Effects of bisphenol analogues on steroidogenic gene expression and hormone synthesis in H295R cells

Chemosphere 147 (2016) 9e19

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Effects of bisphenol analogues on steroidogenic gene expression and hormone synthesis in H295R cells Yixing Feng, Zhihao Jiao, Jiachen Shi, Ming Li, Qiaozhen Guo, Bing Shao* Beijing Key Laboratory of Diagnostic and Traceability Technologies for Food Poisoning, Beijing Center for Disease Control and Prevention, Beijing 100013, China

h i g h l i g h t s
Assessment the endocrine interrupting action of four bisphenols analogues (BPF, BPA, BPS, BPAF) in H295R cells.
The rank order of cytotoxicity of four BPs was BPAF > BPA > BPS > BPF.
Four BPs exhibited endocrine-disrupting action in H295R cell.
Genes involved in steroidogenesis were altered by four BPs treatments.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 July 2015 Received in revised form 9 November 2015 Accepted 22 December 2015 Available online xxx

The use of Bisphenol A (BPA) has been regulated in many countries because of its potential adverse effects on human health. As a result of the restriction, structural anologues such as bisphenol S (BPS) and bisphenol F (BPF) have already been used for industrial applications as alternatives to BPA. Bisphenol AF (BPAF) is mainly used as a crosslinker in the synthesis of specialty fluoroelastomers. These compounds have been detected in various environmental matrices and human samples. Previous studies have shown that these compounds have potential endocrine disrupting effects on wildlife and mammals in general. However, the effects on adrenocortical function and the underlying mechanisms are not fully understood. In the present study, the H295R cell line was used as a model to compare the cell toxicity and to investigate the potential endocrine disrupting action of four BPs (including BPA, BPS, BPF, and BPAF). The half lethal concentration (LC50) values at 72 h exposure indicated that the rank order of toxicities of the chemicals was BPAF > BPA > BPS > BPF. The hormone results demonstrated that BPA analogues, such as BPF, BPS and BPAF were capable of altering steroidogenesis in H295R cells. BPA and BPS exhibited inhibition of hormone production, BPF predominantly led to increased progesterone and 17b-estradiol levels and BPAF showed induction of progesterone and reduction of testosterone. Inhibition effects of BPA and BPAF on hormone production were probably mediated by down-regulation of steroidogenic genes in H295R cells. However, the mechanisms of the endocrine interrupting action of BPF and BPS are still unclear, which may have additional mechanisms that have not been detected with BPA. © 2015 Elsevier Ltd. All rights reserved.

Handling Editor: A. Gies Keywords: Bisphenols analogues (BPF, BPA, BPS, BPAF) Steroidogenesis Steroidogenic gene H295R cell

1. Introduction Bisphenols (BPs) are a group of chemical compounds that consist of two phenolic rings joined together through a bridging carbon or other chemical structures (Chen et al., 2002). BPs are commonly used to produce polycarbonates and epoxy (Delfosse et al., 2012). Among these compounds, bisphenol A (BPA) is the

* Corresponding author. E-mail address: [email protected] (B. Shao). http://dx.doi.org/10.1016/j.chemosphere.2015.12.081 0045-6535/© 2015 Elsevier Ltd. All rights reserved.

most widely used and investigated chemical (Delfosse et al., 2012). A large number of studies has shown that BPA has adverse effects on human health, including interrupted steroid hormone synthesis (Zhang et al., 2011), disturbed mammary gland development (Moral et al., 2008), changes in obesity associated parameters (Miyawaki et al., 2007). BPA also is associated with heart disease, diabetes, abnormal liver function, etc (Vandenberg et al., 2012; Rochester, 2013; Rezg et al., 2014). Due to its ubiquitous nature and potential health hazard for human beings, restriction and legislation of BPA have been suggested worldwide (European Union, 2011; U.S. Food and Drug Administration, 2013). For

