- Email: [email protected]
Effects of basic fibroblast growth factor on angiogenin expression and cell proliferation in H7402 human hepatoma cells
JOURNAL OF
GENETICS AND GENOMICS J. Genet. Genomics 36 (2009) 399407
www.jgenetgenomics.org
Effects of basic fibroblast growth factor on angiogenin expression and cell proliferation in H7402 human hepatoma cells Ji Wang, Jianli Yang, Dawei Yuan, Jun Wang, Jia Zhao, Li Wang* Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024, China Received for publication 21 December 2008; revised 3 March 2009; accepted 24 March 2009
Abstract Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide. Basic fibroblast growth factor (bFGF), which is highly expressed in developing tissues and malignant cells, regulates cell growth, differentiation, and migration. Its expression is essential for the progression and metastasis of HCC. This study aims to investigate the effects of bFGF on the expression of angiogenin, another growth factor, which plays an important role in tumor angiogenesis, and on cell proliferation in H7402 human hepatoma cells. The bFGF sense cDNA or antisense cDNA was stably transfected into H7402 cells. Genomic DNA PCR analysis demonstrated that human bFGF sense cDNA or antisense cDNA was inserted into the genome. Furthermore, the expression of bFGF and angiogenin was examined by RT-PCR and Western blot assays. MTT and colony formation assays were employed to determine cell proliferation. Stable bFGF over-expressing and under-expressing transfectants were successfully established. Expression of angiogenin was decreased in the over-expressing bFGF cells (sense transfectants) and was increased in the under-expressing bFGF cells (antisense transfectants). Cell proliferation increased in the bFGF sense transfectants and decreased in the bFGF antisense transfectants. These results demonstrated that the endogenous bFGF may not only negatively regulate the angiogenin expression but also contribute to the overall cell proliferation in H7402 human hepatoma cells. This study may be helpful in finding a potential therapeutic approach to HCC. Keywords: H7402 human hepatoma cells; basic fibroblast growth factor (bFGF); angiogenin; cell proliferation
Introduction Hepatocellular carcinoma (HCC) is the most common hypervascular tumor and is one of the most common cancers worldwide (Mise et al., 1996; McKillop and Schrum, 2005). The growth and metastasis of solid tumor depends on angiogenesis. Recent studies demonstrated that the expressions of many angiogenic factors are closely related to the growth and metastasis of HCC (Hisai et al., 2003). Among the known angiogenic factors, basic fibroblast growth factor (bFGF) and angiogenin are potent and rep* Corresponding author. Tel: +86-431-8509 9360; Fax: +86-431-8569 5065. E-mail address: [email protected] DOI: 10.1016/S1673-8527(08)60129-0
resentative factors involved in tumor development. However, the interrelationships among these factors and their effects on tumor development and angiogenesis, especially on HCC, are still poorly understood. Previous study has shown that bFGF is an important modulator responsible for cell proliferation, development and migration under both physiological and pathological conditions (Bikfalvi et al., 1997). Differential initiation of translation from alternative initiation codons of a single bFGF mRNA yields five isoforms with different molecular weights. The four higher molecular weight forms (22, 22.5, 24 and 34 kDa) are predominantly located in the cell nucleus while the lowest molecular weight form (18 kDa) is found in the cytosol (Florkiewicz et al., 1998; Arnaud et al.,
400
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
1999; Delrieu, 2000). The 18 kDa bFGF isoform is released from cells by a non-classical secretory pathway, and it binds to cell surface receptors and translocates into the nucleus (Florkiewicz et al., 1998; Dailey et al., 2005). Besides cytosol, the 18 kDa bFGF also localizes in the nucleus (Claus et al., 2003; Sheng et al., 2004). One of the functions of 18 kDa bFGF is to directly regulate rRNA transcription and ribosome biogenesis, the rate-limiting processes in cell growth (Sheng et al., 2005). Angiogenin is a 14 kDa angiogenic protein, which is originally isolated from a medium conditioned by HT-29 human colon adenocarcinoma cells based on its angiogenic activity (Fett et al., 1985). The protein has been shown to play an important role in tumor angiogenesis (Olson et al., 1995). Its expression is up-regulated in many types of cancers including HCC (Majumder et al., 2001; Ugurel et al., 2001; Hisai et al., 2003; Shimoyama and Kaminishi, 2003; Musolino et al., 2004). Similar to bFGF, angiogenin undergoes nuclear translocation and regulates rRNA transcription in endothelial cells and some tumor cells (Tsuji et al., 2005; Yoshioka et al., 2006). In addition to its angiogenic activity, angiogenin also plays a role in cancer cell proliferation. Our study aims to reveal the effects of bFGF on angiogenin expression and cell proliferation of H7402 human hepatoma cells. We first established the stable transfected H7402 cells that over- or under-express bFGF. Then we investigated the influence of bFGF on the expression of angiogenin and on cell proliferation in H7402 human hepatoma cells. The results showed that the endogenous bFGF negatively regulated the angiogenin expression but stimulated cell proliferation of hepatoma cell. This study demonstrated that there was a relationship between these two important growth factors and it might be helpful in finding a potential therapeutic approach to HCC.
Materials and methods Plasmids construction A human bFGF cDNA was obtained by reverse transcription-polymerase chain reaction (RT-PCR), using primers based on the known bFGF sequence (GenBank accession no. J04513; forward primer: 5c-TCTGAATTCA TGGCAGCCGGGAGCATCAC-3ƍ and reverse primer: 5c-TCTGGTCGAAAAATCAGCTCTTAGCAGAC-3c). The template DNA was from bFGF cDNA and the PCR condition was as follows: denaturation at 94ºC for 5 min;
35 cycles of denaturation at 94ºC for 1 min, annealing at 58ºC for 1 min and extension at 72ºC for 1 min; extension at 72ºC for 10 min. The resulting PCR products were purified and inserted into the pUCm-T vector (Sangon, Shanghai, China) to yield pUCm-T-bFGF. The plasmid was digested with two pairs of restriction enzyme EcoR I/Sal I and Xho I/Not I, respectively. The two excised fragments were cloned into the EcoR I/Sal I and Xho I/Not I of pCI-neo mammalian expression vector, respectively. This enabled the bFGF cDNA to be inserted into the vector both in sense and antisense orientations. The generated constructs were confirmed by sequencing and were named as pCI-neo-bFGF-sense and pCI-neo-bFGF-antisense.
Cell culture The human hepatoma cell line H7402 was acquired from the Medical School of Jinlin University, China. The cells were cultured in Dulbecco’s Modified Eagel Medium (DMEM) supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 U/mL penicillin and 100 mg/mL streptomycin at 37ºC in a humidified atmosphere containing 5% CO2.
Stable transfection The empty pCI-neo vector and plasmids containing the human bFGF sense or antisense cDNA (pCI-neo-bFGFsense and pCI-neo-bFGF-antisense) were introduced into H7402 cells by the electroporation method using Bio-Rad Gene Pulser XcellTM Electroporation System (Bio-Rad Laboratories Inc., Hercules, CA, USA) following the manufacturer’s instructions. Forty-eight hours after transfection, the medium was replaced with the selection medium containing 600 Pg/mL G418 (GIBCO, Invitrogen Corporation, Carlabad, CA, USA). The selection medium was changed every 3 or 4 days until G418-resistant colonies appeared. The remaining colonies were then individually picked out and subcultured in the G418-conatining medium.
Genomic DNA PCR analysis of transfected bFGF genes in cloned cells To confirm that the bFGF sense or antisense cDNA was integrated into the H7402 genome, polymerase chain reaction (PCR) was carried out using genomic DNA of cloned cells. Genomic DNA was extracted from confluent cells as described previously (RamÕ’rez-Solis et al., 1992). One
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
microliter of the genomic DNA from each sample was used for PCR amplification. The primers were B1, bFGF forward primer (5c-TCTGAATTCATGGCAGCCGGGAG CATCAC-3c); B2, bFGF reverse primer (5c-TCTGGTCGA AAAATCAGCTCTTAGCAGAC-3c); and T3, from the pCI-neo vector (5c-ATCATGTCTGCTCGAAGCATTAAC-3c). The PCR products were analyzed on 1 % agarose gel electrophoresis.
