- Email: [email protected]
Effects of calcitonin gene-related peptide on the immune privilege of human hair follicles
Neuropeptides 47 (2013) 51–57
Contents lists available at SciVerse ScienceDirect
Neuropeptides journal homepage: www.elsevier.com/locate/npep
Effects of calcitonin gene-related peptide on the immune privilege of human hair follicles Long-Quan Pi a, Xing-Hai Jin a, Sungjoo Tommy Hwang b, Won-Soo Lee a,⇑ a b
Department of Dermatology and Institute of Hair and Cosmetic Medicine, Yonsei University, Wonju College of Medicine, Wonju, Republic of Korea Dr. Hwang’s Hair-Hair Clinic, Seoul, Republic of Korea
a r t i c l e
i n f o
Article history: Received 21 November 2011 Accepted 16 July 2012 Available online 10 September 2012 Keywords: Hair follicle Immune privilege calcitonin gene-related peptide
a b s t r a c t The hair follicle is a widely available and instructive miniature organ in the human body that experiences major histocompatibility complex (MHC) class I dependent immune privilege (IP). There are various regulation factors that act on the generation, maintenance, and collapse of hair follicle IP. Neuropeptides such as calcitonin gene-related peptide (CGRP) are created in many organs, including skin, and display various immune regulation effects. The purpose of this study was to investigate the phenotypic effect of CGRP on the hair follicle’s IP. First, we used interferon-c (IFN-c) to generate ectopic MHC antigen expression model in cultured human hair follicles as previously described. Then, we examined the effects of CGRP on the regulation of ectopic MHC antigen expression in cultured human hair follicles using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical staining techniques. IFN-c (75 IU/ml) induced ectopic MHC expression. CGRP down-regulated INF-c-induced ectopic MHC class I mRNA expression. These down-regulated effects were especially evident in 108 M. In addition, CGRP also suppressed the staining intensity related to the expression of MHC class I and MHC class I-pathway related molecules (b2-microglobulin), but had no effect on MHC class II antigen expression. Taken together, these results indicate that CGRP might be an important regulatory factor for IP maintenance and restoration of IP via suppression of MHC class I antigen. Ó 2012 Elsevier Ltd. All rights reserved.
1. Introduction The peripheral nerve fibers that innervate the skin have a very important efferent component that controls various inflammatory and proliferative cutaneous responses (Ansel et al., 1996). Among the constituents of skin, the hair follicle is a richly innervated organ, and there are many studies on perifollicular nerve innervations (Halata, 1993; Hordinsky and Ericson, 1996; Rice et al., 1993). Increasing evidence suggests that the peripheral nervous system plays an important role in follicular development, growth and the hair cycle (Hordinsky and Ericson, 1996; Stenn and Paus, 2001; Peters et al., 2001). Neuropeptides released from cutaneous nerves or skin and immune cells can interact with specific receptors on cutaneous cells, including mast cells, Langerhans cells, endothelial cells, keratinocytes and fibroblasts, to modulate immune responses, tissue maintenance and repair (Luger, 2002; Peters et al., 2006).
⇑ Corresponding author. Address: Department of Dermatology and Institute of Hair and Cosmetic Medicine, Yonsei University, Wonju College of Medicine, 162 Ilsan-Dong, Wonju, Gangwon-Do 220-701, Republic of Korea. Tel.: +82 33 741 0622; fax: +82 33 748 2650. E-mail address: [email protected] (W.-S. Lee). 0143-4179/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.npep.2012.07.008
A hair follicle is a typical stress-responding miniature organ with a peculiar immune system. The proximal epithelium of anagen hair follicles are known to be an area of immune privilege (IP) (Christoph et al., 2000). This IP is characterized primarily by a very low level of expression of major histocompatibility (MHC) class antigens (Ito et al., 2004). During postnatal life, the hair follicle cyclically undergoes three alternating phases of rapid growth: hair production (anagen), apoptosis-mediated regression (catagen), and relative quiescence (telogen) (Stenn and Paus, 2001). During the anagen–catagen transformation, hair follicles physiologically lose their IP (Westgate et al., 1991), These transformations are controlled by changes in the local signaling milieu based on changes in the expression/activity of a constantly growing number of cytokines, hormones, neurotransmitters and their cognate receptors, and transcription factors and enzymes are recognized as key mediators of hair follicle cycling (Krause and Foitzik, 2006). The neuropeptide, calcitonin gene-related peptide (CGRP), a 37amino acid peptide, is one of the most abundant neuropeptides in human and rodent skin (Gibbins et al., 1987). CGRP mediates its activities through interactions with specific membrane receptors. Pharmacological studies strongly suggest the existence of at least two CGRP receptors (CGRP-R). CGRP-R belongs to the superfamily of G protein-coupled receptors.
52
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
A number of studies have illustrated the role for CGRP as a regulator of the immune response. CGRP inhibits mitogenstimulated T lymphocyte and thymocyte proliferation and survival (Bulloch et al., 1998; Sakuta et al., 1996; Umeda et al., 1988). CGRP inhibits the production of interleukin-2 and other cytokines by CD41 Th1 T cell clones (Wang et al., 1992), antigen presentation by Langerhans cells (Hosoi et al., 1993), and early B cell differentiation (McGillis et al., 1995). Also, CGRP is an important factor that supports IP in the eye (Streilein et al., 2000; Niederkorn, 2003). Taken together, these observations strongly suggest that CGRP may assist in the maintenance of the unique immune system of the hair follicle. The purpose of this study was to investigate the phenotypic effect of CGRP on the hair follicle’s IP. First, we used interferon-c (IFN-c) to make ectopic MHC antigen expression model in cultured human hair follicles as previously described (Ito et al., 2004). Then, we examined the effects of CGRP on the regulation of ectopic MHC antigen expression in cultured human hair follicles using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical staining techniques. 2. Materials and methods 2.1. Materials Recombinant human INF-c (Catalog # 300-02; Lot # 0305CY27) was purchased from PeproTech, Inc. (Rocky Hill, NJ, USA), and CGRP (Catalog # C0167; Lot # 109K4782) was purchased from Sigma (Sigma, St. Louis, MO, USA). Mouse anti-human leukocyte antigen (HLA)-ABC (Catalog # SC-65319, Lot # B2307), ß2-microglobulin (Catalog # SC-13565, Lot # A0606) and HLA-DP/DQ/DR (Catalog # SC-59251, Lot # E2709) monoclonal antibodies were purchased from Santa Cruz Biotech, Inc. (Santa Cruz, CA, USA). 2.2. Isolation and culture of human hair follicles Human occipital scalp skin specimens were collected during hair transplantation surgery after informed consent was obtained. The medical ethics committee of the Yonsei University Wonju College of Medicine-Wonju Christian Hospital, Wonju, Korea, approved all described studies. The study was conducted according to the Declaration of Helsinki Principles. Human hair follicles in the Anagen VI stage were isolated as previously described (Philpott et al., 1994). Briefly, after separation of the epidermis and dermis from the dermo-subcutaneous interface, anagen hair follicles were isolated from subcutaneous fat using a binocular microscope and Watchmaker’s forceps. A total of 300 hair follicles taken from five individuals were used in this study. Each of the anagen hair follicles was carefully transferred to a 24-well plate (Corning NY, USA) containing 500 ll of William’s E medium (Gibco BRL, Gaithersburg, MD, USA) supplemented with 10 lg/ml insulin (Sigma, St, Louis, MO, USA), 10 ng/ml hydrocortisone (Sigma, St, Louis, MO, USA), 2 mM L-glutamine (Gibco BRL, Gaithersburg, MD, USA), 100 IU/ml penicillin and 100 lg/ml streptomycin (Gibco BRL, Gaithersburg, MD, USA). Hair follicles were maintained freefloating at 37 °C in an atmosphere of 5% CO2 and 95% air in a humidified incubator.