10

Y. Feng et al. / Chemosphere 147 (2016) 9e19

example, BPA was banned in baby bottles in Canada, France, and the European Union in 2008, 2010, and 2011, respectively. Therefore, finding a substitute for BPA is urgent for industrial applications. Structural anologues such as bisphenol S (BPS) and bisphenol F (BPF) have already been used as alternatives for BPA. BPS is used for a variety of industrial applications such as a wash fastening agent, an electroplating solvent, and thermal receipt papers (Clark, 2012). BPF can be used in the production of epoxy resins and polycarbonates, especially for lining of solid/high built systems (Fiege et al., 2000). BPAF is mainly used as a crosslinker in the synthesis of specialty fluoroelastomers (National Toxicology program, 2008). Due to the widespread consumer and commercial use of BPS, BPF, and BPAF, these chemicals have been detected in many dairy products such as food, personal care products, and paper products (Liao and Kannan, 2013, 2014; Liao et al., 2012c). BPS and BPF were also detected at the same order of magnitude as the concentration of BPA in environmental samples such as surface water, sediment, and sewage in China (Song et al., 2014; Yang et al., 2014a, b, c). In indoor dust, BPS, BPF, BPA, and BPAF have been detected at the following concentrations: BPS, 0.34 mg/g; BPF, 0.054 mg/g; BPA, 1.33 mg/g; BPAF, 0.00069 mg/g (Liao et al., 2012b). In 267 foodstuffs from the United States, the mean concentrations of BPS, BPF, BPA, and BPAF were 0.130, 0.929, 3.00, and 0.012 ng/g, respectively (Liao and Kannan, 2013). The Estimated Daily Dietary Intakes (EDI) of BPS, BPF, BPA, and BPAF for adults were 1.31, 7.46, 44.6, and 0.275 ng/kg bw/day, respectively (Liao and Kannan, 2013). In 100 urine samples from non-occupational Americans, BPS was detected in 78% of samples with 0.13 ng/mL median concentration, BPF was detected in 55% of samples with 0.08 ng/mL median concentration, and BPA was detected in 95% of samples with 0.72 ng/mL median concentration (Liao et al., 2012a). However, in urine samples from 94 Chinese individuals living near a BPAF manufacturing plant, Yang et al. (2014a,b,c) found relatively lower frequencies of occurrence of BPS, BPF and BPAF in 10.6%, 2.1%, and 6.4% of samples, respectively. It seems that these chemicals may become worldwide food contaminants and environmental pollutants in the future. Studies have shown that BPA is a known endocrine disruptor according to experiments both in vitro and in vivo (Wetherill et al., 2007; Vandenberg, 2014). Though toxic research on BPS and BPF in vivo is scare, limited data showed that these chemicals have endocrine disruptive activity and reproductive toxicity (Ji et al., 2013; Naderi et al., 2014; Higashihara et al., 2007). They also were shown to be estrogenic in rats as a result of studies that showed increases in uterine weights (Yamasaki et al., 2003, 2004; Stroheker et al., 2004). Similarly, the in vitro studies show evidence of hormonal and endocrine disruptive action of these chemicals in vivo (Rosenmai et al., 2014; Kitamura et al., 2005). As far as BPAF is concerned, the in vitro study indicated that BPAF has stronger binding affinity on estrogen receptors (ER) than BPA (Matsushima et al., 2010). Our previous study in adult male rats demonstrated that BPAF could cause reduction of testosterone by directly affecting testis function (Feng et al., 2012). BPAF also interrupted the steroid hormonal balance of zebra fish and had an impact on the development of offspring (Shi et al., 2015). Furthermore, a study with human breast cancer cells indicated that BPAF could induce endogenous transcription of estrogen responsive genes through both genomic and non-genomic pathways involving ERa and ERK1/ 2 activation (Li et al., 2014). Considering that BPS, BPF, and BPAF have been used as alternatives for BPA, it is important to understand whether or not these compounds possess similar or more potent endocrine interrupting activities than BPA. The H295R cell line is a human adrenal carcinoma cell that has intact steroidogenic pathways and can secrete all the steroid intermediates of steroidogenesis (Hilscherova et al., 2004; Gracia et al., 2007; Ulleras et al., 2008). This cell line has been used

widely as a cell model for evaluating the chemical disruption of the steroidogenesis pathway because of the ability to measure the alteration in gene transcription, enzyme activity and hormone production at the same time (Gracia et al., 2006; Breen et al., 2010; Rotroff et al., 2013). However, the responses of cell line to Adrenocorticotropic Hormone (ACTH), the secretions of steroid hormones, and the expression of enzymes involved in hormone synthesis can be changed with increased passage number and different culture conditions. As a result, the steroid hormone produced in culture can be different from that seen in vivo (Rainey et al., 2004). The objective of this study is to compare the cell toxicity of BPA, BPS, BPF, and BPAF (Fig.1) and evaluate their endocrine interruption action on steroidogenesis pathways. Viability of H295R cells exposed to 10e500 mM BPF, BPA, BPS and BPAF for 24 h, 48 h, and 72 h was assessed, the half lethal concentration (LC50) values at 72 h for the four compounds were determined. In addition, this study exposed H295R cells to BPA, BPF, BPS, and BPAF at different concentrations in the presence of 0.1 mM dbcAMP (a cAMP analogue) for 48 h. Production of five steroid hormones (progesterone, aldosterone, cortisol, testosterone, and 17b-estradiol) and transcription of ten genes encoding the steroidogenic enzymes (StAR, FDX-1, CYP11A1, HSD3B2, CYP21A2, CYP11B1, CYP11B2, CYP17A1, CYP19A1 and 17b-HSD) were investigated. 2. Materials and methods 2.1. Chemicals Bisphenol F (BPF, CAS No. B0819, purity: 99%), bisphenol A (BPA, CAS No. B0494, purity: 99%), Bisphenol S (BPS, CAS No. B0495, purity: 98%), and bisphenol AF (BPAF, CAS No. B0945, purity: 99%) were purchased from Tokyo Chemical Industry (TCI, Tokyo, Japan). 2.2. H295R cell culture and chemical exposure The human adrenocortical carcinoma cell line (H295R) was purchased from Cell Bank (China Academy of Medical Sciences, Institute of Basic Medical Center of Cell) and cultured in 75 cm2 petri dish with 20 mL of DMEM/F-12 (HyClone, SH30023.01B) supplemented with 1% insulinetransferrineselenium-G (ITES-G, Gibco, 41400-045), 1% penicillinestreptomycin (Gibco, 15140- 122), and 10% fetal bovine serum (Gibco, 16000-044) at 37  C containing 95% air and 5% CO2 atmosphere. The medium was refreshed two or three times a week and cells were detached from the culture dish for subculture. Due to the ability of the adrenal cell line to produce steroid hormone and respond to ACTH and can be changed over time in culture (Rainey et al., 2004), cells were used between passages 5 and 10 after thawing from liquid nitrogen. For determining the effects of BPAs on gene transcription and hormone production, cells were grown in 6-well plates with a density of 1.5  106 cell/well and 24-well plates with a density of 2.5  105 cell/well for 24 h before the experiments were performed, respectively. Afterwards, the cells were exposed to 0, 0.1, 1, 10, 30, 50, and 70 mM BPs (BPAF was absent of 70 mM group due to the affection of cell viability) in the presence of 0.1 mM dbcAMP (Sigma, D0627) for 48 h, which was added to mimic the ACTH upsurge (Sewer and Waterman, 2003). dbcAMP can activate the protein kinase-A pathway and has been demonstrated to induce secreted progesterone and cortisol levels and increase the expression of genes involved in sterodiogenesis in H295R cells (Li et al., 2013). Three replicates of each exposure were used in each experiment. Chemical solutions were made as stock solutions. BPs were dissolved in DMSO to increase their solubility and the working solutions were prepared freshly on the day of treatment. Control cells