RT-PCR assay Total RNA was isolated from pCI-neo, bFGF sense and bFGF antisense transfected cells using the Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. One microliter of total RNA was reverse transcribed with Improm-ĊTM reverse transcriptase per reaction according to the manufacturer’s instructions (Promega, WI, USA). All the cDNA samples were diluted 1:5 in DEPC water (Biotech, CA) prior to amplification. The generated cDNA was then amplified by PCR with 12.5 PL Premix Taq DNA polymerase (TaKaRa, Japan) and 2 PL of each primer (2.5 Pmol/L) in 25 PL reaction volume. The PCR was performed in thermal cycler (Thermo Electron Corporation, USA) with the following thermal cycle conditions: denaturation at 94ºC for 30 s, annealing for 30 s and extension at 72ºC for 40 s for 28 cycles. Primers used in this study and the expected size of the amplified DNA are listed in Table 1. Electrophoresis of amplified products was carried out on 1.5% agarose gels.
Western blot assay The cells (pCI-neo, bFGF sense and bFGF antisense transfected) were harvested and washed twice with ice-cold PBS. The whole cell extracts were obtained by lysing the cells with the lysis buffer containing 50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, 50 mmol/L sodium pyrophosphate, 1 mmol/L NaF, 1 mmol/L Na3VO4, 30
401
mmol/L Na4P2O7, 1% NP-40, and 1 mmol/L phenylmethylsulfonyl fluoride. Twenty micrograms of protein from each sample was subjected to 15% SDS-polyacrylamide gels and electrophoretically transferred to nitrocellulose membrane following the protocol suggested by the manufacturer (Bio-Rad). The membrane was blocked overnight at 4ºC with 5% nonfat milk in TBS (10 mmol/L Tris-HCl pH 7.5, 150 mmol/L NaCl) containing 0.05% Tween-20. Then the membrane was incubated with primary antibodies against bFGF (R&D System, Inc, USA), angiogenin (prepared in our lab) or ȕ-actin (Sigma-Aldrich, St. Louis, MI, USA) for 1 h at 37 ºC. Followed by incubation with HRP-conjugated IgG (Beijing ZhongShan Golden Bridge Biotechnology Co. Ltd, Beijing, China) for 1 h at 37ºC. The results were visualized by enhanced chemiluminescence (ECL) using Pierce Biotechnology SuperSignal West Pico Chemiluminescent substrate. The ȕ-actin was co-analyzed as the internal control at the same time.
ELISA assay for angiogenin The angiogenin secretion levels in stable transfected cells (pCI-neo, sense and antisense) were detected by ELISA. The cells were seeded at a density of 6 × 105 cells per 100 mm plate and cultured in DMEM containing 10% FBS at 37ºC under humidified 5% CO2 for 48 h. The cell number in each culture plate was counted in order to calculate the amount of secreted angiogenin. The culture medium was collected and centrifuged to remove particles. The supernatants were collected and determined by ELISA, using human angiogenin ELISA Kits (R&D System, Inc) according to the manufacturers’ instructions. The absorbance was measured at 570/630 nm using a microtiter plate reader (Multiskan Ascent, Labsystems, Finland). The amount of secreted angiogenin was normalized based on the number of cells, and the cell number used for the calculation was determined by the average of seeding cell number and the final cell number.
Table 1 Primer sequence and amplified fragment sizes Primers name
Sequence (5cĺ3c)
Size (bp)
Angiogenin
Forward: CATCATGAGGAGACGGGG
264
Reverse: TCCAAGTGGACAGGTAAGCC bFGF
Forward: ATGGCAGCCGGGAGCATCACC
235
Reverse: CACACACTCCTTTGATAGACACAA ȕ-actin
Forward: TGGGTCAGAAGGATTCCTATGT Reverse: CAGCCTGGATAGCAACGTACA
276
402
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
MTT and colony formation assays Cell proliferation was assessed using MTT assay. In brief, transfected cells were seeded into 96-well plates at a density as indicated. After 0, 24, 48, and 72 h of incubation, 100 ȝL of MTT working solution (0.5 mg/mL) was added and incubated at 37oC for 4 h. At the end of the incubation period, the media were removed and 100 ȝL of DMSO was added to lyse cells for dissolving dye. Absorbance of the converted dye was measured using a microtiter plate reader (Multiskan Ascent, Labsystems) at 492 nm. Colony formation was assessed as follows: H7402 cells were plated on 10 cm dishes at the cell density of 5 × 104 cells after transfection, and cultured in DMEM containing 600 ȝg/mL G418 for two weeks. Then the cells were washed with PBS and fixed with 4% formaldehyde and stained with 0.1% crystal violet for 10 min at room temperature.
means was determined using the Student’s t test.
Results Selection of stable transfection cells pCI-neo-bFGF-sense, pCI-neo-bFGF-antisense or empty vecotors were transfected into H7420 cells using electroporation and the transfected H7402 cells were cultured in DMEM containing 600 Pg/mL antibiotic G418 for two weeks. In two weeks most of the cells were dead, except the resistant cells containing the foreign genes survived and formed colonies (Fig. 1A). G418-resistant colonies were picked up and continuously cultured in medium in the presence of G418.
PCR with genomic DNA to identify transfectants Statistical analysis Experimental results are expressed as means ± SD of at least three independent experiments for statistical analysis. The statistical significance of difference between group
To confirm bFGF sense or antisense cDNA were integrated into genomic DNA of the transfectants, genomic DNA was isolated and PCR was carried out. The H7402 cells carrying the empty vector showed no amplification
Fig. 1. Cell selection and genomic DNA PCR to identify transfectants. A: cell selection. A1, H7402 cells; A2, 10 days after transfection, most of the cultured cells were dead in DMEM containing 600 ȝg/mL G418; A3, remaining resistant colonies two weeks after transfections. B: identification of tranfectants by genomic DNA PCR. Lane 1, DNA ladder; lanes 2–4, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lanes 5–7, H7402 cells transfected with bFGF sense cDNA; lanes 8–10, H7402 cells transfected with bFGF antisense cDNA. B1, bFGF forward primer; B2, bFGF reverse primer; T3, primer sequence from pCI-neo vector.
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
with any pair of the primers, 575 bp PCR products were obtained from the transfectants carrying bFGF sense DNA and 568 bp PCR products were obtained from the transfectants carrying antisense bFGF DNA (Fig. 1B). In this study, we obtained four pCI-neo clones, five bFGF cDNA sense clones, and four bFGF cDNA antisense clones. In the following experiments, all of the clones of each type (pCI-neo, sense, and antisense) were pooled.
Expression of bFGF in sense and antisense transfectants The expression of bFGF in transfected H7402 cells was examined at both transcriptional and translational levels by RT-PCR and Western blot assay. The expression of bFGF was significantly increased in the bFGF sense transfectants carrying bFGF sense DNA and decreased in the transfectants carrying bFGF antisense DNA (Fig. 2). These data were consistent with the results of transient transfection (Supplemental Fig. 1) and made the results more clear and convictive. These results demonstrated that the bFGF
403
sense transfectants and bFGF antisense transfectants could increase or decrease the expression of bFGF at both mRNA and protein levels.
Stable transfection of bFGF sense and antisense cDNA affects the expression of angiogenin To understand the effect of bFGF on angiogenin expression, RT-PCR and Western blot and ELISA analyses were carried out to examine the expression of angiogenin in the cells transfected bFGF sense or antisense fragments. The results showed that no obvious difference was observed between sense and antisense transfectants at mRNA level of angiogenin as assessed by RT-PCR (Fig. 3, A and B). However, the expression of angiogenin was decreased (P < 0.05) in the bFGF sense transfectants while increased (P < 0.01) in the bFGF antisense transfectants compared with the control at the protein level (Fig. 3, C and D). The secretion levels of angiogenin in culture supernatants were determined by ELISA. Fig. 4 showed that secreted
Fig. 2. bFGF expression in sense and antisense transfectants. A: RT-PCR assay for bFGF mRNA expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. B: photodensitometric analysis of PCR products in (A). The histogram showed the ratio of the intensity of bFGF bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. C: Western blot assay for bFGF protein expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. D: photodensitometric analysis of the protein expression in (C). The histogram showed the ratio of the intensity of bFGF bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. Each value represents the mean ± SD. * Significant (P < 0.05); ** Very significant (P < 0.01).