being cultured for 3 days, RT-PCR analysis was performed. After being cultured for 4 days, immunohistochemical analysis was performed. The same experiment was repeated three times. 2.4. Semi-quantitative RT PCR analysis At least eight hair follicles were obtained from each group. Total RNA was extracted using a monophasic solution of phenol and guanidine isothiocyanate (TRIzol Reagent; Gibco BRL). The concentration of RNA was determined using a U.V. spectrometer at 260 nm. Aliquots (1.0 lg) of RNA were reverse transcribed using Moloney murine leukemia virus reverse transcriptase (MML-V RTase, Promega). Briefly, RNA samples were incubated at 70 °C for 10 min with molecular biology grade water. After chilling on ice, primer extension and reverse transcription were done by the addition of 1X RT-buffer, 5 mM MgCl2 solution, 1 mM deoxynucleotide triphosphates (dNTPs), 2.5 lM Oligo d(T)16 (Roche) and MML-V RTase (2.5 units/ll) in total reaction volumes of 20 ll. Samples were then incubated at 42 °C for 45 min before storage at 20 °C. cDNA (1 ll) was then subjected to the following PCR cycling program: 94 °C denaturation for 5 min, followed by 30 cycles of 94 °C for 30 s, 55 °C for 1 min, 72 °C for 1 min, and an additional extension for 10 min at 72 °C. The primers used for amplifying the respective fragments are listed in Table 1. PCR products were visualized on a 2% agarose gel. The density of each band (PCR product) was measured using BandScan software (http://www. glyko.com). RT-PCR band values are presented as a ratio of the HLA-B signal in the selected linear amplification cycle to the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) signal. 2.5. Immunohistochemical staining At least 10 hair follicles were obtained from each group. Hair follicles were fixed in 4% buffered formaldehyde, pH 7, and embedded in paraffin. Serial sections of 4 lm were cut and mounted on slides. After deparaffinization and rehydration, sections were incubated with peroxidase blocking reagent for 30 min to block endogenous peroxidase activity. After incubation with Ultra V Block (UltraVision LP Detection System, Lab Vision Corporation) for 5 min at room temperature to block background staining, the tissues were incubated with a mouse monoclonal antibody specific for human HLA-ABC (dilution 1:25), ß2-microglobulin (dilution 1:50), and HLA DP/DQ/DR (dilution 1:50) for three hours at room temperature. Antibody binding was detected by means of the UltraVision LP Detection System according to the manufacturer’s recommendations (Lab Vision Corporation). Color development was achieved with 3-30 -diaminobenzidine and counterstaining was carried out with hematoxylin. The immunostaining results were photo-documented. The immunostaining was assessed semi-quantitatively by three investigators blinded to the clinical and histopathological data. Staining intensity was determined as 0 (absent), 1 (weak), 2 (moderate), and 3 (strong). 2.6. Statistical analysis The results are expressed as mean ± SEM, and the t-test was used for comparing the data between the two groups. SPSS for
2.3. Medium preparation Hair follicles were cultured in each type of medium. Briefly, control hair follicles were cultured with vehicle for 4 days. Test groups were treated with 75 IU/ml IFN-c for 4 days as previously described (Ito et al., 2004). Furthermore, 108, 109 and 1010 M CGRP were added to each type of culture medium on day 2. After
Table 1 Primer sequences. Primer
Forward
Reverse
HLA-B GAPDH
CCGGACTCAGAATCTCCTCAG GAAGGTGAAGGTCGGAGT
AAACACAGGTCAGCATGGGAA CGGAACCTGTCATTGAGGC
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
Windows was used for data handling and analysis (SPSS, Inc., Chicago, IL, USA), and p < 0.05 was considered statistically significant.
53
papilla (Fig. 2). Therefore, the dose range from 108 to 1010 M CGRP was used in all subsequent experiments. 3.2. IFN-c generates ectopic MHC class I/II expression
3. Results 3.1. The effects of CGRP on human hair growth and catagen induction Because during each catagen phase, hair follicles physiologically lose their IP (Westgate et al., 1991), catagen induction was undesired and had to be avoided for the purpose of this study. By careful titration studies, CGRP at 106–107 M significantly inhibited hair shaft elongation in a dose-dependent manner. CGRP at 108 M, it produced no significant impairment of hair shaft elongation compared with the control (Fig. 1). Hair follicles treated with 108 M CGRP had no perceptible alterations compared with untreated control, showed a fully developed anagen VI hair follicle. In contrast, hair follicles treated with 106 or 107 M CGRP showed a catagen-like regressive changes (Kligman, 1959), which is characterized by the upward movement of the hair shaft from the dermal
We used IFN-c (75 IU/ml) to generate ectopic MHC class expression. IFN-c (75 IU/ml) were identified as the minimally effective dose of IFN-c that sufficed to induce the ectopic MHC class expression in organ cultured human anagen hair follicles, while higher doses (100–1000 IU/ml IFN-c) also caused significant, premature hair follicle regression (catagen) in vitro (Ito et al., 2004). In semi-quantitative RT-PCR analysis, IFN-c (75 IU/ml) significantly induced ectopic HLA-B mRNA expression compared with control (P < 0.001) (Fig. 3). In immunohistochemical analysis, control hair follicles almost not expressed MHC class I, MHC class I pathway-related molecule (i.e., b2-microglobulin) and MHC class II antigen. In contrast, IFN-c (75 IU/ml) induced ectopic MHC class I, b2-microglobulin, and MHC class II expression in the proximal hair bulb epithelium (Figs. 3–5).
Fig. 1. Effects of CGRP on hair shaft elongation: anagen hair follicles were isolated and cultured in the presence of CGRP. Cultures were performed for 10 days. For follicle length, the entire length from the base of the hair bulb to the tip of the hair shaft was measured using the measuring scales attached to the objective lens of the microscope. Data are presented as the mean ± SEM. p < 0.05, compared with CGRP non-treated control.
Fig. 2. Effects of CGRP on the catagen induction (original magnification, 100): anagen hair follicles were isolated and cultured in the presence of CGRP. Cultures were performed for 10 days. The hair cycle stage of each hair follicle was assessed and classified by morphological criteria in CGRP treated hair follicles. Hair follicles treated with 108 M CGRP had no perceptible alterations compared with untreated control, showed a fully developed anagen VI hair follicle. In contrast, hair follicles treated with 106 or 107 M CGRP showed a catagen-like regressive changes, which is characterized by the upward movement of the hair shaft from the dermal papilla. Scale bar = 100 lm.