Y. Feng et al. / Chemosphere 147 (2016) 9e19

HO

HO

H2 C

OH

11

HO

OH

Bisphenol F (BPF)

Bisphenol (BPA)

O

CF3

S

OH

O Bisphenol S (BPS)

HO

OH CF3 Bisphenol AF (BPAF)

Fig. 1. Structure of BPS. Structures of bisphenol A and related compounds tested in this study.

were treated with culture medium including DMSO and, in all cases, the final concentration of DMSO was 0.05%. Solvents at this concentration in working solutions were not cytotoxic  ski et al., 2007). At the end of the exposure, cells were (Kleszczyn prepared for mRNA detection and the culture medium was collected for quantification of hormones. 2.3. Cell viability Cell counting kit-8 (CCK-8) assay was used for cell viability and proliferation assessment. Water-soluble tetrazolium salt WST-8 was reduced by dehydrogenase in cells to generate a soluble yellow-color formazan dye, which was proportional to the number of living cells. H295R cells were seeded into 96-well microplates with a density of 3  104 cell/well and incubated overnight to adhere. Six replicate wells of each concentration of BPs were prepared. Cells were exposed to 0, 10, 30, 50, 70, 100, 200, 300, and 500 mM BPs with 0.1 mM dbcAMP for 24 h, 48 h, and 72 h. CCK-8 (Beyotime Institute of Biotechnology, Haimen, Jiangsu, China) was added to the medium and incubated for 3 h at 37  C, and then the absorbance was measured at 450 nm using a microplate reader (Bio-rad, California, USA). Results were presented as percentages of the control values obtained with untreated cells. 2.4. Hormone measurement The cell culture media from H295R cells in each treatment group were collected at the end of the cultures, and stored at 80  C until measurements of hormone levels were performed. Levels of five steroid hormones: progesterone, aldosterone, cortisol, testosterone and 17b-estradiol, were measured. Quantification of hormone levels were performed using commercially available radioimmunoassay kits from Beijing North Institute of Biological Technology. All kits were used according to the manufacturer's instructions with exception of the standards which were prepared in cell culture media rather than using the standards supplied. The sensitivities of the assays were 0.2 ng/mL, 0.02 ng/mL, 2 ng/mL, 0.02 ng/mL and 2 pg/mL for progesterone, aldosterone, cortisol, testosterone and 17b-estradiol, respectively. The standard curve ranges for the assays were 0.2e100 ng/mL, 0.0625e2 ng/mL, 10e500 ng/mL, 0.1e20 ng/ mL and 5e4000 pg/mL for progesterone, aldosterone, cortisol, testosterone and 17b-estradiol, respectively. The intra-assay and inter-assay coefficients of variation were less than 10% and 15%, respectively for all the kits. Samples and standard curves were performed at the same time in all of the plates. Standards, controls and samples were analyzed in duplicate and the average was calculated for each sample. Three independent experiments were performed.

2.5. Real-time RT-PCR Total RNA was isolated from the cell sample using the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The concentration of total RNA was measured at 260 nm using a Bio-Rad SmartSpec 3000 spectrophotometer (Biorad, California, USA). All RNA samples showed suitable A260/A280 and 28S/18S ratios. The first strand cDNA was synthesized from 1 mg of total RNA mixed with random 6 mers using PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). SYBR Green PCR Master Mix reagent kits (Applied Biosystems Inc., USA) were used to detect the expression levels of target genes according to the manufacturer's instructions for quantification of gene expression with 7300 real-time PCR system (Applied Biosystems Inc., USA). PCR primers (Table 1) were designed using Primer 5.0 software. The cycling conditions were as follows: 95  C for 10 s followed by 40 cycles of 95  C for 15 s, 55  C for 15 s, and 72  C for 35 s. After PCR, a melting curve analysis was performed to demonstrate the PCR product specificity, which was displayed as a single peak (data not shown). b-actin is a housekeeping gene and is usually used as endogenous control for quantification due to relatively stable mRNA expression level in toxicity research (Roelofs et al., 2015). bactin was detected at the same time with the target gene in all of the plates. Every sample was analyzed in triplicate. The relative expression ratio (R) of a target gene was expressed for the sample versus the control in comparison to the b-actin gene. R was calculated based on the following equation (Livak and Schmittgen, 2001): R ¼ 2DDCt, where Ct represents the cycle number at which the fluorescence signal was first significantly different from background and DDCt was the (Ct, targetdCt, actin) treatmentd(Ct, targetdCt, actin) control. 2.6. Statistical analysis All data analyses were performed with SPSS 13.0. Results were presented as mean ± SEM (n ¼ 3). Statistical analyses of hormone production and gene transcription profiles between control and exposed cells were evaluated by one-way analysis of variance (ANOVA) followed by post hoc LSD tests. A p value < 0.05 was considered statistically significant. 3. Results 3.1. Effect of BPs on cell viability The viability of H295R cells exposed to 10e500 mM BPF, BPA, BPS and BPAF for 24 h, 48 h, and 72 h was assessed by CCK-8 assay (Fig. 2). The results indicated that cytotoxicity was increased with prolonged exposure time and increased exposure