404
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
Fig. 3. Effects of stable transfection of bFGF sense and antisense cDNA on the expression of angiogenin. A: RT-PCR assay for angiogenin mRNA expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. B: photodensitometric analysis of PCR products in (A). The histogram showed the ratio of the intensity of angiogenin bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. C: Western blot assay for angiogenin protein expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. D: photodensitometric analysis of the protein expression in (C). The histogram showed the ratio of the intensity of angiogenin bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. Each value represents the means ± SD. * Significant (P < 0.05), ** Very significant (P < 0.01).
Fig. 4. ELISA assay for angiogenin expression in sense and antisense transfectants. The angiogenin secretion levels in stably transfected cells (pCI-neo, sense and antisense) were detected by ELISA. The data shown were means ± SD of three independent experiments. * Significant (P < 0.05), ** Very significant (P < 0.01).
angiogenin was lower in the sense transfectants and higher in the antisense transfectants. These results indicated that bFGF affect the expression of angiogenin at protein level but not at RNA level.
Stable transfection of bFGF sense and antisense cDNA affects cell proliferation In order to determine whether endogenous bFGF influ-
ences the proliferation of H7402 cells, the bFGF sense and antisense transfectants were cultured for 72 h and MTT assay and colony formation assay were performed. The cell proliferation was remarkably increased in the cells over-expresssing bFGF (bFGF sense transfectants) and decreased in the cells under-expressing bFGF (bFGF antisense transfectants) compared with those in controls as measured by MTT assay (Fig. 5A). Moreover, increased colony formation was observed in the cells over-expressing bFGF while decreased colony formation was observed in the cells under-expressing bFGF (Fig. 5B).
Discussion Angiogenesis is now believed to be one of the most important biological features of tumors. Tumor angiogenesis is the proliferation of a network of blood vessels that penetrates into cancerous growths, supplying nutrients and oxygen and removing waste products (Manoj et al., 2003). HCC is a hypervascular tumor characterized by neovascularization. The expression of many angiogenic factors is closely related to the growth and metastasis of HCC (Sun and Tang, 2004). Furthermore, bFGF and angiogenin are
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
405
Fig. 5. Cell proliferation measured by MTT and colony formation assays in sense and antisense transfectants. A: MTT assay. Cells were seeded into a 96-well plate with the density of 6 × 103 cells per well and cultured in DMEM at 37ºC. MTT assay was carried out after 0, 24, 48, and 72 h. The data shown are means ± SD of four independent experiments. B: colony formation assay. B1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); B2, H7402 cells transfected with bFGF sense cDNA; B3, H7402 cells transfected with bFGF antisense cDNA.
potentially important angiogenic factors because of their contributions to HCC progression. For instance, bFGF is a biological marker of tumor invasiveness and post resection recurrence in HCC (Poon et al., 2001). Angiogenin is one of the neovascularization defining factors of HCC, and measuring serum angiogenin may assist in monitoring the disease (Hisai et al., 2003). It has been reported that bFGF up-regulated the expression of vascular endothelial growth factor (VEGF) (Liu et al., 2000; Rabie and Lu, 2004; Yasuda et al., 2005). However, there is little documentation of the relationship between bFGF and angiogenin to date. It is of importance to investigate whether or not bFGF affects on the expression of angiogenin and whether or not cell proliferation in H7402 hepatoma cells is affected by bFGF. We first established H7402 cells which over- or underexpressed bFGF. Subsequently, we examined the effects of bFGF on expression of angiogenin, another angiogenic factor known to be expressed by hepatoma cells (Hisai et al., 2003). To our surprise, we observed decreased expression of angiogenin in cells over-expressing bFGF, and increased expression of angiogenin in the cells under-
expressing bFGF compared with those in the control cells (Fig. 3). Our results indicate that bFGF negatively regulates the expression of angiogenin. To our knowledge, this is the first report that bFGF regulates angiogenin negatively, although the mechanism is unclear. It has been reported that bFGF activates stress-activated protein kinases (SAPK)/c-Jun N-terminal kinase (JNK) and p44/p42 mitogen-activated protein (MAP). The MAP kinase (MAPK) stimulates VEGF release, and bFGF-activated p38 MAPK negatively regulates the VEGF release (Yasuda et al., 2005). Because there were no significant changes observed between sense and antisense transfectants at mRNA level of angiogenin in our study, it is possible that probably bFGF negatively regulates angiogenin expression at protein level via MAPK activation. Interestingly, a study also reported that angiogenin antisense transfected HeLa cells expressed enhanced amount of bFGF (Kishimoto et al., 2005). Taken together, we postulate that there might be a negative-feedback regulation between the two factors. In addition, the activity of angiogenin in stimulating cell proliferation is much lower than the typical endothelial cell
406
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
growth factor bFGF (Kishimoto et al., 2005). A previous study demonstrated that the function of angiogenin is downstream of the signal transduction pathway triggered by receptor binding (Kishimoto et al., 2005). But the exact position and the roles of angiogenin in the pathway activated by bFGF are unclear. Moreover, whether angiogenin is involved in the pathway of bFGF stimulating rRNA is not proved. Thus, the bFGF might be a more potent factor in cell proliferation and contribute to the total cell proliferation in H7402. The precise mechanisms await further investigation. We also examined the effect of stable transfection of bFGF sense and antisense cDNA on cell proliferation by carrying out MTT and colony formation assays. Cell proliferation was increased in the cells over-expressing bFGF, in contrast, decreased cell proliferation was observed in the cells under-expressing bFGF, indicating that bFGF stimulated the cell proliferation of H7402 cells and it was a major factor in cell proliferation. Our result was in agreement with the previous study that bFGF regulates proliferation and motility of human hepatoma cells by an autocrine mechanism (Kin et al., 1997). Our result was also in concordance with the previous report that the total cell proliferation decreased after the antisense oligos of bFGF transfection in HUVEC (Kishimoto et al., 2005). The mechanism on the potential role of bFGF in cell proliferation was studied recently, demonstrating that the 18 kDa bFGF interacts with a transcription factor in the nucleus, and directly regulates rRNA transcription and ribosome biogenesis, a rate-limiting process in cell growth (Sheng et al., 2003; Dailey et al., 2005). It has been reported that bFGF first binds and activates high-affinity cell surface receptors (Pederson, 1998). After internalization it can translocate into the nucleus and nucleolus (Claus et al., 2003; Xu et al., 2003; Sheng et al., 2004). Therefore, a change of bFGF expression level may affect the rRNA transcription in cell nucleus, and subsequently the cell proliferation rate. In summary, our study showed for the first time the effect of bFGF on the expression of angiogenin and demonstrated that the endogenous 18 kDa bFGF negatively regulated the expression of angiogenin. Moreover, we confirm that bFGF played an important role in stimulating cell proliferation of hepatoma cells. The results might be helpful in studying whether bFGF could be a promising target for anti-angiogenesis therapies. Further work needs to be carried out in order to find the pathway of negativefeedback regulation between bFGF and angiogenin, to identify the role of angiogenic factors in hepatoma cells and to
find more effective treatments for HCC.
Acknowledgments This work was supported by a grant (No. 20060923-02) from the Department of Science and Technology of Jilin Province, China.
Supplemental data Supplemental Fig. 1 associated with this article can be found in the online version at www.jgentgenomics.org.
