-β of UU infected Leydig cells could be inhibited by high dosage of VIP. The different effects of different dosages of VIP indicated the bi-directional characteristic of VIP on immune regulation. In vivo, the level of TGF-β in UU infected rats were firstly downregulated and then upregulated by VIP which may associate with the reverse feedback. In early time of infection, the down-regulation of TGF-β would be good for the anti-inflammation reaction, while in later time, the up-regulation of TGF-β would benefit the control of the intensity of anti-inflammation, the inducement of cell apoptosis and the maintainance of immune privilege of testis. In vitro, the expression of FasL of UU infected rat Leydig cell was down-regulated by different dosages of VIP no matter on mRNA level or on protain level with the low dosage of VIP had better inhibition effect. In vivo, the expression of FasL of UU infected rat Leydig cell was slightly up-regulated by VIP firstly but was significantly down-regulated laterly. The significance of this change may exist in that in early time of infection, the up-regulation of FasL expression would benefit the maintainance of immune privilege while its inhibition in later time would be good for anti-inflammation reaction which was corespondent to the result of inhibition of FasL expression by VIP in vitro. According to reaserch paper, the down-regulation of FasL expression on T cell by VIP may be regulated by the NF-κB, NFAT and Egr2/3, ect.[13,14]. It was also reported that VIP could inhibit activation and induce cell death(AICD) by preventing FasL expression on T cell[15-17]. So the effect of VIP on FasL expression is an immportant way to regulate immune privilege in testis. We also used different dosages of VIP to intervene UU infected rat Leydig cell to test the effect of VIP on regulation of apoptosis of Jurkat cell induced by Leydig cell. The results showed that the rate of apoptosis of Jurkat cell could be inhibited by different dosages of VIP with the low dosage which had more significant inhibition effect and was corespondent to the down-regulation of FasL expression on Leydig cell by VIP in vivo and in vitro. 7
In conclusion, when Leydig cells or testis infected by UU, VIP could regulate the immune function of rat Leydig cells and participate in the regulation of immune privilege of testis through the regulation of TGF-β secretion and FasL expression pattern of Leydig cells. This would be an important mechanism for VIP to participate in the regulation of immune privilege of testis.
References 1. Rayne AH. The Leydig cell. Vienna: Cache River press, 1996: 231-506. 2. Wu MZ , Zeng CW, Zhang JH. The generative pathology of the male. Shanghai: the Publishing Company of the Permeating Science, 1997: 25-36. 3. Cudicini C, Lejeune H, Gomez E, et al. Human Leydig cells and Sertoli cells are producers of interleukin-1 and6. J Clin Endocrinol Meteb, 1997, 82(5): 1 416-33. 4. Le Roy C, Lejeune H, Chujel F, et al. Autocrine regulation of Leydig cell differenfiated functions by insulinlike growth factor I and transforming growth factor beta. J Steroicl Biochem Mol Biol, 1999, 69(1-6): 379-84. 5. Sandro F, Peira D, Nadia R, et al. Fas and Fas ligand expression in fetal and adult human testis with normal or deranged spermatogenesis. J Clin Endocrinol Metab, 2000, 85(8): 2 692- 700. 6. Bellgrau D, Gold D, Selawry H, et al. A role for CD95 ligand in preventing graft rejection. Nature, 1995, 377 (6 550): 630-2. 7. Zhang YD, Li WY, Xi YB, et al. The change of IL-6, FasL expressed by rat Leydig cell which is infected by UU. Immunology, 2004, 20(2): 95-9. 8. Voice JK, Grinninger C, Kong Y, et al. Roles of vasoactive intestinal peptide (VIP) in the expression of different immune phenotypes by wild-type mice and T cell-targeted type II VIP receptor transgenic mice. J Immunol, 2003, 170(1): 308-14. 9. Xi YB, Chen GJ ,Wang BG, et al. Immunoregulation of IL-1 and TGF-β1 secreted by rat Leydig cell infected. Reproduction and Contraception (in Chinese), 2002, 22(5): 309-12. 10. Xu C, Sun GF, Xu S, et al. The creation of UU infected animals model £-the effect on the morphology of the testis. Reproduction and Contraception (in Chinese), 1995, 15(3): 205-9. 11. Li WY, Xu C. The pathological change of the rat urinary and generative system by UU infected. Academic Journal of Shanghai Second Medical University(in Chinese), 1996, 16(5): 350-2. 