12

Y. Feng et al. / Chemosphere 147 (2016) 9e19

Table 1 Sequences of primers used for real-time RT-PCR amplification. Target gene

GenBank accession No

Primer sequences

Product length(bp)

Tm( C)

b- actin

NM_001164319

106

55.0

StAR

NM_000349.2

83

55.0

FDX-1

NM_004109.4

87

55.0

CYP11A1

NM_001099773

154

55.0

HSD3B2

NM_001166120.1

161

55.0

CYP21A1

NM_009995.2

403

55.0

CYP11B1

NM_000497.3

112

55.0

CYP11B2

NM_000498.3

203

55.0

CYP17A1

NM_000102.3

228

55.0

17bHSD

NM_000413.2

122

55.0

CYP19A1

NM_031226.2

FW: GCAGACCGACCTGAGCGA RW: CATCTGGCGAAAGGTGGG FW: GGGCATCCTTAGCAACC RW: CTGGGACCACTTTACTCATC FW: TGGCTTGTTCAACCTGTC RW: CGAGCATGTCATTCTCCT FW:GAAGTGTTCACCACGATTACC RW: GCCATCTCATACAAGTGCC FW: TGCCAGTCTTCATCTACACC RW: ATTAGCCGCCAGCACAGC FW: ACTTCCTACAGCCTAACCTT RW: GTGAGGCAGGAGATGATACT FW: CTTCCAGTACGGCGACAA RW: CGACAGTTCCGCATTCAA FW: GAGGGAGCAGGGTTATGA RW: CACGATGTTGTCTGTAGGC FW: ATTCCTCCCCAGACACGG RW: GAGTCAGCGAAGGCGATA FW: TGAGCCTGATCGAGTGCG RW: GGCGAGGTATTGGTAGAAGC FW: GGACCCCTCATCTCCCACG RW: CCCAAGTTTGCTGCCGAAT

195

55.0

Fig. 2. Cell viability. Cell viability in NCI-H295R cultures exposed to BPF (blank), BPA (red), BPS (blue) and BPAF (dark cyan) (10e500 mM) for 24 h, 48 h and 72 h. Results are means ± SEM of three replicate experiments (n ¼ 6 wells per exposure dose). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

concentration of BPs. BPAF had the greatest cytotoxicity with 16.1%, 3.9%, and 0% cell viability at 200 mM for 24 h, 48 h, and 72 h, respectively; followed by BPA with 60.2%, 22.2%, and 13.8% cell viability at 200 mM for 24 h, 48 h, and 72 h, respectively. BPS was less toxic than BPA, the percent cell viability was 62.6%, 32.6%, and 33.3% in the 200 mM BPS treatment group for 24 h, 48 h, and 72 h, respectively, while BPF did not show cytotoxicity even at 200 mM exposure for 24 h. To further compare the cell toxicity of these compounds, the half lethal concentration (LC50) values of 72 h for BPF, BPA, BPS, and BPAF exposure were determined by the cell viability percent. The 72 h LC50 values of BPF, BPA, BPS, and BPAF on H295R cells were 208.0, 103.4, 159.6, and 66.8 mM, respectively. The rank order of cytotoxicity of these chemicals was BPAF > BPA > BPS > BPF. To exclude cell-death related changes in mRNA expression and steroidogenesis, the following experiments were conducted at the concentrations of BPs that had no effect on cell viability. According to the cell viability results, dosages of 0.1, 1, 10, 30, 50 and 70 mM were selected as the test concentrations because no cytotoxicity was observed at these test concentrations for BPF, BPA, and BPS.

However, BPAF was excluded from the 70 mM group due to the presence of obvious cytotoxicity (cell viability was reduced by 29.9% when compared to the control group). 3.2. Effects of BPs on hormone production In this study, steroid hormone synthesis was affected by all tested compounds in the H295R cells (Fig. 3). Progesterone was significantly altered in some treated groups for all four compounds. Increasing levels of progesterone were observed in a dosedependent manner after exposure to 30, 50, and 70 mM BPF (elevated by 733%, 1122%, and 1273%, respectively). Similar to BPF, progesterone secretion was elevated by 10, 30, and 50 mM BPAF exposure (increased by 363%, 552%, and 369%, respectively). In contrast, dose-dependent decreases were observed in 30, 50, and 70 mM BPA treatments (reduced by 53.4%, 67.6%, and 83.1%, respectively). Additionally, 1 and 10 mM BPS resulted in significant elevation of progesterone (increased by 50.3% and 91.0%, respectively), whereas it was decreased with 50 and 70 mM BPAF treatments (reduced by 53.8% and 70.3%, respectively).

Fig. 3. Hormone levels. Hormone production in H295R cell exposed to four BPs for 48 h. Results are means ± SEM of three replicate samples. Compared with the control, *p < 0.05 and **p < 0.01.