54
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
Fig. 3. Semi-quantitative RT-PCR analysis of HLA-B mRNA expression in human hair follicle organ culture: lane 1: control (vehicle), lane 2: IFN-c (75 IU/ml), lane 3: IFNc + 108 M CGRP, lane 4: IFN-c + 109 M CGRP, lane 5: IFN-c + 1010 M CGRP. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group.
Fig. 4. Immunohistochemical analysis of MHC class I (HLA-ABC) expression in hair follicle organ culture (original magnification, 100): 108 M CGRP significantly suppressed INF-c-induced ectopic HLA-class I expression. The vertical axis corresponds to staining intensity. The intensity was assigned a score: none (), 0; weak (+), 1; moderate (++), 2; or strong (+++), 3. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group. Scale bar = 100 lm.
3.3. CGRP down-regulates INF-c-induced ectopic MHC class I expression In semi-quantitative RT-PCR analysis, CGRP significantly down-regulated IFN-c (75 IU/ml) induced ectopic HLA-B mRNA
expression (P < 0.001), these down-regulated effects were especially evident in 108 M (Fig. 3). In immunohistochemical analysis, 108 M CGRP also significantly down-regulated ectopic MHC class I protein expression which induced by IFN-c in the proximal hair bulb epithelium (Fig. 4).
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
55
Fig. 5. Immunohistochemical analysis of MHC class I-pathway related molecules (b2-microglobulin) expression in hair follicle organ culture (original magnification 100). 108 M CGRP significantly suppressed INF-c-induced ectopic b2-microglobulin expression. The vertical axis corresponds to staining intensity. The intensity is shown as a score: none (), 0; weak (+), 1; moderate (++), 2; or strong (+++), 3. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group. Scale bar = 100 lm.
3.4. CGRP down-regulates INF-c-induced ectopic b2-microglobulin expression b2-Microglobulin is an essential subunit of MHC class I molecules, which present antigenic peptides to T lymphocytes. b2Microglobulin is needed for the stabilization of MHC class I and endogenous antigen complex. In immunohistochemical analysis, 108 M CGRP significantly down-regulates ectopic b2-microglobulin protein expression which induced by IFN-c in the proximal hair bulb epithelium (Fig. 5). 3.5. CGRP has no effect on the regulation of INF-c-induced ectopic MHC class II (DP/DQ/DR) expression MHC class II antigens are functionally impaired in immuneprivileged region of the hair follicle (Christoph et al., 2000). In immunohistochemical analysis, 108 M CGRP showed no significant change in MHC class II (DP/DQ/DR) expression which induced by IFN-c in the proximal hair bulb epithelium (Fig. 6). 4. Discussion Here, we have investigated the effects of CGRP on the suppression of MHC expression in cultured human hair follicles. This study showed that IFN-c (75 IU/ml) induces ectopic MHC expression (Figs. 3–6). CGRP down-regulates INF-c-induced ectopic MHC class I mRNA expression. These down-regulated effects were especially evident in 108 M (Fig. 3). In addition, CGRP also suppressed the staining intensity related to the expression of MHC class I and MHC class I-pathway related molecules
(b2-microglobulin) (Figs. 4 and 5), but had no effect on MHC class II antigen expression (Fig. 6). The hair follicle is a unique organ in the body that shows cyclically undergoes three alternating phases of anagen, catagen and telogen. The proximal epithelium of anagen hair follicles are known to be an area of IP (Christoph et al., 2000). This IP is characterized primarily by a very low level of expression of MHC class antigens. However, hair follicles in the catagen or telogen phase express MHC class I and II on the follicular epithelium (Gilhar et al., 2007; McElwee and Hoffmann, 2002; Westgate et al., 1991), which means that hair follicles are capable of expressing MHCs, but there is functional suppression of MHC expression on the proximal hair follicle epithelium. Ito and Lee found that immunosuppressants such as proopiomelanocortin-derived peptides, transforming growth factor-b1 can suppress IFN-c-induced ectopic MHC expression in the proximal epithelium of anagen hair follicles (Ito et al., 2004; Lee et al., 2009). In this study, we also found that CGRP can suppress IFNc-induced ectopic MHC expression in the proximal epithelium of anagen hair follicles. Collapse of IP can lead to autoimmune diseases. Both humans and C3H/HeJ mice with alopecia areata express MHC class I and II on the follicular epithelium, which is interpreted as loss of IP (McDonagh et al., 1993). The precise mechanisms are not known, but has been suggested that INF-c likely up-regulates MHC class I and II on the follicular epithelium via interferon regulatory factor-1 (Gilhar and Kalish, 2006; Ito et al., 2004). Almost all the cells in the body express MHC protein. The function of MHC is to present antigens to T-cells, and the T-cell receptors plug onto the MHC molecule and try to bind with the presented antigen. MHC come in two major varieties: MHC class I and MHC class II. MHC class I
56
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
Fig. 6. Immunohistochemical analysis of MHC class II (DP/DQ/DR) expression in hair follicle organ culture (original magnification 100). 108 M CGRP had no statistically significant effect on INF-c-induced ectopic MHC class II expression. The vertical axis corresponds to staining intensity. The intensity is shown as a score: none (), 0; weak (+), 1; moderate (++), 2; or strong (+++), 3. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group. Scale bar = 100 lm.
is present on almost all nucleated cells, MHC class II is present only on a population of cells known as antigen presenting cells (Soos et al., 2001). The presence of class I MHC antigens, which are necessary for interaction with cytotoxic T cells, may facilitate damage to hair bulb cells by the T cells. The expression of class II MHC antigens, which are induced by immune injury, suggests that epithelial cells in affected hair bulbs are injured. INF-c-induced MHC class I expression in alopecia areata allows an autoreactive CD8+ T cell attack (Gilhar et al., 2005; Paus et al., 2003). CGRP has immunomodulatory properties and apparently suppresses antigen presentation to lymphocytes and slows down their proliferation and reactivity (Berkowitz-Balshayi and Becker, 1995; Hosoi et al., 1993). Also CGRP expression is decreased in alopecia areata lesions (Meyronet et al., 2003). Suppression of MHC class I expression by CGRP could protect proximal hair follicles from autoreactive CD8+ T cell attack. Our experimental results indicate that CGRP might be an important regulatory factor for IP maintenance and restoration of IP via suppression of MHC class I antigen. Although the mechanisms underlying CGRP suppression of MHC class I expression remain to be elucidated, this study helps explain the peculiar hair IP and may aid in the development of a therapeutic tool to cure autoimmune hair diseases. Acknowledgement This work was supported in part by the Yonsei University Research Fund of 2010-7-0247. References Ansel, J.C., Kaynard, A.H., Armstrong, C.A., Olerud, J., Bunnett, N., Payan, D., 1996. Skin-nervous system interactions. J. Invest. Dermatol. 106, 198–204.