12. Sun W, Tadmori I, Yang L, et al. Vasoactive intestinal peptide (VIP) inhibits TGF-beta1 production in murine macrophages. J Neuroimmunol, 2000, 107(1): 88-99. 13. Xu C, Sun GF, Zhu YF, et al. The correlation of ureaplasma urealyticum infection with infertility. Andrologia, 1997, 29(4): 219-26. 14. Delgado M, Ganea D. Vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide inhibit expression of Fas ligand in activated T lymphocytes by regulating c-Myc, NF-kappa B, NF-AT, and early growth factors 2/3. J Immunol, 2001, 166(2): 1 028-40 15. Wang Q, Gao HB. Involvement of nuclear factor-kappa B on corticosterone-induced rat Leydig cell apoptosis. Asian J Androl, 2006, 8(6): 693-702. 16. Delgado M, Ganea D. VIP and PACAP inhibit activation induced apoptosis in T lymphocytes. Ann N Y Acad Sci, 2000, 921(1): 55-67. 17. Sharma V, Delgado M, Ganea D, et al. A new player in activation-induced cell death, is down-regulated by vasoactive intestinal peptide in Th2 but not Th1 effectors. J Immunol, 2006, 176(4): 2 670. (Received on June 25, 2007) 8
http://www.RandC.cn
2008 Mar; 19(1):1-8
[email protected]
·ORIGINAL PAPER·
Effect of Vasocation Intestinal Peptide on Immune Privilege of the Rat Testis Wei WANG, Ye-bin XI, Guang-jie CHEN, Jing HAO, Bao-guo WANG, Tian-wei SHEN, Li-hua JIANG, Wei-yi LI Shanghai Institute of Immunology, Shanghai Jiaotong University School of Medicine, Shanghai 200025, China
Objective To study the effect of vasocation intestinal peptide (VIP) on immune privilege of the rat testis. Methods The UU infected SD rats and Leydig cells were intervened by VIP, the secretion of TGF- β and the expression of FasL in rat Leydig cells were compared between VIP-intervened group and control group to test the effect of VIP on immune privilege of the rat testis in vitro and in vivo. Results In vitro, the secretion of TGF-β in Leydig cells could be increased by low dosage of VIP while inhibitited by high dosage of VIP; expression of FasL mRNA in Leydig cells could be decreased by VIP. In vivo, increased expression of TGF-β mRNA and decreased FasL mRNA were observed in VIP group in 2- 3 weeks after infected by UU. In addition, the apoptosis of Jurkat cells mediated by Leydig cells could be prevented by VIP. Conclusion When Leydig cells or testis infected by UU, VIP could regulate the immune function of rat Leydig cells and participate in the regulation of immune privilege of testis through the regulation of TGF- β secretion and FasL expression pattern of Leydig cells. Key words: vasocation intestinal peptide (VIP); Leydig cell; FasL; TFG-β; immune privilege Leydig cell, a kind of endocrine cell secreting androgen, plays an important physiological role in modulating the development and maturation of mankind sexual organs, in maintaining This study was supported by Shanghai Education Committee Science and Research Funds (04BB21) Corresponding author: Wei-yi LI; Tel: +86-21-63846590*776442; E-mail: [email protected] 1
the procreative, sexual function and secondary sexual characteristic of mankind[1,2]. Furthermore, Leydig cell could secret cytokines[3,4] and express surface molecules[5] which are crucial in maintaining and modulating the immune privilege of partial testicle. In addition, Leydig cell has important immune functions[6]. Vasocation intestinal peptide (VIP) is a transmitter of central and peripheral nervous system with important physiological role. As a multifunctional neurotransmitter and nervous regulatory factor in nervous and endocrine system, VIP plays complex role in immune microenvironment. And as an effective anti-inflammation factor, VIP could inhibite activated macrophage and monocyte. VIP could be produced by antigen-stimulated Th2 cell and mainly shows a anti-inflammatory action in adaptive immunity[7]. In recent years, many researches showed that VIP widely dispersed over the mucous membrane sufface of gastrointestinal tract, upper respiratory tract and genital meatus and play important immune regulatory functions. Our work is conducted to test the effect of VIP on immune privilege of the rat testis. We used VIP to intervene the UU infected SD rats and rat Leydig cells and compared the secretion of TGF-β and the expression of FasL in rat Leydig cells in VIP group and control group to evaluate the effect of VIP on immune privilege of the rat testis in vitro and in vivo.