14

Y. Feng et al. / Chemosphere 147 (2016) 9e19

In the BPF treatment group, aldosterone was not significantly altered at any of the tested concentrations. However, in 50 and 70 mM BPA groups, aldosterone was dramatically reduced by 46.7% and 62.9% of the control group, respectively. A dose-dependent decrease in aldosterone production was observed with BPS (reduced by 20.5%, 20.9%, 50.3%, 62.7%, 74.5%, and 75.2% of the control at 0.1, 1, 10, 30, 50, and 70 mM BPS, respectively). Similar to BPS, aldosterone production in the BPAF exposure group was also inhibited in a dose-dependent manner (reduced by 25.8%, 32.2%, 61.1%, and 71.5% of the control at 1, 10, 30, and 50 mM, respectively). Cortisol was affected by all four compounds. The level of cortisol was reduced significantly in a doseeresponse manner after exposure to 10, 50, and 70 mM BPF, or to 30, 50, 70 mM BPA and BPS, and to 10, 30, 50 mM BPAF (concentration of cortisol was reduced by 30.5%, 33.0%, 41.5%, respectively for BPF; 32.3%, 53.6%, and 68.0%, respectively for BPA; 55.9%, 71.7%, and 79.0%, respectively for BPS; 29.0%, 65.8%, and 76.7%, respectively for BPAF). BPA and BPS caused a concentration-dependent decrease in testosterone production at 1e70 mM BPA exposure (decreased by 31.1%, 42.0%, 69.6%, 87.7%, and 92.8%, respectively) and 10e70 mM BPS treatment (reduced by 34.0%, 69.1%, 82.4%, and 86.8%, respectively). Likewise, BPAF exposure also reduced the testosterone level at the dosage of 1e50 mM (inhibited by 33%, 27.2%, 36.2%, and 55.1%). However, no significant differences were observed in any tested group of BPF. 17b-estradiol increased dramatically by 51.0%, 61.6%, and 61.3% compared to the control group after exposure to 30, 50, and 70 mM BPF, respectively. However, all the other compounds did not exhibit any significant effect. 3.3. Effects of BPs on steroidogenic gene transcription According to the hormone results, BPs exposure interferes with the production of hormone in different models. To further evaluate the related mechanisms, transcription levels of corresponding genes encoding steroidogenic enzymes (StAR, FDX-1, CYP11A1, HSD3B2, CYP21A2, CYP11B1, CYP11B2, CYP17A1, CYP19A1 and 17bHSD) were studied (Fig. 4). Progesterone is an important precursor of hormones such as aldosterone, cortisol, testosterone, and 17b-estradiol in the adrenal glands. It is generated from cholesterol via sequential reactions catalyzed by StAR, FDX-1, CYP11A1, and HSD3B2. As shown in Fig. 4, gene transcription levels of StAR and CYP11A1 were decreased dramatically at dosages of 10, 30, 50, and 70 mM BPA treatment, whereas no significant differences were noted in the other three compounds at any concentrations. Additionally, BPF at concentrations up to 50 mM caused a statistically significant inhibition of HSD3B2 gene expression. Similar to BPF, BPA at concentrations up to 10 mM and BPAF at concentrations up to 30 mM reduced the gene expression of HSD3B2 strongly. However, BPS did not disrupt this gene expression at any tested concentration. Aldosterone is generated from progesterone via sequential reactions catalyzed by CYP21A2, CYP11B1 and CYP11B2. Cortisol is derived from 17a-OH-progesterone by CYP21A2 and CYP11B1. CYP21A2 was down-regulated after 1, 50 and 70 mM BPF exposures, while no significant differences were noted in the other three compound treatment groups. CYP11B1 was up-regulated at relatively low concentrations of BPA and BPS (0.1 mM BPA; 1 and 10 mM BPS). However, it was down-regulated at relatively higher concentrations of BPF, BPS and BPAF (30 and 50 mM BPF; 10, 30, 50 and 70 mM BPS; 30 and 50 mM BPAF). Meanwhile, CYP11B2 was downregulated in a dose-dependent manner after exposure to BPF, BPA and BPAF at concentrations as low as 1 mM BPF, 0.1 mM BPA, and 10e50 mM BPAF; while no significant differences were noted in BPS exposed groups.