Berkowitz-Balshayi, C., Becker, Y., 1995. Immunomodulation by OK-432 and calcitonin gene-related peptide (CGRP) of nitric oxide synthase (NOS) and IL1 beta gene expression and of HSV-1 pathogenicity in mouse skin Langerhans cells (LC). In Vivo 9, 447–454. Bulloch, K., McEwen, B.S., Nordberg, J., Diwa, A., Baird, S., 1998. Selective regulation of T-cell development and function by calcitonin gene-related peptide in thymus and spleen. An example of differential regional regulation of immunity by the neuroendocrine system. Ann. N. Y. Acad. Sci. 840, 551–562. Christoph, T., Muller-Rover, S., Audring, H., Tobin, D.J., Hermes, B., Cotsarelis, G., Ruckert, R., Paus, R., 2000. The human hair follicle immune system: cellular composition and immune privilege. Br. J. Dermatol. 142, 862–873. Gibbins, I.L., Wattchow, D., Coventry, B., 1987. Two immunohistochemically identified populations of calcitonin gene-related peptide (CGRP)immunoreactive axons in human skin. Brain Res. 414, 143–148. Gilhar, A., Kalish, R.S., 2006. Alopecia areata: a tissue specific autoimmune disease of the hair follicle. Autoimmun. Rev. 5, 64–69. Gilhar, A., Kam, Y., Assy, B., Kalish, R.S., 2005. Alopecia areata induced in C3H/HeJ mice by interferon-gamma: evidence for loss of immune privilege. J. Invest. Dermatol. 124, 288–289. Gilhar, A., Paus, R., Kalish, R.S., 2007. Lymphocytes, neuropeptides, and genes involved in alopecia areata. J. Clin. Invest. 117, 2019–2027. Halata, Z., 1993. Sensory innervation of the hairy skin (light-microscopic and electron-microscopic study). J. Invest. Dermatol. 101, S75–S81. Hordinsky, M.K., Ericson, M.E., 1996. Relationship between follicular nerve supply and alopecia. Dermatol. Clin. 14, 651–660. Hosoi, J., Murphy, G.F., Egan, C.L., Lerner, E.A., Grabbe, S., Asahina, A., Granstein, R.D., 1993. Regulation of Langerhans cell function by nerves containing calcitonin gene-related peptide. Nature 363, 159–163. Ito, T., Ito, N., Bettermann, A., Tokura, Y., Takigawa, M., Paus, R., 2004. Collapse and restoration of MHC class-I-dependent immune privilege: exploiting the human hair follicle as a model. Am. J. Pathol. 164, 623–634. Kligman, A.M., 1959. The human hair cycle. J. Invest. Dermatol. 33, 307–316. Krause, K., Foitzik, K., 2006. Biology of the hair follicle: the basics. Semin. Cutan. Med. Surg. 25, 2–10. Lee, S., Pi, L.Q., Park, Y.L., Whang, K.U., Jeon, S.Y., Lee, W.S., 2009. The effect of proopiomelanocortin-derived peptides on the immune system of human hair follicles. J. Dermatol. Sci. 55, 195–197. Luger, T.A., 2002. Neuromediators-a crucial component of the skin immune system. J. Dermatol. Sci. 30, 87–93. McDonagh, A.J., Snowden, J.A., Stierle, C., Elliott, K., Messenger, A.G., 1993. HLA and ICAM-1 expression in alopecia areata in vivo and in vitro: the role of cytokines. Br. J. Dermatol. 129, 250–256.
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57 McElwee, K.J., Hoffmann, R., 2002. Alopecia areata – animal models. Clin. Exp. Dermatol. 27, 410–417. McGillis, J.P., Rangnekar, V., Ciallella, J.R., 1995. A role for calcitonin gene related peptide (CGRP) in the regulation of early B lymphocyte differentiation. Can. J. Physiol. Pharmacol. 73, 1057–1064. Meyronet, D., Jaber, K., Gentil-Perret, A., Cambazard, F., Misery, L., 2003. Decreased CGRP staining in alopecia areata. Br. J. Dermatol. 149, 422–424. Niederkorn, J.Y., 2003. Mechanisms of immune privilege in the eye and hair follicle. J. Invest. Dermatol. Symp. Proc. 8, 168–172. Paus, R., Ito, N., Takigawa, M., Ito, T., 2003. The hair follicle and immune privilege. J. Invest. Dermatol. Symp. Proc. 8, 188–194. Peters, E.M., Botchkarev, V.A., Botchkareva, N.V., Tobin, D.J., Paus, R., 2001. Hair-cycle-associated remodeling of the peptidergic innervation of murine skin, and hair growth modulation by neuropeptides. J. Invest. Dermatol. 116, 236–245. Peters, E.M.J., Ericson, M.E., Hosoi, J., Seiffert, K., Hordinsky, M.K., Ansel, J.C., Paus, R., Scholzen, T.E., 2006. Neuropeptide control mechanisms in cutaneous biology: physiological and clinical significance. J. Invest. Dermatol. 126, 1937–1947. Philpott, M.P., Sanders, D., Westgate, G.E., Kealey, T., 1994. Human hair growth in vitro: a model for the study of hair follicle biology. J. Dermatol. Sci. 7 (Suppl.), S55–72.
57
Rice, F.L., Kinnman, E., Aldskogius, H., Johansson, O., Arvidsson, J., 1993. The innervation of the mystacial pad of the rat as revealed by Pgp 9.5 immunofluorescence. J. Comp. Neurol. 337, 366–385. Sakuta, H., Inaba, K., Muramatsu, S., 1996. Calcitonin gene-related peptide enhances apoptosis of thymocytes. J. Neuroimmunol. 67, 103–109. Soos, J.M., Krieger, J.I., Stuve, O., King, C.L., Patarroyo, J.C., Aldape, K., Wosik, K., Slavin, A.J., Nelson, P.A., Antel, J.P., et al., 2001. Malignant glioma cells use MHC class II transactivator (CIITA) promoters III and IV to direct IFN-gamma-inducible CIITA expression and can function as nonprofessional antigen presenting cells in endocytic processing and CD4(+) T-cell activation. Glia 36, 391–405. Stenn, K.S., Paus, R., 2001. Controls of hair follicle cycling. Physiol. Rev. 81, 449–494. Streilein, J.W., Okamoto, S., Sano, Y., Taylor, A.W., 2000. Neural control of ocular immuneprivilege. Ann. N. Y. Acad. Sci. 917, 297–306. Umeda, Y., Takamiya, M., Yoshizaki, H., Arisawa, M., 1988. Inhibition of mitogenstimulated T lymphocyte proliferation by calcitonin gene-related peptide. Biochem. Biophys. Res. Commun. 154, 227–235. Wang, F., Millet, I., Bottomly, K., Vignery, A., 1992. Calcitonin gene-related peptide inhibits interleukin 2 production by murine T lymphocytes. J. Biol. Chem. 267, 21052–21057. Westgate, G.E., Craggs, R.I., Gibson, W.T., 1991. Immune privilege in hair growth. J. Invest. Dermatol. 97, 417–420.