Materials & Methods UU culture and titer confirmation Serum type 8 standard lines (T960) was donated by Doctor Robeston from the Institute of Microbiology and Infection of Canada Alberta University. Standard UU bacteria T960 (freeze-dried product) was resuscitated, then inoculated into UU medium (Shanghai Enkang) under germfree condition and incubated for 18-24 h at 37℃. The cultured UU (as described above) was double diluted in the period of logarithmic growth, inoculated into the 40- well plate for 48 h at 37℃, then the result was observed. The titer of UU was expressed as color-changing units(CCU/ml). The maximal dilution with color turned red was the titer of UU, which in our test was 1 × 105 CCU/ml. Induction of testis partial infection and VIP involvement protocol in vivo Male SD rats(weighted 150±7.4 g) were obtained from the Apartment of Science and Animal of Fudan University. The rat testis partial infection operation was processed as discribed with 0.3 ml UU suspending liquid [8]. In vivo experiments, rats were stochastically divided into 2 groups and there were 4 rats per group. One group was control group, in which the rats had been infected by UU. The other group was VIP group, in this group, the rats were also infected by UU, and before the day when were infected by UU, the rats had been intraperitoneally injected with 10 nmol VIP. 2
VIP preparation Each 300 µg VIP(Shanghai Boiasia Company) was dissolved into 9 ml PBS with glacial acetic acid（the ratio was 20∶1）, so the concentration of VIP solution was 0.033 g/L. Seperation and culture of Leydig cell The Leydig cell was seperated from male SD rats of 35 d old and cultured as discribed[8]. Stained with 3β-HSD, Leydig cells were observed through optical microscope and the results showed high pure rate and lively Leydig cells. After the density of cells was adjusted into 5 × 105/ml, 5 ml cell suspension was inoculated into cell culture flasks and cultured in LCM medium(Gibco BRL) and in the condition of 37℃ and 5% CO2 . Leydig cell could be cultured for 7 d continuously in vitro and growed well. Measurement of TGF-β Leydig cells were divided into 4 groups: control(UU infected group) and VIP group of high dosage (10-6mol/L), middle dosage (10-7 mol/L) and low dosage (10-8 mol/L), that is to add 100 µl, 10µl and 1 µl of prepared VIP solution into the cell suspension of each group separately. The cells were cultured for 8 hwith or without VIP, then added with 50 µl of UU(50 µl/ml of UU culture medium) and cultured for 56 h. The secration of TGF-β of Legdig cells was measured by ELISA( ELISA kit, R&D, lot:790129.2) in various group, respectively The result was analysed by SOFTmaxPRO analytical system. Flow cytometric analysis of FasL The Leydig cells were cultured for 8 h with(10-7 mol/L and 10-8 mol/L, respectively) or without VIP, then added with 50 µl of UU (50 µl/ml of UU culture medium) and cultured for 56 h. Washed with 20 g/L neonatal bovine serum(NBS, Hangzhou Sijiqing Biological Engineering Materials Co. LTD) and digested by tryspin, Leydig cells were then transfered into EP tubes. After incubated with anti-FasL mAb(4℃, 45 min) and FITC-conjugated IgG (4℃, 30 min)(both Santa Cruz), cell suspensions were fixed in 1% paraformaldehyde and analyzed on a FACSCalibur flow cytometer (FCM). mRNA analysis of TGF-β and FasL Total RNA was isolated from Leydig cells using TRIzol reagent box (Life Technology Company). Reverse transfer-PCR was used to determine TGF-β and FasL mRNA expression in isolated Leydig cells. Primer sequences were as follows: for β-actin (GenBank, GI: 55574), 5'-AGGCATCCTGACCCTGAAGTAC-3' (forward), 