References Arnaud, E., Touriol, C., Boutonnet, C., Gensac, M.C., Vagner, S., Prats, H., and Prats, A.C. (1999). A new 34-kilodalton isoform of human fibroblast growth factor 2 is cap dependently synthesized by using a non-AUG start codon and behaves as a survival factor. Mol. Cell Biol. 19: 505514. Bikfalvi, A., Klein, S., Pintucci, G., and Rifkin, D.B. (1997). Biological roles of fibroblast growth factor-2. Endocr. Rev. 18: 2645. Bouche, G., Gas, N., Prats, H., Baldin, V., Tauber, J.P., Teissié, J., and Amalric, F. (1987). Basic fibroblast growth factor enters the nucleolus and stimulates the transcription of ribosomal genes in ABAE cells undergoing G0 ėG1 transition. Proc. Natl. Acad. Sci. USA 84: 67706774. Claus, P., Doring, F., Gringel, S., Muller-Ostermeyer, F., Fuhlrott, J., Kraft, T., and Grothe, C. (2003). Differential intranuclear localization of fibroblast growth factor-2 isoforms and specific interaction with the survival of motoneuron protein. J. Biol. Chem. 278: 479485. Dailey, L., Ambrosetti, D., Mansukhani, A., and Basilico, C. (2005). Mechanisms underlying differential responses to FGF signaling. Cytokine Growth Factor Rev. 16: 233247. Delrieu, I. (2000). The high molecular weight isoforms of basic fibroblast growth factor (FGF-2): An insight into an intracrine mechanism. FEBS Lett. 468: 610. Fett, J.W., Strydom, D.J., Lobb, R.R., Alderman, E.M., Bethune, J.L., Riordan, J.F., and Vallee, B.L. (1985). Isolation and characterization of angiogenin, an angiogenic protein from human carcinoma cells. Biochemistry 24: 54805486. Florkiewicz, R.Z., Anchin, J., and Baird, A. (1998). The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+, K+-ATPase. J. Biol. Chem. 273: 544551. Hisai, H., Kato, J., Kobune, M., Murakami, T., Miyanishi, K., Takahashi, M., Yoshizaki, N., Takimoto, R., Terui, T., and Niitsu, Y. (2003). Increased expression of angiogenin in hepatocellular carcinoma in correlation with tumor vascularity. Clin. Cancer Res. 9: 48524859. Kin, M., Sata, M., Ueno, T., Torimura, T., Inuzuka, S., Tsuji, R., Sujaku, K., Sakamoto, M., Sugawara, H., Tamaki, S., and Tanikawa, K. (1997). Basic fibroblast growth factor regulates proliferation and
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
motility of human hepatoma cells by an autocrine mechanism. J. Hepatol. 27: 677687. Kishimoto, K., Liu, S., Tsuji, T., Olson, K.A., and Hu G.F. (2005). Endogenous angiogenin in endothelial cells is a general requirement for cell proliferation and angiogenesis. Oncogene 24: 445456. Liu, X., Zheng, S.X., Zhou, L.J., and Zhu, X.Z. (2000). Basic fibroblast growth factor up-regulates the expression of vascular endothelial growth factor in primary cultured rat astrocytes. Acta Pharmacol. Sin. 21: 1922. Majumder, P.K., Yeh, J.J., George, D.J., Febbo, P.G., Kum, J., Xue, Q., Bikoff, R., Ma, H., Kantoff, P.W., Golub, T.R., Loda, M., and Sellers, W.R. (2003). Prostate intraepithelial neoplasia induced by prostate restricted Akt activation: The MPAKT model. Proc. Natl. Acad. Sci. USA 100: 78417846. Manoj K.G., Qin R.Y. (2003). Mechanism and its regulation of tumor-induced angiogenesis. World J. Gastroenterol. 9:11441155. McKillop, I.H., and Schrum, L.W. (2005). Alcohol and liver cancer. Alcohol 35: 195203. Mise, M., Arii, S., Higashituji, H., Furutani, M., Niwano, M., Harada, T., Ishigami, S., Toda, Y., Nakayama, H., Fukumoto, M., Fujita, J., and Imamura, M. (1996). Clinical significance of vascular endothelial growth factor and basic fibroblast growth factor gene expression in liver tumor. Hepatology 23: 455464. Musolino, C., Alonci, A., Bellomo, G., Loteta, B., Quartarone, E., Gangemi, D., Massara, E., and Calabrò, L. (2004). Levels of soluble angiogenin in chronic myeloid malignancies: Clinical implications. Eur. J. Haematol. 72: 416419. Olson, K.A., Fett, J.W., French, T.C., Key, M.E., and Vallee, B.L. (1995). Angiogenin antagonists prevent tumor growth in vivo. Proc. Natl. Acad. Sci. USA 92: 442446. Pederson T. (1998). Growth factors in the nucleolus? J. Cell Biol. 143: 279281. Poon R.T., Ng I.O., Lau C., Yu W.C., Fan S.T., and Wong J. (2001). Correlation of serum basic fibroblast growth factor levels with clinicopathologic features and postoperative recurrence in hepatocellular carcinoma. Am. J. Surg. 182: 298304. Rabie, A.B., and Lu, M. (2004). Basic fibroblast growth factor up-regulates the expression of vascular endothelial growth factor during healing of allogeneic bone graft. Arch. Oral Biol. 49: 10251033.
407
Ramírez-Solis, R., Rivera-Pérez, J., Wallace, J.D., Wims, M., Zheng, H., and Bradley, A. (1992). Genomic DNA microextraction: A method to screen numerous samples. Anal. Biochem. 201: 331335. Sheng, Z., Chang, S.B., and Chirico, W.J. (2003). Expression and purification of a biologically active basic fibroblast growth factor fusion protein. Protein Expr. Purif. 27: 267271. Sheng, Z., Lewis, J.A., and Chirico, W.J. (2004). Nuclear and nucleolar localization of 18-kDa fibroblast growth factor-2 is controlled by C-terminal signals. J. Biol. Chem. 279: 4015340160. Sheng, Z., Liang, Y., Lin, C.Y., Comai, L., and Chirico, W.J. (2005). Direct regulation of rRNA transcription by fibroblast growth factor 2. Mol. Cell Biol. 25: 94199426. Shimoyama, S., and Kaminishi, M. (2003). Angiogenin in sera as an independent prognostic factor in gastric cancer. J. Cancer Res. Clin. Oncol. 129: 239244. Sun, H.C., and Tang, Z.Y. (2004).Angiogenesis in hepatocellular carcinoma: The retrospectives and perspectives. J. Cancer Res. Clin. Oncol. 130: 307319. Tsuji, T., Sun, Y., Kishimoto, K., Olson, K.A., Liu, S., Hirukawa, S., and Hu, G.F. (2005). Angiogenin is translocated to the nucleus of HeLa cells and is involved in ribosomal RNA transcription and cell proliferation. Cancer Res. 65: 13521360. Ugurel, S., Rappl, G., Tilgen, W., and Reinhold, U. (2001). Increased serum concentration of angiogenic factors in malignant melanoma patients correlates with tumor progression and survival. J. Clin. Oncol. 19: 577583. Xu, Z.P., Tsuji, T., Riordan, J.F., and Hu, G.F. (2003). Identification and characterization of an angiogenin-binding DNA sequence that stimulates luciferase reporter gene expression. Biochemistry 42: 121128. Yasuda, E., Tokuda, H., Ishisaki, A., Hirade, K., Kanno, Y., Hanai, Y., Nakamura, N., Noda, T., Katagiri, Y., and Kozawa, O. (2005). PPAR-gamma ligands up-regulate basic fibroblast growth factor-induced VEGF release through amplifying SAPK/JNK activation in osteoblasts. Biochem. Biophys. Res. Commun. 328: 137143. Yoshioka, N., Wang, L., Kishimoto, K., Tsuji, T., and Hu, G.F. (2006). A therapeutic target for prostate cancer based on angiogenin-stimulated angiogenesis and cancer cell proliferation. Proc. Natl. Acad. Sci. USA 103: 1451914524.