Contents lists available at SciVerse ScienceDirect
Neuropeptides journal homepage: www.elsevier.com/locate/npep
Effects of calcitonin gene-related peptide on the immune privilege of human hair follicles Long-Quan Pi a, Xing-Hai Jin a, Sungjoo Tommy Hwang b, Won-Soo Lee a,⇑ a b
Department of Dermatology and Institute of Hair and Cosmetic Medicine, Yonsei University, Wonju College of Medicine, Wonju, Republic of Korea Dr. Hwang’s Hair-Hair Clinic, Seoul, Republic of Korea
a r t i c l e
i n f o
Article history: Received 21 November 2011 Accepted 16 July 2012 Available online 10 September 2012 Keywords: Hair follicle Immune privilege calcitonin gene-related peptide
a b s t r a c t The hair follicle is a widely available and instructive miniature organ in the human body that experiences major histocompatibility complex (MHC) class I dependent immune privilege (IP). There are various regulation factors that act on the generation, maintenance, and collapse of hair follicle IP. Neuropeptides such as calcitonin gene-related peptide (CGRP) are created in many organs, including skin, and display various immune regulation effects. The purpose of this study was to investigate the phenotypic effect of CGRP on the hair follicle’s IP. First, we used interferon-c (IFN-c) to generate ectopic MHC antigen expression model in cultured human hair follicles as previously described. Then, we examined the effects of CGRP on the regulation of ectopic MHC antigen expression in cultured human hair follicles using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical staining techniques. IFN-c (75 IU/ml) induced ectopic MHC expression. CGRP down-regulated INF-c-induced ectopic MHC class I mRNA expression. These down-regulated effects were especially evident in 108 M. In addition, CGRP also suppressed the staining intensity related to the expression of MHC class I and MHC class I-pathway related molecules (b2-microglobulin), but had no effect on MHC class II antigen expression. Taken together, these results indicate that CGRP might be an important regulatory factor for IP maintenance and restoration of IP via suppression of MHC class I antigen. Ó 2012 Elsevier Ltd. All rights reserved.
1. Introduction The peripheral nerve fibers that innervate the skin have a very important efferent component that controls various inflammatory and proliferative cutaneous responses (Ansel et al., 1996). Among the constituents of skin, the hair follicle is a richly innervated organ, and there are many studies on perifollicular nerve innervations (Halata, 1993; Hordinsky and Ericson, 1996; Rice et al., 1993). Increasing evidence suggests that the peripheral nervous system plays an important role in follicular development, growth and the hair cycle (Hordinsky and Ericson, 1996; Stenn and Paus, 2001; Peters et al., 2001). Neuropeptides released from cutaneous nerves or skin and immune cells can interact with specific receptors on cutaneous cells, including mast cells, Langerhans cells, endothelial cells, keratinocytes and fibroblasts, to modulate immune responses, tissue maintenance and repair (Luger, 2002; Peters et al., 2006).
⇑ Corresponding author. Address: Department of Dermatology and Institute of Hair and Cosmetic Medicine, Yonsei University, Wonju College of Medicine, 162 Ilsan-Dong, Wonju, Gangwon-Do 220-701, Republic of Korea. Tel.: +82 33 741 0622; fax: +82 33 748 2650. E-mail address: [email protected] (W.-S. Lee). 0143-4179/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.npep.2012.07.008
A hair follicle is a typical stress-responding miniature organ with a peculiar immune system. The proximal epithelium of anagen hair follicles are known to be an area of immune privilege (IP) (Christoph et al., 2000). This IP is characterized primarily by a very low level of expression of major histocompatibility (MHC) class antigens (Ito et al., 2004). During postnatal life, the hair follicle cyclically undergoes three alternating phases of rapid growth: hair production (anagen), apoptosis-mediated regression (catagen), and relative quiescence (telogen) (Stenn and Paus, 2001). During the anagen–catagen transformation, hair follicles physiologically lose their IP (Westgate et al., 1991), These transformations are controlled by changes in the local signaling milieu based on changes in the expression/activity of a constantly growing number of cytokines, hormones, neurotransmitters and their cognate receptors, and transcription factors and enzymes are recognized as key mediators of hair follicle cycling (Krause and Foitzik, 2006). The neuropeptide, calcitonin gene-related peptide (CGRP), a 37amino acid peptide, is one of the most abundant neuropeptides in human and rodent skin (Gibbins et al., 1987). CGRP mediates its activities through interactions with specific membrane receptors. Pharmacological studies strongly suggest the existence of at least two CGRP receptors (CGRP-R). CGRP-R belongs to the superfamily of G protein-coupled receptors.
52
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
A number of studies have illustrated the role for CGRP as a regulator of the immune response. CGRP inhibits mitogenstimulated T lymphocyte and thymocyte proliferation and survival (Bulloch et al., 1998; Sakuta et al., 1996; Umeda et al., 1988). CGRP inhibits the production of interleukin-2 and other cytokines by CD41 Th1 T cell clones (Wang et al., 1992), antigen presentation by Langerhans cells (Hosoi et al., 1993), and early B cell differentiation (McGillis et al., 1995). Also, CGRP is an important factor that supports IP in the eye (Streilein et al., 2000; Niederkorn, 2003). Taken together, these observations strongly suggest that CGRP may assist in the maintenance of the unique immune system of the hair follicle. The purpose of this study was to investigate the phenotypic effect of CGRP on the hair follicle’s IP. First, we used interferon-c (IFN-c) to make ectopic MHC antigen expression model in cultured human hair follicles as previously described (Ito et al., 2004). Then, we examined the effects of CGRP on the regulation of ectopic MHC antigen expression in cultured human hair follicles using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical staining techniques. 2. Materials and methods 2.1. Materials Recombinant human INF-c (Catalog # 300-02; Lot # 0305CY27) was purchased from PeproTech, Inc. (Rocky Hill, NJ, USA), and CGRP (Catalog # C0167; Lot # 109K4782) was purchased from Sigma (Sigma, St. Louis, MO, USA). Mouse anti-human leukocyte antigen (HLA)-ABC (Catalog # SC-65319, Lot # B2307), ß2-microglobulin (Catalog # SC-13565, Lot # A0606) and HLA-DP/DQ/DR (Catalog # SC-59251, Lot # E2709) monoclonal antibodies were purchased from Santa Cruz Biotech, Inc. (Santa Cruz, CA, USA). 2.2. Isolation and culture of human hair follicles Human occipital scalp skin specimens were collected during hair transplantation surgery after informed consent was obtained. The medical ethics committee of the Yonsei University Wonju College of Medicine-Wonju Christian Hospital, Wonju, Korea, approved all described studies. The study was conducted according to the Declaration of Helsinki Principles. Human hair follicles in the Anagen VI stage were isolated as previously described (Philpott et al., 1994). Briefly, after separation of the epidermis and dermis from the dermo-subcutaneous interface, anagen hair follicles were isolated from subcutaneous fat using a binocular microscope and Watchmaker’s forceps. A total of 300 hair follicles taken from five individuals were used in this study. Each of the anagen hair follicles was carefully transferred to a 24-well plate (Corning NY, USA) containing 500 ll of William’s E medium (Gibco BRL, Gaithersburg, MD, USA) supplemented with 10 lg/ml insulin (Sigma, St, Louis, MO, USA), 10 ng/ml hydrocortisone (Sigma, St, Louis, MO, USA), 2 mM L-glutamine (Gibco BRL, Gaithersburg, MD, USA), 100 IU/ml penicillin and 100 lg/ml streptomycin (Gibco BRL, Gaithersburg, MD, USA). Hair follicles were maintained freefloating at 37 °C in an atmosphere of 5% CO2 and 95% air in a humidified incubator.