5'-TCTTCATGAGGTAGTCTGTCAG-3' (reverse); for TGF-β (GenBank, GI:55574), 5'- CCGCAACAACGCAATCTAT -3' (forward), 5'- GAAAGCCCTGTATTCCGTCTC -3'(reverse); for FasL (GenBank, GI:6978524), 5'-GGAATGGGAAGACACATATGGAACTGC-3'(forward), 5'CATATCTGG CCAGTAGTGCAGTAATTC-3'(reverse). The all primers were synthesized by the Shanghai SBSBio Company. Reverse transfer-copy reaction was processed following the instruction of First strand cDNA synthesis kit(Fermentas Company), total volume of RT reaction system was 20 µl. PCR reaction condition is shown in Table 1. 3
Table 1 PCR reaction condition cDNA
Quantity
β-actin
10.0 pmol
Condition 94℃ 20 s, 65℃ 30 s, 72℃1.5 min, 30 cycle, 72℃ 10 min
Length 389 bp
FasL
12.5 pmol
94℃ 20 s, 66℃ 30 s, 72℃1.5 min, 35 cycle, 72℃ 10 min
238 bp
TGF-β
10.0 pmol
94℃ 20 s, 65℃ 20 s, 72℃1.5 min, 30 cycle, 72℃ 10 min
308 bp
PCR-expanding products of β-actin, TGF-β and FasL of each group were added into a same piece of 1.5% gelose-gel and electrophoreseed for 45 min in the condition of l.5 V/cm, 0.5 × TBE buffer. The gelose-gel was then putted in GDS-UVP8000 gel imaging system (UVP, USA) gel-scanner to get the grey degree value and the ratio of FasL/β-actin and TGFβ/β-actin of each group were calculated to represent the expression of FasL and TGF-β. Culture of Jurkat cell with Leydig cell Jurkat cells(Shanghai Institute of Immunology) were cultured in RPMI-1640 (Gibco BRL)with 10% fetus serum(Hangzhou Sijiqing Biological Engineering Materials Co. LTD). Leydig cells were separated and infected with UU for 72 h, then the supernatants were discarded. Jurkat cells were cocultured with Leydig cells in the ratio of 2∶3 for 14 h in LCM medium(Gibco BRL) without fetus serum. Apoptosis test of Jurkat cell The apoptosis of Jurkat cells was tested following the instruction of the kit of AnnexinV/PI(BD), Jurkat cells were aspirated and washed twice with cooling PBS. The cells were suspended in 1×binding buffer and the density was adjusted into 1×106 cells/ml, 100 µl of the suspension (1×105 cells) was transferred to a 5 ml culture tube, then 5 µl Annexin V-FITC and 5 µl PI were added. The cells were then gently eddied and cultured in darkroom for 15 min at 25℃. Finally, 400 µl 1×binding buffer was added to each tube and do Fluorescence Activated Cell Sorter(FACS) within 1 h. All datas were analysed by Cellquest software. Statistic analysis The t-test by SAS6.04 software was applied to compare two samples’s average for statistical significance in all experiments. P<0.05 was considered to be significant difference.
Results Regulation of VIP on secretion of TGF-β in Leydig cell The results showed that the secretion of TGF-β in Leydig cells could be significantly increased by low dosage of VIP while inhibitited by high dosage of VIP (Table 2). Regulation of VIP on expression of FasL on Leydig cell After UU infected rat Leydig cell was intervened by VIP for 56 h, the expression of FasL on the cell was significantly changed no matter on protein level or on mRNA level. The PCR 4
Table 2 Regulation of VIP on secretion of TGF-β in Leydig cell Group Control
VIP dose(mol/L )
n
TGF-β contents (pg/ml) 94.75 ± 6.99 59.25 ± 4.35**
4
High
10-6
4
Middle
10-7
4
106.00 ± 2.58*
-8
4
117.75 ± 4.35**
Low
10
*: P<0.05, **: P<0.01, compared with control group
results showed that the expression of FasL was obviously decreased in VIP group with the low dosage of VIP had better inhibitition effect compared with control group (Figure1). The high dosage of VIP had no better inhibitition effect, so the result was not showed. The FCM analysis showed the corespondent results (Figure 2).