GENETICS AND GENOMICS J. Genet. Genomics 36 (2009) 399407
www.jgenetgenomics.org
Effects of basic fibroblast growth factor on angiogenin expression and cell proliferation in H7402 human hepatoma cells Ji Wang, Jianli Yang, Dawei Yuan, Jun Wang, Jia Zhao, Li Wang* Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024, China Received for publication 21 December 2008; revised 3 March 2009; accepted 24 March 2009
Abstract Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide. Basic fibroblast growth factor (bFGF), which is highly expressed in developing tissues and malignant cells, regulates cell growth, differentiation, and migration. Its expression is essential for the progression and metastasis of HCC. This study aims to investigate the effects of bFGF on the expression of angiogenin, another growth factor, which plays an important role in tumor angiogenesis, and on cell proliferation in H7402 human hepatoma cells. The bFGF sense cDNA or antisense cDNA was stably transfected into H7402 cells. Genomic DNA PCR analysis demonstrated that human bFGF sense cDNA or antisense cDNA was inserted into the genome. Furthermore, the expression of bFGF and angiogenin was examined by RT-PCR and Western blot assays. MTT and colony formation assays were employed to determine cell proliferation. Stable bFGF over-expressing and under-expressing transfectants were successfully established. Expression of angiogenin was decreased in the over-expressing bFGF cells (sense transfectants) and was increased in the under-expressing bFGF cells (antisense transfectants). Cell proliferation increased in the bFGF sense transfectants and decreased in the bFGF antisense transfectants. These results demonstrated that the endogenous bFGF may not only negatively regulate the angiogenin expression but also contribute to the overall cell proliferation in H7402 human hepatoma cells. This study may be helpful in finding a potential therapeutic approach to HCC. Keywords: H7402 human hepatoma cells; basic fibroblast growth factor (bFGF); angiogenin; cell proliferation
Introduction Hepatocellular carcinoma (HCC) is the most common hypervascular tumor and is one of the most common cancers worldwide (Mise et al., 1996; McKillop and Schrum, 2005). The growth and metastasis of solid tumor depends on angiogenesis. Recent studies demonstrated that the expressions of many angiogenic factors are closely related to the growth and metastasis of HCC (Hisai et al., 2003). Among the known angiogenic factors, basic fibroblast growth factor (bFGF) and angiogenin are potent and rep* Corresponding author. Tel: +86-431-8509 9360; Fax: +86-431-8569 5065. E-mail address: [email protected] DOI: 10.1016/S1673-8527(08)60129-0
resentative factors involved in tumor development. However, the interrelationships among these factors and their effects on tumor development and angiogenesis, especially on HCC, are still poorly understood. Previous study has shown that bFGF is an important modulator responsible for cell proliferation, development and migration under both physiological and pathological conditions (Bikfalvi et al., 1997). Differential initiation of translation from alternative initiation codons of a single bFGF mRNA yields five isoforms with different molecular weights. The four higher molecular weight forms (22, 22.5, 24 and 34 kDa) are predominantly located in the cell nucleus while the lowest molecular weight form (18 kDa) is found in the cytosol (Florkiewicz et al., 1998; Arnaud et al.,
400
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
1999; Delrieu, 2000). The 18 kDa bFGF isoform is released from cells by a non-classical secretory pathway, and it binds to cell surface receptors and translocates into the nucleus (Florkiewicz et al., 1998; Dailey et al., 2005). Besides cytosol, the 18 kDa bFGF also localizes in the nucleus (Claus et al., 2003; Sheng et al., 2004). One of the functions of 18 kDa bFGF is to directly regulate rRNA transcription and ribosome biogenesis, the rate-limiting processes in cell growth (Sheng et al., 2005). Angiogenin is a 14 kDa angiogenic protein, which is originally isolated from a medium conditioned by HT-29 human colon adenocarcinoma cells based on its angiogenic activity (Fett et al., 1985). The protein has been shown to play an important role in tumor angiogenesis (Olson et al., 1995). Its expression is up-regulated in many types of cancers including HCC (Majumder et al., 2001; Ugurel et al., 2001; Hisai et al., 2003; Shimoyama and Kaminishi, 2003; Musolino et al., 2004). Similar to bFGF, angiogenin undergoes nuclear translocation and regulates rRNA transcription in endothelial cells and some tumor cells (Tsuji et al., 2005; Yoshioka et al., 2006). In addition to its angiogenic activity, angiogenin also plays a role in cancer cell proliferation. Our study aims to reveal the effects of bFGF on angiogenin expression and cell proliferation of H7402 human hepatoma cells. We first established the stable transfected H7402 cells that over- or under-express bFGF. Then we investigated the influence of bFGF on the expression of angiogenin and on cell proliferation in H7402 human hepatoma cells. The results showed that the endogenous bFGF negatively regulated the angiogenin expression but stimulated cell proliferation of hepatoma cell. This study demonstrated that there was a relationship between these two important growth factors and it might be helpful in finding a potential therapeutic approach to HCC.
Materials and methods Plasmids construction A human bFGF cDNA was obtained by reverse transcription-polymerase chain reaction (RT-PCR), using primers based on the known bFGF sequence (GenBank accession no. J04513; forward primer: 5c-TCTGAATTCA TGGCAGCCGGGAGCATCAC-3ƍ and reverse primer: 5c-TCTGGTCGAAAAATCAGCTCTTAGCAGAC-3c). The template DNA was from bFGF cDNA and the PCR condition was as follows: denaturation at 94ºC for 5 min;
35 cycles of denaturation at 94ºC for 1 min, annealing at 58ºC for 1 min and extension at 72ºC for 1 min; extension at 72ºC for 10 min. The resulting PCR products were purified and inserted into the pUCm-T vector (Sangon, Shanghai, China) to yield pUCm-T-bFGF. The plasmid was digested with two pairs of restriction enzyme EcoR I/Sal I and Xho I/Not I, respectively. The two excised fragments were cloned into the EcoR I/Sal I and Xho I/Not I of pCI-neo mammalian expression vector, respectively. This enabled the bFGF cDNA to be inserted into the vector both in sense and antisense orientations. The generated constructs were confirmed by sequencing and were named as pCI-neo-bFGF-sense and pCI-neo-bFGF-antisense.
Cell culture The human hepatoma cell line H7402 was acquired from the Medical School of Jinlin University, China. The cells were cultured in Dulbecco’s Modified Eagel Medium (DMEM) supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 U/mL penicillin and 100 mg/mL streptomycin at 37ºC in a humidified atmosphere containing 5% CO2.
Stable transfection The empty pCI-neo vector and plasmids containing the human bFGF sense or antisense cDNA (pCI-neo-bFGFsense and pCI-neo-bFGF-antisense) were introduced into H7402 cells by the electroporation method using Bio-Rad Gene Pulser XcellTM Electroporation System (Bio-Rad Laboratories Inc., Hercules, CA, USA) following the manufacturer’s instructions. Forty-eight hours after transfection, the medium was replaced with the selection medium containing 600 Pg/mL G418 (GIBCO, Invitrogen Corporation, Carlabad, CA, USA). The selection medium was changed every 3 or 4 days until G418-resistant colonies appeared. The remaining colonies were then individually picked out and subcultured in the G418-conatining medium.
Genomic DNA PCR analysis of transfected bFGF genes in cloned cells To confirm that the bFGF sense or antisense cDNA was integrated into the H7402 genome, polymerase chain reaction (PCR) was carried out using genomic DNA of cloned cells. Genomic DNA was extracted from confluent cells as described previously (RamÕ’rez-Solis et al., 1992). One
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
microliter of the genomic DNA from each sample was used for PCR amplification. The primers were B1, bFGF forward primer (5c-TCTGAATTCATGGCAGCCGGGAG CATCAC-3c); B2, bFGF reverse primer (5c-TCTGGTCGA AAAATCAGCTCTTAGCAGAC-3c); and T3, from the pCI-neo vector (5c-ATCATGTCTGCTCGAAGCATTAAC-3c). The PCR products were analyzed on 1 % agarose gel electrophoresis.