being cultured for 3 days, RT-PCR analysis was performed. After being cultured for 4 days, immunohistochemical analysis was performed. The same experiment was repeated three times. 2.4. Semi-quantitative RT PCR analysis At least eight hair follicles were obtained from each group. Total RNA was extracted using a monophasic solution of phenol and guanidine isothiocyanate (TRIzol Reagent; Gibco BRL). The concentration of RNA was determined using a U.V. spectrometer at 260 nm. Aliquots (1.0 lg) of RNA were reverse transcribed using Moloney murine leukemia virus reverse transcriptase (MML-V RTase, Promega). Briefly, RNA samples were incubated at 70 °C for 10 min with molecular biology grade water. After chilling on ice, primer extension and reverse transcription were done by the addition of 1X RT-buffer, 5 mM MgCl2 solution, 1 mM deoxynucleotide triphosphates (dNTPs), 2.5 lM Oligo d(T)16 (Roche) and MML-V RTase (2.5 units/ll) in total reaction volumes of 20 ll. Samples were then incubated at 42 °C for 45 min before storage at 20 °C. cDNA (1 ll) was then subjected to the following PCR cycling program: 94 °C denaturation for 5 min, followed by 30 cycles of 94 °C for 30 s, 55 °C for 1 min, 72 °C for 1 min, and an additional extension for 10 min at 72 °C. The primers used for amplifying the respective fragments are listed in Table 1. PCR products were visualized on a 2% agarose gel. The density of each band (PCR product) was measured using BandScan software (http://www. glyko.com). RT-PCR band values are presented as a ratio of the HLA-B signal in the selected linear amplification cycle to the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) signal. 2.5. Immunohistochemical staining At least 10 hair follicles were obtained from each group. Hair follicles were fixed in 4% buffered formaldehyde, pH 7, and embedded in paraffin. Serial sections of 4 lm were cut and mounted on slides. After deparaffinization and rehydration, sections were incubated with peroxidase blocking reagent for 30 min to block endogenous peroxidase activity. After incubation with Ultra V Block (UltraVision LP Detection System, Lab Vision Corporation) for 5 min at room temperature to block background staining, the tissues were incubated with a mouse monoclonal antibody specific for human HLA-ABC (dilution 1:25), ß2-microglobulin (dilution 1:50), and HLA DP/DQ/DR (dilution 1:50) for three hours at room temperature. Antibody binding was detected by means of the UltraVision LP Detection System according to the manufacturer’s recommendations (Lab Vision Corporation). Color development was achieved with 3-30 -diaminobenzidine and counterstaining was carried out with hematoxylin. The immunostaining results were photo-documented. The immunostaining was assessed semi-quantitatively by three investigators blinded to the clinical and histopathological data. Staining intensity was determined as 0 (absent), 1 (weak), 2 (moderate), and 3 (strong). 2.6. Statistical analysis The results are expressed as mean ± SEM, and the t-test was used for comparing the data between the two groups. SPSS for
2.3. Medium preparation Hair follicles were cultured in each type of medium. Briefly, control hair follicles were cultured with vehicle for 4 days. Test groups were treated with 75 IU/ml IFN-c for 4 days as previously described (Ito et al., 2004). Furthermore, 108, 109 and 1010 M CGRP were added to each type of culture medium on day 2. After
Table 1 Primer sequences. Primer
Forward
Reverse
HLA-B GAPDH
CCGGACTCAGAATCTCCTCAG GAAGGTGAAGGTCGGAGT
AAACACAGGTCAGCATGGGAA CGGAACCTGTCATTGAGGC
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
Windows was used for data handling and analysis (SPSS, Inc., Chicago, IL, USA), and p < 0.05 was considered statistically significant.
53
papilla (Fig. 2). Therefore, the dose range from 108 to 1010 M CGRP was used in all subsequent experiments. 3.2. IFN-c generates ectopic MHC class I/II expression
3. Results 3.1. The effects of CGRP on human hair growth and catagen induction Because during each catagen phase, hair follicles physiologically lose their IP (Westgate et al., 1991), catagen induction was undesired and had to be avoided for the purpose of this study. By careful titration studies, CGRP at 106–107 M significantly inhibited hair shaft elongation in a dose-dependent manner. CGRP at 108 M, it produced no significant impairment of hair shaft elongation compared with the control (Fig. 1). Hair follicles treated with 108 M CGRP had no perceptible alterations compared with untreated control, showed a fully developed anagen VI hair follicle. In contrast, hair follicles treated with 106 or 107 M CGRP showed a catagen-like regressive changes (Kligman, 1959), which is characterized by the upward movement of the hair shaft from the dermal
We used IFN-c (75 IU/ml) to generate ectopic MHC class expression. IFN-c (75 IU/ml) were identified as the minimally effective dose of IFN-c that sufficed to induce the ectopic MHC class expression in organ cultured human anagen hair follicles, while higher doses (100–1000 IU/ml IFN-c) also caused significant, premature hair follicle regression (catagen) in vitro (Ito et al., 2004). In semi-quantitative RT-PCR analysis, IFN-c (75 IU/ml) significantly induced ectopic HLA-B mRNA expression compared with control (P < 0.001) (Fig. 3). In immunohistochemical analysis, control hair follicles almost not expressed MHC class I, MHC class I pathway-related molecule (i.e., b2-microglobulin) and MHC class II antigen. In contrast, IFN-c (75 IU/ml) induced ectopic MHC class I, b2-microglobulin, and MHC class II expression in the proximal hair bulb epithelium (Figs. 3–5).
Fig. 1. Effects of CGRP on hair shaft elongation: anagen hair follicles were isolated and cultured in the presence of CGRP. Cultures were performed for 10 days. For follicle length, the entire length from the base of the hair bulb to the tip of the hair shaft was measured using the measuring scales attached to the objective lens of the microscope. Data are presented as the mean ± SEM. p < 0.05, compared with CGRP non-treated control.
Fig. 2. Effects of CGRP on the catagen induction (original magnification, 100): anagen hair follicles were isolated and cultured in the presence of CGRP. Cultures were performed for 10 days. The hair cycle stage of each hair follicle was assessed and classified by morphological criteria in CGRP treated hair follicles. Hair follicles treated with 108 M CGRP had no perceptible alterations compared with untreated control, showed a fully developed anagen VI hair follicle. In contrast, hair follicles treated with 106 or 107 M CGRP showed a catagen-like regressive changes, which is characterized by the upward movement of the hair shaft from the dermal papilla. Scale bar = 100 lm.