1: VIP 10-8 mol/L
2: control
3: β-actin
M: maker
Figure 1 The electrophoresis result of β-actin and FasL PCR product
Figure 2
The flow cytometric analysis
Regulation of VIP on mRNA expression of TGF-β and FasL in Leydig cell (in vivo) Leydig cells from control group and VIP group were isolated to test the mRNA expression of TGF-β and FasL. For TGF-β, the results showed that its expression was decreased in 1 week after infection while in 2 weeks and 3 weeks, it was increased by VIP 5
compared with control group. For FasL, its expression was slightly up-regulated by VIP in 1 week after infection while was significantly down-regulated in 2 weeks and in 3 weeks (Figure 3). 2.0 control The rate of expression
VIP-intervened 1.5
1.0
0.5
0.0 1
2
3
1
TGF-β
2
3
FasL Week post infection
Figure 3 Regulation of VIP on mRNA expression of TGF-β and FasL in Leydig cell in vivo
Regulation of VIP on Jurkat cell apoptosis induced by Leydig cell The apoptosis rate of Jurkat cell induced by UU infected Leydig cell was 44% while the rate was decreased into 37% and 34% in 10-7 mol/L of VIP group and 10-8 mol/L VIP group respectively which indicated that VIP could inhibit the apoptosis of Jurkat cell induced by Leydig cell with the low dosage which had more significant inhibition effect(Figure 4).
Figure 4 Regulation of VIP on Jurkat cell apoptosis induced by Leydig cell
Discussion Testis is an important immune privileged site, the maintainance of its immune privilege relays on the immune prevention function of TGF-β and apoptosis induced by FasL. Leydig 6
cell could secret many kinds of cytokines with biological effects including TGF-β which plays an important physiological role in maintaining and regulating microenvironment and immune previlege of testis. In addition, Leydig cell could express FasL in the natural condition which could induce the apoptosis of the Fas+ cells to regulate and maintain the immune privilege and maintain natural physiological balance. In our work, we used rat infection model to imitate the converse infection way of nature infection (from bladder up to testis)[9-11]. We observed the effect of VIP on regulation of the secretion of TGF-β and expression of FasL of UU infected rats and Leydig cells to test the effect of VIP on immune privilege of the rat testis in vitro and in vivo. In vitro, the secretion of TGF-β of UU infected Leydig cells could be significantly promoted by low dosage of VIP(10-7 mol/L and 10-8 mol/L) , which would indicate that one important mechanism of the regulation of VIP on regulating the immune response and immune privilege of testicular would be promoting the secretion of TGF-β[12]. In contrast, the secretion of TGF-β of UU infected Leydig cells could be inhibited by high dosage of VIP. The different effects of different dosages of VIP indicated the bi-directional characteristic of VIP on immune regulation. In vivo, the level of TGF-β in UU infected rats were firstly downregulated and then upregulated by VIP which may associate with the reverse feedback. In early time of infection, the down-regulation of TGF-β would be good for the anti-inflammation reaction, while in later time, the up-regulation of TGF-β would benefit the control of the intensity of anti-inflammation, the inducement of cell apoptosis and the maintainance of immune privilege of testis. In vitro, the expression of FasL of UU infected rat Leydig cell was down-regulated by different dosages of VIP no matter on mRNA level or on protain level with the low dosage of VIP had better inhibition effect. In vivo, the expression of FasL of UU infected rat Leydig cell was slightly up-regulated by VIP firstly but was significantly down-regulated laterly. The significance of this change may exist in that in early time of infection, the up-regulation of FasL expression would benefit the maintainance of immune privilege while its inhibition in later time would be good for anti-inflammation reaction which was corespondent to the result of inhibition of FasL expression by VIP in vitro. According to reaserch paper, the down-regulation of FasL expression on T cell by VIP may be regulated by the NF-κB, NFAT and Egr2/3, ect.[13,14]. It was also reported that VIP could inhibit activation and induce cell death(AICD) by preventing FasL expression on T cell[15-17]. So the effect of VIP on FasL expression is an immportant way to regulate immune privilege in testis. We also used different dosages of VIP to intervene UU infected rat Leydig cell to test the effect of VIP on regulation of apoptosis of Jurkat cell induced by Leydig cell. The results showed that the rate of apoptosis of Jurkat cell could be inhibited by different dosages of VIP with the low dosage which had more significant inhibition effect and was corespondent to the down-regulation of FasL expression on Leydig cell by VIP in vivo and in vitro. 7
In conclusion, when Leydig cells or testis infected by UU, VIP could regulate the immune function of rat Leydig cells and participate in the regulation of immune privilege of testis through the regulation of TGF-β secretion and FasL expression pattern of Leydig cells. This would be an important mechanism for VIP to participate in the regulation of immune privilege of testis.