Gene transcription involved in testosterone and 17b-estradiol biosynthesis was also measured. Testosterone and 17b-estradiol are generated from progesterone via sequential reactions catalyzed by CYP17A1, 17b-HSD, and CYP19A1. All four compounds downregulated the gene expression of CYP17A1 in a dose-dependent manner starting at concentrations as low as 1 mM for BPA and BPAF and at concentrations from 10 mM BPA to 30 mM for BPS. However, gene expression of 17b-HSD and CYP19A1 was not interrupted with the four compounds across the entire range of concentration (data not show). 4. Discussion BPS, BPF, and BPAF have been widely used as the alternatives for BPA. Environmental monitoring data show that these chemicals might become worldwide food contaminants and environmental pollutants in the future. BPA-like effects from these alternatives can be hypothesized because of their similar chemical structures. In the present study, 72 h LC50 values of BPF, BPA, BPS, and BPAF for H295R cell were calculated and the results indicated that the rank order of cytotoxicity of these chemicals was BPAF > BPA > BPS > BPF. However, the rank order of hormonal activity of these chemicals was not clear. It is important to understand whether or not these compounds possess similar or more potent endocrine interrupting activities compared to BPA. Thus, the effects of bisphenols (BPs) in the presence of dbcAMP, including BPF, BPA, BPS and BPAF, on steroidogenesis were studied using the H295R screening assay. For this purpose, 5 steroid hormone levels and 10 steroid related genes were measured. An overview of how BPs modulated the steroidogenic pathway is presented in Fig. 5. Progesterone level was elevated with BPF and BPAF exposure, however, BPA caused a concentration-dependent decrease in progesterone production. Interestingly, BPS showed a non-monotonic profile of the doseeresponse curve for progesterone level. BPF showed the most potent effects on progesterone levels, followed by BPAF. Similar to our findings, 10 mM BPS and BPF predominantly increased progesterone secretion in MA-10 cell (Roelofs et al., 2015). In H295R cells, progesterone levels were also increased with BPS and BPF exposure though no change was observed after BPA exposure (Rosenmai et al., 2014). Testosterone levels were decreased with BPA, BPS and BPAF treatments; thus, they all showed anti-androgenic effects. However, BPF did not cause any effect on testosterone production. BPA had a more potent inhibitory effect than BPS. Indeed,1 mM BPA significantly reduced testosterone secretion, whereas no change was observed with 1 mM BPS. It was reported that BPA, BPS and BPF all showed inhibition of the testosterone secretion in mouse and human fetal testis and BPS had an even more potent inhibitory effect than BPA when using the mouse fetal testis model (Eladak et al., 2015). Furthermore, anti-androgenic effects were also observed for the BPA, BPS and BPF on androgen receptor (AR) activity and androgen synthesis with less anti-androgenic potential for BPS compared with BPA and BPF (Rosenmai et al., 2014). In contrast, BPS did not have an antagonistic effect on AR in the yeast AR bisassay (Roelofs et al., 2015). In vivo, decreases in serum testosterone levels were also observed in SD rats with 200 mg/kg/d BPAF treatment (Feng et al., 2012). The production of cortisol was inhibited by all four test compounds and aldosterone secretion was inhibited by BPA, BPS and BPAF. However, it was noted that in the present study BPF is the only compound that did not lead to an effect on aldosterone production and also the only compound that significantly induced 17bestradiol levels. BPF seems to elicit the highest endocrine modulating potential with strong induction of progesterone and 17bestradiol secretion and might have different actions on the modulation of steroid hormone synthesis in H295R cell.

Fig. 4. Gene expression. Expression changes of steroidogenic gene in H295R cells exposed to four BPs for 48 h. Results are means ± SEM of three replicate samples. Compared with the control, *p < 0.05 and **p < 0.01.

16

Y. Feng et al. / Chemosphere 147 (2016) 9e19

Y. Feng et al. / Chemosphere 147 (2016) 9e19

In this study, steroid hormone synthesis and steroid related genes were affected by all tested compounds in the H295R cells. With respect to hormone synthesis, BPA and BPS mainly showed inhibition of hormone production; BPF predominantly led to increased progesterone and 17b-estradiol levels; and BPAF exhibited induction of progesterone and reduction of testosterone. Differential effects on steroidogenesis were observed suggesting compound specific mechanisms. To discover the possible mechanisms of the effects of BPs upon hormone production, the transcription levels of synthesis-related genes were measured. StAR is an important rate-limiting regulatory factor in steroidogenesis and plays an important role in transferring cholesterol from the outer mitochondrial to the inner mitochondrial membrane (Sasano and Parker, 2000). Cholesterol is subsequently catalyzed by CYP11A1 and HSD3B2 to produce progesterone, which is the precursor to other steroid hormones in the adrenal glands. Furthermore, progesterone is catalyzed sequentially by CYP21, CYP11B1, and CYP11B2 to form aldosterone; and cortisol is converted from 17a-OH-progesterone by CYP21 and CYP11B1 (Gazdar et al., 1990). The final rate-limiting step of the synthesis of cortisol and aldosterone is regulated by CYP11B1 and CYP11B2, respectively (Wang et al., 2015). CYP17A1 has 17a-hydroxylase and 17, 20-lyase activity and is responsible for the production of dehydroepiandrosterone and androstenedione. Androstenedione, as the precursor of testosterone, is catalyzed by17b-HSD enzyme, which controls estrogen and androgen concentrations. Finally, CYP19A1 catalyzes the final and rate-limiting step in conversion of testosterone to 17b-estradiol (Li et al., 2013). BPA treatment inhibited almost all hormone production, although 17b-estradiol was not affected, which was in accordance with the finding that it decreased mRNA expression of most genes related to the steroidogenesis. BPA might inhibit the synthesis of progesterone by down-regulation of the expression of StAR, FDX-1, CYP11A1 and HSD3B2, which control the production of progesterone. Likewise, we hypothesized that reduction of transcription of CYP11B1 and CYP11B2 would probably affect the synthesis of sex hormones and then decrease the production of cortisol and aldosterone. On the other hand, the depressed expression of CYP17A1 might lead to the reduced synthesis of testosterone due to decreased androstenedione levels, which is the precursor of testosterone. The results of in vitro studies on the effects of BPA upon steroidogenesis are also equivocal. In accordance with our findings, BPA exposure inhibited testosterone and progesterone production and decreased StAR and CYP11A1 expression in cultured intact murine antral follicles (Peretz et al., 2012; Ziv-Gal et al., 2013). However, 0.1e100 mM BPA treatment had opposite effects on testosterone levels and CYP17a, StAR and CYP11A1 expression in isolated rat theca-interstitial cells (Zhou et al., 2008). In isolated Leydig cells, low-dose BPA decreased testosterone production and expression of steroidogenesis enzymes (Nanjappa et al., 2012). Conversely, Thuillier et al. (2009) reported that gestational exposure to low- and high-dose BPA increased Leydig cell numbers without altering testosterone levels in adult male rats. In summary, these data suggest that effects of BPA exposure on sex steroid hormone levels might be related to exposure time, route and concentration, as well as other confounders. For BPF, the most pronounced effects were the sharply increased progesterone and 17b-estradiol levels. It is well known that progesterone is catalyzed by StAR, FDX-1, CYP11A1 and HSD3B2 from colesterol, and 17b-estradiol is generated from testosterone by the CYP19A1 enzyme in H295R cells. The finding that there were