54
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
Fig. 3. Semi-quantitative RT-PCR analysis of HLA-B mRNA expression in human hair follicle organ culture: lane 1: control (vehicle), lane 2: IFN-c (75 IU/ml), lane 3: IFNc + 108 M CGRP, lane 4: IFN-c + 109 M CGRP, lane 5: IFN-c + 1010 M CGRP. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group.
Fig. 4. Immunohistochemical analysis of MHC class I (HLA-ABC) expression in hair follicle organ culture (original magnification, 100): 108 M CGRP significantly suppressed INF-c-induced ectopic HLA-class I expression. The vertical axis corresponds to staining intensity. The intensity was assigned a score: none (), 0; weak (+), 1; moderate (++), 2; or strong (+++), 3. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group. Scale bar = 100 lm.
3.3. CGRP down-regulates INF-c-induced ectopic MHC class I expression In semi-quantitative RT-PCR analysis, CGRP significantly down-regulated IFN-c (75 IU/ml) induced ectopic HLA-B mRNA
expression (P < 0.001), these down-regulated effects were especially evident in 108 M (Fig. 3). In immunohistochemical analysis, 108 M CGRP also significantly down-regulated ectopic MHC class I protein expression which induced by IFN-c in the proximal hair bulb epithelium (Fig. 4).
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
55
Fig. 5. Immunohistochemical analysis of MHC class I-pathway related molecules (b2-microglobulin) expression in hair follicle organ culture (original magnification 100). 108 M CGRP significantly suppressed INF-c-induced ectopic b2-microglobulin expression. The vertical axis corresponds to staining intensity. The intensity is shown as a score: none (), 0; weak (+), 1; moderate (++), 2; or strong (+++), 3. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group. Scale bar = 100 lm.
3.4. CGRP down-regulates INF-c-induced ectopic b2-microglobulin expression b2-Microglobulin is an essential subunit of MHC class I molecules, which present antigenic peptides to T lymphocytes. b2Microglobulin is needed for the stabilization of MHC class I and endogenous antigen complex. In immunohistochemical analysis, 108 M CGRP significantly down-regulates ectopic b2-microglobulin protein expression which induced by IFN-c in the proximal hair bulb epithelium (Fig. 5). 3.5. CGRP has no effect on the regulation of INF-c-induced ectopic MHC class II (DP/DQ/DR) expression MHC class II antigens are functionally impaired in immuneprivileged region of the hair follicle (Christoph et al., 2000). In immunohistochemical analysis, 108 M CGRP showed no significant change in MHC class II (DP/DQ/DR) expression which induced by IFN-c in the proximal hair bulb epithelium (Fig. 6). 4. Discussion Here, we have investigated the effects of CGRP on the suppression of MHC expression in cultured human hair follicles. This study showed that IFN-c (75 IU/ml) induces ectopic MHC expression (Figs. 3–6). CGRP down-regulates INF-c-induced ectopic MHC class I mRNA expression. These down-regulated effects were especially evident in 108 M (Fig. 3). In addition, CGRP also suppressed the staining intensity related to the expression of MHC class I and MHC class I-pathway related molecules
(b2-microglobulin) (Figs. 4 and 5), but had no effect on MHC class II antigen expression (Fig. 6). The hair follicle is a unique organ in the body that shows cyclically undergoes three alternating phases of anagen, catagen and telogen. The proximal epithelium of anagen hair follicles are known to be an area of IP (Christoph et al., 2000). This IP is characterized primarily by a very low level of expression of MHC class antigens. However, hair follicles in the catagen or telogen phase express MHC class I and II on the follicular epithelium (Gilhar et al., 2007; McElwee and Hoffmann, 2002; Westgate et al., 1991), which means that hair follicles are capable of expressing MHCs, but there is functional suppression of MHC expression on the proximal hair follicle epithelium. Ito and Lee found that immunosuppressants such as proopiomelanocortin-derived peptides, transforming growth factor-b1 can suppress IFN-c-induced ectopic MHC expression in the proximal epithelium of anagen hair follicles (Ito et al., 2004; Lee et al., 2009). In this study, we also found that CGRP can suppress IFNc-induced ectopic MHC expression in the proximal epithelium of anagen hair follicles. Collapse of IP can lead to autoimmune diseases. Both humans and C3H/HeJ mice with alopecia areata express MHC class I and II on the follicular epithelium, which is interpreted as loss of IP (McDonagh et al., 1993). The precise mechanisms are not known, but has been suggested that INF-c likely up-regulates MHC class I and II on the follicular epithelium via interferon regulatory factor-1 (Gilhar and Kalish, 2006; Ito et al., 2004). Almost all the cells in the body express MHC protein. The function of MHC is to present antigens to T-cells, and the T-cell receptors plug onto the MHC molecule and try to bind with the presented antigen. MHC come in two major varieties: MHC class I and MHC class II. MHC class I
56
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57
Fig. 6. Immunohistochemical analysis of MHC class II (DP/DQ/DR) expression in hair follicle organ culture (original magnification 100). 108 M CGRP had no statistically significant effect on INF-c-induced ectopic MHC class II expression. The vertical axis corresponds to staining intensity. The intensity is shown as a score: none (), 0; weak (+), 1; moderate (++), 2; or strong (+++), 3. Data are presented as the mean ± SEM. p < 0.001, compared with IFN-c (75 IU/ml) treated group. Scale bar = 100 lm.
is present on almost all nucleated cells, MHC class II is present only on a population of cells known as antigen presenting cells (Soos et al., 2001). The presence of class I MHC antigens, which are necessary for interaction with cytotoxic T cells, may facilitate damage to hair bulb cells by the T cells. The expression of class II MHC antigens, which are induced by immune injury, suggests that epithelial cells in affected hair bulbs are injured. INF-c-induced MHC class I expression in alopecia areata allows an autoreactive CD8+ T cell attack (Gilhar et al., 2005; Paus et al., 2003). CGRP has immunomodulatory properties and apparently suppresses antigen presentation to lymphocytes and slows down their proliferation and reactivity (Berkowitz-Balshayi and Becker, 1995; Hosoi et al., 1993). Also CGRP expression is decreased in alopecia areata lesions (Meyronet et al., 2003). Suppression of MHC class I expression by CGRP could protect proximal hair follicles from autoreactive CD8+ T cell attack. Our experimental results indicate that CGRP might be an important regulatory factor for IP maintenance and restoration of IP via suppression of MHC class I antigen. Although the mechanisms underlying CGRP suppression of MHC class I expression remain to be elucidated, this study helps explain the peculiar hair IP and may aid in the development of a therapeutic tool to cure autoimmune hair diseases. Acknowledgement This work was supported in part by the Yonsei University Research Fund of 2010-7-0247. References Ansel, J.C., Kaynard, A.H., Armstrong, C.A., Olerud, J., Bunnett, N., Payan, D., 1996. Skin-nervous system interactions. J. Invest. Dermatol. 106, 198–204.