RT-PCR assay Total RNA was isolated from pCI-neo, bFGF sense and bFGF antisense transfected cells using the Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. One microliter of total RNA was reverse transcribed with Improm-ĊTM reverse transcriptase per reaction according to the manufacturer’s instructions (Promega, WI, USA). All the cDNA samples were diluted 1:5 in DEPC water (Biotech, CA) prior to amplification. The generated cDNA was then amplified by PCR with 12.5 PL Premix Taq DNA polymerase (TaKaRa, Japan) and 2 PL of each primer (2.5 Pmol/L) in 25 PL reaction volume. The PCR was performed in thermal cycler (Thermo Electron Corporation, USA) with the following thermal cycle conditions: denaturation at 94ºC for 30 s, annealing for 30 s and extension at 72ºC for 40 s for 28 cycles. Primers used in this study and the expected size of the amplified DNA are listed in Table 1. Electrophoresis of amplified products was carried out on 1.5% agarose gels.
Western blot assay The cells (pCI-neo, bFGF sense and bFGF antisense transfected) were harvested and washed twice with ice-cold PBS. The whole cell extracts were obtained by lysing the cells with the lysis buffer containing 50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, 50 mmol/L sodium pyrophosphate, 1 mmol/L NaF, 1 mmol/L Na3VO4, 30
401
mmol/L Na4P2O7, 1% NP-40, and 1 mmol/L phenylmethylsulfonyl fluoride. Twenty micrograms of protein from each sample was subjected to 15% SDS-polyacrylamide gels and electrophoretically transferred to nitrocellulose membrane following the protocol suggested by the manufacturer (Bio-Rad). The membrane was blocked overnight at 4ºC with 5% nonfat milk in TBS (10 mmol/L Tris-HCl pH 7.5, 150 mmol/L NaCl) containing 0.05% Tween-20. Then the membrane was incubated with primary antibodies against bFGF (R&D System, Inc, USA), angiogenin (prepared in our lab) or ȕ-actin (Sigma-Aldrich, St. Louis, MI, USA) for 1 h at 37 ºC. Followed by incubation with HRP-conjugated IgG (Beijing ZhongShan Golden Bridge Biotechnology Co. Ltd, Beijing, China) for 1 h at 37ºC. The results were visualized by enhanced chemiluminescence (ECL) using Pierce Biotechnology SuperSignal West Pico Chemiluminescent substrate. The ȕ-actin was co-analyzed as the internal control at the same time.
ELISA assay for angiogenin The angiogenin secretion levels in stable transfected cells (pCI-neo, sense and antisense) were detected by ELISA. The cells were seeded at a density of 6 × 105 cells per 100 mm plate and cultured in DMEM containing 10% FBS at 37ºC under humidified 5% CO2 for 48 h. The cell number in each culture plate was counted in order to calculate the amount of secreted angiogenin. The culture medium was collected and centrifuged to remove particles. The supernatants were collected and determined by ELISA, using human angiogenin ELISA Kits (R&D System, Inc) according to the manufacturers’ instructions. The absorbance was measured at 570/630 nm using a microtiter plate reader (Multiskan Ascent, Labsystems, Finland). The amount of secreted angiogenin was normalized based on the number of cells, and the cell number used for the calculation was determined by the average of seeding cell number and the final cell number.
Table 1 Primer sequence and amplified fragment sizes Primers name
Sequence (5cĺ3c)
Size (bp)
Angiogenin
Forward: CATCATGAGGAGACGGGG
264
Reverse: TCCAAGTGGACAGGTAAGCC bFGF
Forward: ATGGCAGCCGGGAGCATCACC
235
Reverse: CACACACTCCTTTGATAGACACAA ȕ-actin
Forward: TGGGTCAGAAGGATTCCTATGT Reverse: CAGCCTGGATAGCAACGTACA
276
402
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
MTT and colony formation assays Cell proliferation was assessed using MTT assay. In brief, transfected cells were seeded into 96-well plates at a density as indicated. After 0, 24, 48, and 72 h of incubation, 100 ȝL of MTT working solution (0.5 mg/mL) was added and incubated at 37oC for 4 h. At the end of the incubation period, the media were removed and 100 ȝL of DMSO was added to lyse cells for dissolving dye. Absorbance of the converted dye was measured using a microtiter plate reader (Multiskan Ascent, Labsystems) at 492 nm. Colony formation was assessed as follows: H7402 cells were plated on 10 cm dishes at the cell density of 5 × 104 cells after transfection, and cultured in DMEM containing 600 ȝg/mL G418 for two weeks. Then the cells were washed with PBS and fixed with 4% formaldehyde and stained with 0.1% crystal violet for 10 min at room temperature.
means was determined using the Student’s t test.
Results Selection of stable transfection cells pCI-neo-bFGF-sense, pCI-neo-bFGF-antisense or empty vecotors were transfected into H7420 cells using electroporation and the transfected H7402 cells were cultured in DMEM containing 600 Pg/mL antibiotic G418 for two weeks. In two weeks most of the cells were dead, except the resistant cells containing the foreign genes survived and formed colonies (Fig. 1A). G418-resistant colonies were picked up and continuously cultured in medium in the presence of G418.
PCR with genomic DNA to identify transfectants Statistical analysis Experimental results are expressed as means ± SD of at least three independent experiments for statistical analysis. The statistical significance of difference between group
To confirm bFGF sense or antisense cDNA were integrated into genomic DNA of the transfectants, genomic DNA was isolated and PCR was carried out. The H7402 cells carrying the empty vector showed no amplification
Fig. 1. Cell selection and genomic DNA PCR to identify transfectants. A: cell selection. A1, H7402 cells; A2, 10 days after transfection, most of the cultured cells were dead in DMEM containing 600 ȝg/mL G418; A3, remaining resistant colonies two weeks after transfections. B: identification of tranfectants by genomic DNA PCR. Lane 1, DNA ladder; lanes 2–4, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lanes 5–7, H7402 cells transfected with bFGF sense cDNA; lanes 8–10, H7402 cells transfected with bFGF antisense cDNA. B1, bFGF forward primer; B2, bFGF reverse primer; T3, primer sequence from pCI-neo vector.
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
with any pair of the primers, 575 bp PCR products were obtained from the transfectants carrying bFGF sense DNA and 568 bp PCR products were obtained from the transfectants carrying antisense bFGF DNA (Fig. 1B). In this study, we obtained four pCI-neo clones, five bFGF cDNA sense clones, and four bFGF cDNA antisense clones. In the following experiments, all of the clones of each type (pCI-neo, sense, and antisense) were pooled.
Expression of bFGF in sense and antisense transfectants The expression of bFGF in transfected H7402 cells was examined at both transcriptional and translational levels by RT-PCR and Western blot assay. The expression of bFGF was significantly increased in the bFGF sense transfectants carrying bFGF sense DNA and decreased in the transfectants carrying bFGF antisense DNA (Fig. 2). These data were consistent with the results of transient transfection (Supplemental Fig. 1) and made the results more clear and convictive. These results demonstrated that the bFGF
403
sense transfectants and bFGF antisense transfectants could increase or decrease the expression of bFGF at both mRNA and protein levels.
Stable transfection of bFGF sense and antisense cDNA affects the expression of angiogenin To understand the effect of bFGF on angiogenin expression, RT-PCR and Western blot and ELISA analyses were carried out to examine the expression of angiogenin in the cells transfected bFGF sense or antisense fragments. The results showed that no obvious difference was observed between sense and antisense transfectants at mRNA level of angiogenin as assessed by RT-PCR (Fig. 3, A and B). However, the expression of angiogenin was decreased (P < 0.05) in the bFGF sense transfectants while increased (P < 0.01) in the bFGF antisense transfectants compared with the control at the protein level (Fig. 3, C and D). The secretion levels of angiogenin in culture supernatants were determined by ELISA. Fig. 4 showed that secreted
Fig. 2. bFGF expression in sense and antisense transfectants. A: RT-PCR assay for bFGF mRNA expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. B: photodensitometric analysis of PCR products in (A). The histogram showed the ratio of the intensity of bFGF bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. C: Western blot assay for bFGF protein expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. D: photodensitometric analysis of the protein expression in (C). The histogram showed the ratio of the intensity of bFGF bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. Each value represents the mean ± SD. * Significant (P < 0.05); ** Very significant (P < 0.01).