17

decreased mRNA expression levels of HSD3B2 and unchanged mRNA expression levels of StAR, CYP11A1 and CYP19A1 by BPF exposure does not explain the sharply elevated progesterone and 17b-estradiol levels. Increased 17a-OH progesterone and progesterone levels were also observed in a study by Rosenmai et al. (2014). While the mechanism of action of progesterone elevation was not clear, previous work indicated a direct inhibition of the CYP17 lyase activity (Zhang et al., 2011). In the present study, it is difficult to explain how decreased mRNA expression of CYP17A1 was associated with increased production of progesterone upon BPF and BPAF exposure. Similar to BPF, the gene expression levels associated with BPS also exhibited a different concentration-dependent response compared with hormone levels. Assuming that protein is the direct participant in regulation of a physiological reaction in vivo or in vitro and that unchanged transcription levels of genes will be accompanied by increased or decreased protein levels, then there are other factors to be discovered regarding the effects of BPs on hormone production. Additional studies are needed to understand the potential mechanisms related to the endocrine disruption activity of BPs, especially for the detection of protein content and variables that are involved in the process of steroidogenesis in H295R cells. To the best of our knowledge, the effects of BPAF on steroidogenesis and gene expression have not been shown before in H295R cells. BPAF lowered aldosterone, cortisol and testosterone levels and elevated progesterone levels significantly. CYP11B1 and CYP11B2 are the final rate-limiting steps of the synthesis of cortisol and aldosterone, respectively (Wang et al., 2015). Inhibition of CYP11B1 and CYP11B2 may, therefore, lead to a decrease in the synthesis of aldosterone and cortisol during BPAF treatment. CYP17A1 is a dual-functional enzyme and is essential for the production of androstenedione, which is the precursor of testosterone. Inhibition of testosterone levels may be connected to the downregulated CYP17A1 transcriptional levels because of the reduced androstenedione levels. The endocrine disrupting activity of BPAF was also observed with in vivo studies. BPAF exposure can disrupt hormonal balances in zebrafish (Shi et al., 2015; Yang et al., 2014a, b, c) and reduce the testosterone levels in the serum of male rats (Feng et al., 2012). Finally, we should point out that this assay predicted the response of each compound on steroidogenesis with the stimulation of dbcAMP, but the responses without dbcAMP were not examined. Indeed, the effects might be different for H295R cells in the absence of dbcAMP. Further studies on the dose-responses following exposure without the stimulation of dbcAMP are required in order to properly assess the risk of BPs. In conclusion, we have shown that the rank order of cytotoxicities of the four chemicals studied were BPAF > BPA > BPS > BPF. Hormone level results demonstrated that BPA analogues, such as BPF, BPS and BPAF are capable of altering steroidogenesis in H295R cells at non-cytotoxic concentrations. BPA and BPS exhibited inhibition of hormone production; BPF predominantly led to increased progesterone and 17b-estradiol levels; and BPAF showed induction of progesterone and reduction of testosterone. Inhibitory effects of BPA and BPAF on hormone production were probably mediated by down-regulation of steroidogenic genes in H295R cells. BPF and BPS may have additional mechanisms that are different than those of BPA and are not yet understood, Further in vivo and in vitro studies are needed to elucidate the mechanisms of the endocrine disruption activity and assess the potential health risks of BPs.

Fig. 5. Steroidogenic pathway. Steroidogenic pathway in H295R cells exposed for 48 h to BPs. Brackets indicate not measured hormones and genes. Arrows indicate decreased or increased hormone or gene expression levels after exposure to (A) BPF; (B) BPA; (C) BPS; (D) BPAF from three independent experiments.