Berkowitz-Balshayi, C., Becker, Y., 1995. Immunomodulation by OK-432 and calcitonin gene-related peptide (CGRP) of nitric oxide synthase (NOS) and IL1 beta gene expression and of HSV-1 pathogenicity in mouse skin Langerhans cells (LC). In Vivo 9, 447–454. Bulloch, K., McEwen, B.S., Nordberg, J., Diwa, A., Baird, S., 1998. Selective regulation of T-cell development and function by calcitonin gene-related peptide in thymus and spleen. An example of differential regional regulation of immunity by the neuroendocrine system. Ann. N. Y. Acad. Sci. 840, 551–562. Christoph, T., Muller-Rover, S., Audring, H., Tobin, D.J., Hermes, B., Cotsarelis, G., Ruckert, R., Paus, R., 2000. The human hair follicle immune system: cellular composition and immune privilege. Br. J. Dermatol. 142, 862–873. Gibbins, I.L., Wattchow, D., Coventry, B., 1987. Two immunohistochemically identified populations of calcitonin gene-related peptide (CGRP)immunoreactive axons in human skin. Brain Res. 414, 143–148. Gilhar, A., Kalish, R.S., 2006. Alopecia areata: a tissue specific autoimmune disease of the hair follicle. Autoimmun. Rev. 5, 64–69. Gilhar, A., Kam, Y., Assy, B., Kalish, R.S., 2005. Alopecia areata induced in C3H/HeJ mice by interferon-gamma: evidence for loss of immune privilege. J. Invest. Dermatol. 124, 288–289. Gilhar, A., Paus, R., Kalish, R.S., 2007. Lymphocytes, neuropeptides, and genes involved in alopecia areata. J. Clin. Invest. 117, 2019–2027. Halata, Z., 1993. Sensory innervation of the hairy skin (light-microscopic and electron-microscopic study). J. Invest. Dermatol. 101, S75–S81. Hordinsky, M.K., Ericson, M.E., 1996. Relationship between follicular nerve supply and alopecia. Dermatol. Clin. 14, 651–660. Hosoi, J., Murphy, G.F., Egan, C.L., Lerner, E.A., Grabbe, S., Asahina, A., Granstein, R.D., 1993. Regulation of Langerhans cell function by nerves containing calcitonin gene-related peptide. Nature 363, 159–163. Ito, T., Ito, N., Bettermann, A., Tokura, Y., Takigawa, M., Paus, R., 2004. Collapse and restoration of MHC class-I-dependent immune privilege: exploiting the human hair follicle as a model. Am. J. Pathol. 164, 623–634. Kligman, A.M., 1959. The human hair cycle. J. Invest. Dermatol. 33, 307–316. Krause, K., Foitzik, K., 2006. Biology of the hair follicle: the basics. Semin. Cutan. Med. Surg. 25, 2–10. Lee, S., Pi, L.Q., Park, Y.L., Whang, K.U., Jeon, S.Y., Lee, W.S., 2009. The effect of proopiomelanocortin-derived peptides on the immune system of human hair follicles. J. Dermatol. Sci. 55, 195–197. Luger, T.A., 2002. Neuromediators-a crucial component of the skin immune system. J. Dermatol. Sci. 30, 87–93. McDonagh, A.J., Snowden, J.A., Stierle, C., Elliott, K., Messenger, A.G., 1993. HLA and ICAM-1 expression in alopecia areata in vivo and in vitro: the role of cytokines. Br. J. Dermatol. 129, 250–256.
L.-Q. Pi et al. / Neuropeptides 47 (2013) 51–57 McElwee, K.J., Hoffmann, R., 2002. Alopecia areata – animal models. Clin. Exp. Dermatol. 27, 410–417. McGillis, J.P., Rangnekar, V., Ciallella, J.R., 1995. A role for calcitonin gene related peptide (CGRP) in the regulation of early B lymphocyte differentiation. Can. J. Physiol. Pharmacol. 73, 1057–1064. Meyronet, D., Jaber, K., Gentil-Perret, A., Cambazard, F., Misery, L., 2003. Decreased CGRP staining in alopecia areata. Br. J. Dermatol. 149, 422–424. Niederkorn, J.Y., 2003. Mechanisms of immune privilege in the eye and hair follicle. J. Invest. Dermatol. Symp. Proc. 8, 168–172. Paus, R., Ito, N., Takigawa, M., Ito, T., 2003. The hair follicle and immune privilege. J. Invest. Dermatol. Symp. Proc. 8, 188–194. Peters, E.M., Botchkarev, V.A., Botchkareva, N.V., Tobin, D.J., Paus, R., 2001. Hair-cycle-associated remodeling of the peptidergic innervation of murine skin, and hair growth modulation by neuropeptides. J. Invest. Dermatol. 116, 236–245. Peters, E.M.J., Ericson, M.E., Hosoi, J., Seiffert, K., Hordinsky, M.K., Ansel, J.C., Paus, R., Scholzen, T.E., 2006. Neuropeptide control mechanisms in cutaneous biology: physiological and clinical significance. J. Invest. Dermatol. 126, 1937–1947. Philpott, M.P., Sanders, D., Westgate, G.E., Kealey, T., 1994. Human hair growth in vitro: a model for the study of hair follicle biology. J. Dermatol. Sci. 7 (Suppl.), S55–72.
57
Rice, F.L., Kinnman, E., Aldskogius, H., Johansson, O., Arvidsson, J., 1993. The innervation of the mystacial pad of the rat as revealed by Pgp 9.5 immunofluorescence. J. Comp. Neurol. 337, 366–385. Sakuta, H., Inaba, K., Muramatsu, S., 1996. Calcitonin gene-related peptide enhances apoptosis of thymocytes. J. Neuroimmunol. 67, 103–109. Soos, J.M., Krieger, J.I., Stuve, O., King, C.L., Patarroyo, J.C., Aldape, K., Wosik, K., Slavin, A.J., Nelson, P.A., Antel, J.P., et al., 2001. Malignant glioma cells use MHC class II transactivator (CIITA) promoters III and IV to direct IFN-gamma-inducible CIITA expression and can function as nonprofessional antigen presenting cells in endocytic processing and CD4(+) T-cell activation. Glia 36, 391–405. Stenn, K.S., Paus, R., 2001. Controls of hair follicle cycling. Physiol. Rev. 81, 449–494. Streilein, J.W., Okamoto, S., Sano, Y., Taylor, A.W., 2000. Neural control of ocular immuneprivilege. Ann. N. Y. Acad. Sci. 917, 297–306. Umeda, Y., Takamiya, M., Yoshizaki, H., Arisawa, M., 1988. Inhibition of mitogenstimulated T lymphocyte proliferation by calcitonin gene-related peptide. Biochem. Biophys. Res. Commun. 154, 227–235. Wang, F., Millet, I., Bottomly, K., Vignery, A., 1992. Calcitonin gene-related peptide inhibits interleukin 2 production by murine T lymphocytes. J. Biol. Chem. 267, 21052–21057. Westgate, G.E., Craggs, R.I., Gibson, W.T., 1991. Immune privilege in hair growth. J. Invest. Dermatol. 97, 417–420.