404
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
Fig. 3. Effects of stable transfection of bFGF sense and antisense cDNA on the expression of angiogenin. A: RT-PCR assay for angiogenin mRNA expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. B: photodensitometric analysis of PCR products in (A). The histogram showed the ratio of the intensity of angiogenin bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. C: Western blot assay for angiogenin protein expression in sense and antisense transfectants. Lane 1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); lane 2, H7402 cells transfected with bFGF sense cDNA; lane 3, H7402 cells transfected with bFGF antisense cDNA. D: photodensitometric analysis of the protein expression in (C). The histogram showed the ratio of the intensity of angiogenin bands to that of ȕ-actin bands. The figure is representative of three independent experiments with similar results. Each value represents the means ± SD. * Significant (P < 0.05), ** Very significant (P < 0.01).
Fig. 4. ELISA assay for angiogenin expression in sense and antisense transfectants. The angiogenin secretion levels in stably transfected cells (pCI-neo, sense and antisense) were detected by ELISA. The data shown were means ± SD of three independent experiments. * Significant (P < 0.05), ** Very significant (P < 0.01).
angiogenin was lower in the sense transfectants and higher in the antisense transfectants. These results indicated that bFGF affect the expression of angiogenin at protein level but not at RNA level.
Stable transfection of bFGF sense and antisense cDNA affects cell proliferation In order to determine whether endogenous bFGF influ-
ences the proliferation of H7402 cells, the bFGF sense and antisense transfectants were cultured for 72 h and MTT assay and colony formation assay were performed. The cell proliferation was remarkably increased in the cells over-expresssing bFGF (bFGF sense transfectants) and decreased in the cells under-expressing bFGF (bFGF antisense transfectants) compared with those in controls as measured by MTT assay (Fig. 5A). Moreover, increased colony formation was observed in the cells over-expressing bFGF while decreased colony formation was observed in the cells under-expressing bFGF (Fig. 5B).
Discussion Angiogenesis is now believed to be one of the most important biological features of tumors. Tumor angiogenesis is the proliferation of a network of blood vessels that penetrates into cancerous growths, supplying nutrients and oxygen and removing waste products (Manoj et al., 2003). HCC is a hypervascular tumor characterized by neovascularization. The expression of many angiogenic factors is closely related to the growth and metastasis of HCC (Sun and Tang, 2004). Furthermore, bFGF and angiogenin are
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
405
Fig. 5. Cell proliferation measured by MTT and colony formation assays in sense and antisense transfectants. A: MTT assay. Cells were seeded into a 96-well plate with the density of 6 × 103 cells per well and cultured in DMEM at 37ºC. MTT assay was carried out after 0, 24, 48, and 72 h. The data shown are means ± SD of four independent experiments. B: colony formation assay. B1, H7402 cells transfected with empty pCI-neo vector (pCI-neo); B2, H7402 cells transfected with bFGF sense cDNA; B3, H7402 cells transfected with bFGF antisense cDNA.
potentially important angiogenic factors because of their contributions to HCC progression. For instance, bFGF is a biological marker of tumor invasiveness and post resection recurrence in HCC (Poon et al., 2001). Angiogenin is one of the neovascularization defining factors of HCC, and measuring serum angiogenin may assist in monitoring the disease (Hisai et al., 2003). It has been reported that bFGF up-regulated the expression of vascular endothelial growth factor (VEGF) (Liu et al., 2000; Rabie and Lu, 2004; Yasuda et al., 2005). However, there is little documentation of the relationship between bFGF and angiogenin to date. It is of importance to investigate whether or not bFGF affects on the expression of angiogenin and whether or not cell proliferation in H7402 hepatoma cells is affected by bFGF. We first established H7402 cells which over- or underexpressed bFGF. Subsequently, we examined the effects of bFGF on expression of angiogenin, another angiogenic factor known to be expressed by hepatoma cells (Hisai et al., 2003). To our surprise, we observed decreased expression of angiogenin in cells over-expressing bFGF, and increased expression of angiogenin in the cells under-
expressing bFGF compared with those in the control cells (Fig. 3). Our results indicate that bFGF negatively regulates the expression of angiogenin. To our knowledge, this is the first report that bFGF regulates angiogenin negatively, although the mechanism is unclear. It has been reported that bFGF activates stress-activated protein kinases (SAPK)/c-Jun N-terminal kinase (JNK) and p44/p42 mitogen-activated protein (MAP). The MAP kinase (MAPK) stimulates VEGF release, and bFGF-activated p38 MAPK negatively regulates the VEGF release (Yasuda et al., 2005). Because there were no significant changes observed between sense and antisense transfectants at mRNA level of angiogenin in our study, it is possible that probably bFGF negatively regulates angiogenin expression at protein level via MAPK activation. Interestingly, a study also reported that angiogenin antisense transfected HeLa cells expressed enhanced amount of bFGF (Kishimoto et al., 2005). Taken together, we postulate that there might be a negative-feedback regulation between the two factors. In addition, the activity of angiogenin in stimulating cell proliferation is much lower than the typical endothelial cell
406
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
growth factor bFGF (Kishimoto et al., 2005). A previous study demonstrated that the function of angiogenin is downstream of the signal transduction pathway triggered by receptor binding (Kishimoto et al., 2005). But the exact position and the roles of angiogenin in the pathway activated by bFGF are unclear. Moreover, whether angiogenin is involved in the pathway of bFGF stimulating rRNA is not proved. Thus, the bFGF might be a more potent factor in cell proliferation and contribute to the total cell proliferation in H7402. The precise mechanisms await further investigation. We also examined the effect of stable transfection of bFGF sense and antisense cDNA on cell proliferation by carrying out MTT and colony formation assays. Cell proliferation was increased in the cells over-expressing bFGF, in contrast, decreased cell proliferation was observed in the cells under-expressing bFGF, indicating that bFGF stimulated the cell proliferation of H7402 cells and it was a major factor in cell proliferation. Our result was in agreement with the previous study that bFGF regulates proliferation and motility of human hepatoma cells by an autocrine mechanism (Kin et al., 1997). Our result was also in concordance with the previous report that the total cell proliferation decreased after the antisense oligos of bFGF transfection in HUVEC (Kishimoto et al., 2005). The mechanism on the potential role of bFGF in cell proliferation was studied recently, demonstrating that the 18 kDa bFGF interacts with a transcription factor in the nucleus, and directly regulates rRNA transcription and ribosome biogenesis, a rate-limiting process in cell growth (Sheng et al., 2003; Dailey et al., 2005). It has been reported that bFGF first binds and activates high-affinity cell surface receptors (Pederson, 1998). After internalization it can translocate into the nucleus and nucleolus (Claus et al., 2003; Xu et al., 2003; Sheng et al., 2004). Therefore, a change of bFGF expression level may affect the rRNA transcription in cell nucleus, and subsequently the cell proliferation rate. In summary, our study showed for the first time the effect of bFGF on the expression of angiogenin and demonstrated that the endogenous 18 kDa bFGF negatively regulated the expression of angiogenin. Moreover, we confirm that bFGF played an important role in stimulating cell proliferation of hepatoma cells. The results might be helpful in studying whether bFGF could be a promising target for anti-angiogenesis therapies. Further work needs to be carried out in order to find the pathway of negativefeedback regulation between bFGF and angiogenin, to identify the role of angiogenic factors in hepatoma cells and to
find more effective treatments for HCC.
Acknowledgments This work was supported by a grant (No. 20060923-02) from the Department of Science and Technology of Jilin Province, China.
Supplemental data Supplemental Fig. 1 associated with this article can be found in the online version at www.jgentgenomics.org.