References 1. Rayne AH. The Leydig cell. Vienna: Cache River press, 1996: 231-506. 2. Wu MZ , Zeng CW, Zhang JH. The generative pathology of the male. Shanghai: the Publishing Company of the Permeating Science, 1997: 25-36. 3. Cudicini C, Lejeune H, Gomez E, et al. Human Leydig cells and Sertoli cells are producers of interleukin-1 and6. J Clin Endocrinol Meteb, 1997, 82(5): 1 416-33. 4. Le Roy C, Lejeune H, Chujel F, et al. Autocrine regulation of Leydig cell differenfiated functions by insulinlike growth factor I and transforming growth factor beta. J Steroicl Biochem Mol Biol, 1999, 69(1-6): 379-84. 5. Sandro F, Peira D, Nadia R, et al. Fas and Fas ligand expression in fetal and adult human testis with normal or deranged spermatogenesis. J Clin Endocrinol Metab, 2000, 85(8): 2 692- 700. 6. Bellgrau D, Gold D, Selawry H, et al. A role for CD95 ligand in preventing graft rejection. Nature, 1995, 377 (6 550): 630-2. 7. Zhang YD, Li WY, Xi YB, et al. The change of IL-6, FasL expressed by rat Leydig cell which is infected by UU. Immunology, 2004, 20(2): 95-9. 8. Voice JK, Grinninger C, Kong Y, et al. Roles of vasoactive intestinal peptide (VIP) in the expression of different immune phenotypes by wild-type mice and T cell-targeted type II VIP receptor transgenic mice. J Immunol, 2003, 170(1): 308-14. 9. Xi YB, Chen GJ ,Wang BG, et al. Immunoregulation of IL-1 and TGF-β1 secreted by rat Leydig cell infected. Reproduction and Contraception (in Chinese), 2002, 22(5): 309-12. 10. Xu C, Sun GF, Xu S, et al. The creation of UU infected animals model £-the effect on the morphology of the testis. Reproduction and Contraception (in Chinese), 1995, 15(3): 205-9. 11. Li WY, Xu C. The pathological change of the rat urinary and generative system by UU infected. Academic Journal of Shanghai Second Medical University(in Chinese), 1996, 16(5): 350-2. 12. Sun W, Tadmori I, Yang L, et al. Vasoactive intestinal peptide (VIP) inhibits TGF-beta1 production in murine macrophages. J Neuroimmunol, 2000, 107(1): 88-99. 13. Xu C, Sun GF, Zhu YF, et al. The correlation of ureaplasma urealyticum infection with infertility. Andrologia, 1997, 29(4): 219-26. 14. Delgado M, Ganea D. Vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide inhibit expression of Fas ligand in activated T lymphocytes by regulating c-Myc, NF-kappa B, NF-AT, and early growth factors 2/3. J Immunol, 2001, 166(2): 1 028-40 15. Wang Q, Gao HB. Involvement of nuclear factor-kappa B on corticosterone-induced rat Leydig cell apoptosis. Asian J Androl, 2006, 8(6): 693-702. 16. Delgado M, Ganea D. VIP and PACAP inhibit activation induced apoptosis in T lymphocytes. Ann N Y Acad Sci, 2000, 921(1): 55-67. 17. Sharma V, Delgado M, Ganea D, et al. A new player in activation-induced cell death, is down-regulated by vasoactive intestinal peptide in Th2 but not Th1 effectors. J Immunol, 2006, 176(4): 2 670. (Received on June 25, 2007) 8