References Arnaud, E., Touriol, C., Boutonnet, C., Gensac, M.C., Vagner, S., Prats, H., and Prats, A.C. (1999). A new 34-kilodalton isoform of human fibroblast growth factor 2 is cap dependently synthesized by using a non-AUG start codon and behaves as a survival factor. Mol. Cell Biol. 19: 505514. Bikfalvi, A., Klein, S., Pintucci, G., and Rifkin, D.B. (1997). Biological roles of fibroblast growth factor-2. Endocr. Rev. 18: 2645. Bouche, G., Gas, N., Prats, H., Baldin, V., Tauber, J.P., Teissié, J., and Amalric, F. (1987). Basic fibroblast growth factor enters the nucleolus and stimulates the transcription of ribosomal genes in ABAE cells undergoing G0 ėG1 transition. Proc. Natl. Acad. Sci. USA 84: 67706774. Claus, P., Doring, F., Gringel, S., Muller-Ostermeyer, F., Fuhlrott, J., Kraft, T., and Grothe, C. (2003). Differential intranuclear localization of fibroblast growth factor-2 isoforms and specific interaction with the survival of motoneuron protein. J. Biol. Chem. 278: 479485. Dailey, L., Ambrosetti, D., Mansukhani, A., and Basilico, C. (2005). Mechanisms underlying differential responses to FGF signaling. Cytokine Growth Factor Rev. 16: 233247. Delrieu, I. (2000). The high molecular weight isoforms of basic fibroblast growth factor (FGF-2): An insight into an intracrine mechanism. FEBS Lett. 468: 610. Fett, J.W., Strydom, D.J., Lobb, R.R., Alderman, E.M., Bethune, J.L., Riordan, J.F., and Vallee, B.L. (1985). Isolation and characterization of angiogenin, an angiogenic protein from human carcinoma cells. Biochemistry 24: 54805486. Florkiewicz, R.Z., Anchin, J., and Baird, A. (1998). The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+, K+-ATPase. J. Biol. Chem. 273: 544551. Hisai, H., Kato, J., Kobune, M., Murakami, T., Miyanishi, K., Takahashi, M., Yoshizaki, N., Takimoto, R., Terui, T., and Niitsu, Y. (2003). Increased expression of angiogenin in hepatocellular carcinoma in correlation with tumor vascularity. Clin. Cancer Res. 9: 48524859. Kin, M., Sata, M., Ueno, T., Torimura, T., Inuzuka, S., Tsuji, R., Sujaku, K., Sakamoto, M., Sugawara, H., Tamaki, S., and Tanikawa, K. (1997). Basic fibroblast growth factor regulates proliferation and
Ji Wang et al. / Journal of Genetics and Genomics 36 (2009) 399407
motility of human hepatoma cells by an autocrine mechanism. J. Hepatol. 27: 677687. Kishimoto, K., Liu, S., Tsuji, T., Olson, K.A., and Hu G.F. (2005). Endogenous angiogenin in endothelial cells is a general requirement for cell proliferation and angiogenesis. Oncogene 24: 445456. Liu, X., Zheng, S.X., Zhou, L.J., and Zhu, X.Z. (2000). Basic fibroblast growth factor up-regulates the expression of vascular endothelial growth factor in primary cultured rat astrocytes. Acta Pharmacol. Sin. 21: 1922. Majumder, P.K., Yeh, J.J., George, D.J., Febbo, P.G., Kum, J., Xue, Q., Bikoff, R., Ma, H., Kantoff, P.W., Golub, T.R., Loda, M., and Sellers, W.R. (2003). Prostate intraepithelial neoplasia induced by prostate restricted Akt activation: The MPAKT model. Proc. Natl. Acad. Sci. USA 100: 78417846. Manoj K.G., Qin R.Y. (2003). Mechanism and its regulation of tumor-induced angiogenesis. World J. Gastroenterol. 9:11441155. McKillop, I.H., and Schrum, L.W. (2005). Alcohol and liver cancer. Alcohol 35: 195203. Mise, M., Arii, S., Higashituji, H., Furutani, M., Niwano, M., Harada, T., Ishigami, S., Toda, Y., Nakayama, H., Fukumoto, M., Fujita, J., and Imamura, M. (1996). Clinical significance of vascular endothelial growth factor and basic fibroblast growth factor gene expression in liver tumor. Hepatology 23: 455464. Musolino, C., Alonci, A., Bellomo, G., Loteta, B., Quartarone, E., Gangemi, D., Massara, E., and Calabrò, L. (2004). Levels of soluble angiogenin in chronic myeloid malignancies: Clinical implications. Eur. J. Haematol. 72: 416419. Olson, K.A., Fett, J.W., French, T.C., Key, M.E., and Vallee, B.L. (1995). Angiogenin antagonists prevent tumor growth in vivo. Proc. Natl. Acad. Sci. USA 92: 442446. Pederson T. (1998). Growth factors in the nucleolus? J. Cell Biol. 143: 279281. Poon R.T., Ng I.O., Lau C., Yu W.C., Fan S.T., and Wong J. (2001). Correlation of serum basic fibroblast growth factor levels with clinicopathologic features and postoperative recurrence in hepatocellular carcinoma. Am. J. Surg. 182: 298304. Rabie, A.B., and Lu, M. (2004). Basic fibroblast growth factor up-regulates the expression of vascular endothelial growth factor during healing of allogeneic bone graft. Arch. Oral Biol. 49: 10251033.
407
Ramírez-Solis, R., Rivera-Pérez, J., Wallace, J.D., Wims, M., Zheng, H., and Bradley, A. (1992). Genomic DNA microextraction: A method to screen numerous samples. Anal. Biochem. 201: 331335. Sheng, Z., Chang, S.B., and Chirico, W.J. (2003). Expression and purification of a biologically active basic fibroblast growth factor fusion protein. Protein Expr. Purif. 27: 267271. Sheng, Z., Lewis, J.A., and Chirico, W.J. (2004). Nuclear and nucleolar localization of 18-kDa fibroblast growth factor-2 is controlled by C-terminal signals. J. Biol. Chem. 279: 4015340160. Sheng, Z., Liang, Y., Lin, C.Y., Comai, L., and Chirico, W.J. (2005). Direct regulation of rRNA transcription by fibroblast growth factor 2. Mol. Cell Biol. 25: 94199426. Shimoyama, S., and Kaminishi, M. (2003). Angiogenin in sera as an independent prognostic factor in gastric cancer. J. Cancer Res. Clin. Oncol. 129: 239244. Sun, H.C., and Tang, Z.Y. (2004).Angiogenesis in hepatocellular carcinoma: The retrospectives and perspectives. J. Cancer Res. Clin. Oncol. 130: 307319. Tsuji, T., Sun, Y., Kishimoto, K., Olson, K.A., Liu, S., Hirukawa, S., and Hu, G.F. (2005). Angiogenin is translocated to the nucleus of HeLa cells and is involved in ribosomal RNA transcription and cell proliferation. Cancer Res. 65: 13521360. Ugurel, S., Rappl, G., Tilgen, W., and Reinhold, U. (2001). Increased serum concentration of angiogenic factors in malignant melanoma patients correlates with tumor progression and survival. J. Clin. Oncol. 19: 577583. Xu, Z.P., Tsuji, T., Riordan, J.F., and Hu, G.F. (2003). Identification and characterization of an angiogenin-binding DNA sequence that stimulates luciferase reporter gene expression. Biochemistry 42: 121128. Yasuda, E., Tokuda, H., Ishisaki, A., Hirade, K., Kanno, Y., Hanai, Y., Nakamura, N., Noda, T., Katagiri, Y., and Kozawa, O. (2005). PPAR-gamma ligands up-regulate basic fibroblast growth factor-induced VEGF release through amplifying SAPK/JNK activation in osteoblasts. Biochem. Biophys. Res. Commun. 328: 137143. Yoshioka, N., Wang, L., Kishimoto, K., Tsuji, T., and Hu, G.F. (2006). A therapeutic target for prostate cancer based on angiogenin-stimulated angiogenesis and cancer cell proliferation. Proc. Natl. Acad. Sci. USA 103: 1451914524.