18

Y. Feng et al. / Chemosphere 147 (2016) 9e19

Acknowledgments This work was supported by National Natural Science Foundation of China (grant number 21207008 and 41273132) and Projects in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (2012BAK17B01). References Breen, M.S., Breen, M., Terasaki, N., Yamazaki, M., Conolly, R.B., 2010. Computational model of steroidogenesis in human H295R cells to predict biochemical response to endocrine-active chemicals: model development for metyrapone. Environ. Health. Perspect. 118, 265e272. Chen, M.Y., Ike, M., Fujita, M., 2002. Acute toxicity, mutagenicity, and estrogenicity of bisphenol-A and other bisphenols. Environ. Toxicol. 17, 80e86. Clark, E., 2012. Sulfolane and sulfones. In: Kirk-othmer Encyclopedia of Chemical Technology. John Wiley & Sons, New York, NY. Delfosse, V., Grimaldi, M., Pons, J., Boulahtouf, A., le Maire, A., Cavailles, V., Labesse, G., Bourguet, W., Balaguer, P., 2012. Structural and mechanistic insights into bisphenols action provide guidelines for risk assessment and discovery of bisphenol A substitutes. Proc. Natl. Acad. Sci. U. S. A. 109, 14930e14935. Eladak, S., Grisin, T., Moison, D., Guerquin, M.J., N'Tumba-Byn, T., Pozzi-Gaudin, S., Benachi, A., Livera, G., Rouiller-Fabre, V., Habert, R., 2015. A new chapter in the bisphenol A story: bisphenol S and bisphenol F are not safe alternatives to this compound. Fertil. Steril. 103, 11e21. European Union, 2011. Amending Directive 2002/72/EC as Regards the Restriction of Use of Bisphenol a in Plastic Infant Feeding Bottles, Commission Directive 2011/8/EU of 28 January 2011. Feng, Y., Yin, J., Jiao, Z., Shi, J., Li, M., Shao, B., 2012. Bisphenol AF may cause testosterone reduction by directly affecting testis function in adult male rats. Toxicol. Lett. 211, 201e209. Fiege, H., Voges, H.-W., Hamamoto, T., Umemura, S., Iwata, T., Miki, H., et al., 2000. Phenol derivatives. In: Ullmann's Encyclopedia of Industrial Chemistry. WileyVCH Verlag GmbH & Co. KGaA, Winheim. Gazdar, A.F., Oie, H.K., Shackleton, C.H., Chen, T.R., Triche, T.J., Myers, C.E., Chrousos, G.P., Brennan, M.F., Stein, C.A., La Rocca, R.V., 1990. Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50, 5488e5496. Gracia, T., Hilscherova, K., Jones, P.D., Newsted, J.L., Higley, E.B., Zhang, X., Hecker, M., Murphy, M.B., Yu, R.M., Lam, P.K., Wu, R.S., Giesy, J.P., 2007. Modulation of steroidogenic gene expression and hormone production of H295R cells by pharmaceuticals and other environmentally active compounds. Toxicol. Appl. Pharmacol. 225, 142e153. Gracia, T., Hilscherova, K., Jones, P.D., Newsted, J.L., Zhang, X., Hecker, M., Higley, E.B., Sanderson, J.T., Yu, R.M., Wu, R.S., Giesy, J.P., 2006. The H295R system for evaluation of endocrine-disrupting effects. Ecotoxicol. Environ. Saf. 65, 293e305. Higashihara, N., Shiraishi, K., Miyata, K., Oshima, Y., Minobe, Y., Yamasaki, K., 2007. Subacute oral toxicity study of bisphenol F based on the draft protocol for the 00 Enhanced OECD test guideline no. 407. Arch. Toxicol. 81, 825e832. Hilscherova, K., Jones, P.D., Gracia, T., Newsted, J.L., Zhang, X., Sanderson, J.T., Yu, R.M., Wu, R.S., Giesy, J.P., 2004. Assessment of the effects of chemicals on the expression of ten steroidogenicgenes in the H295R cell line using real-time PCR. Toxicol. Sci. 81, 78e89. Ji, K., Hong, S., Kho, Y., Choi, K., 2013. Effects of bisphenol s exposure on endocrine functions and reproduction of zebrafish. Environ. Sci. Technol. 47, 8793e8800. Kitamura, S., Suzuki, T., Sanoh, S., Kohta, R., Jinno, N., Sugihara, K., Yoshihara, S., Fujimoto, N., Watanabe, H., Ohta, S., 2005. Comparative study of the endocrinedisrupting activity of bisphenol A and 19 related compounds. Toxicol. Sci. 84, 249e259.  ski, Kleszczyn K., Gardzielewski, P., Mulkiewicz, E., Stepnowski, P., Składanowski, A.C., 2007. Analysis of structureecytotoxicity in vitro relationship (SAR) for perfluorinated carboxylic acids. Toxicol. Vitro 21, 1206e1211. Li, M., Guo, J., Gao, W., Yu, J., Han, X., Zhang, J., Shao, B., 2014. Bisphenol AF-induced endogenous transcription is mediated by ERalpha and ERK1/2 activation in human breast cancer cells. PLoS One 9, e94725. Li, Z., Yin, N., Liu, Q., Wang, C., Wang, T., Wang, Y., Qu, G., Liu, J., Cai, Y., Zhou, Q., Jiang, G., 2013. Effects of polycyclic musks HHCB and AHTN on steroidogenesis in H295R cells. Chemosphere 90, 1227e1235. Liao, C., Kannan, K., 2014. A survey of alkylphenols, bisphenols, and triclosan in personal care products from china and the United States. Arch. Environ. Contam. Toxicol. 67, 50e59. Liao, C., Kannan, K., 2013. Concentrations and profiles of bisphenol A and other bisphenol analogues in foodstuffs from the United States and their implications for human exposure. J. Agric. Food. Chem. 61, 4655e4662. Liao, C., Liu, F., Alomirah, H., Loi, V.D., Mohd, M.A., Moon, H.B., Nakata, H., Kannan, K., 2012a. Bisphenol S in urine from the United States and seven Asian countries: occurrence and human exposures. Environ. Sci. Technol. 46, 6860e6866. Liao, C., Liu, F., Guo, Y., Moon, H.B., Nakata, H., Wu, Q., Kannan, K., 2012b. Occurrence of eight bisphenol analogues in indoor dust from the United States and several Asian countries: implications for human exposure. Environ. Sci. Technol. 46,

9138e9145. Liao, C., Liu, F., Kannan, K., 2012c. Bisphenol s, a new bisphenol analogue, in paper products and currency bills and its association with bisphenol a residues. Environ. Sci. Technol. 46, 6515e6522. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402e408. Matsushima, A., Liu, X., Okada, H., Shimohigashi, M., Shimohigashi, Y., 2010. Bisphenol AF is a full agonist for the estrogen receptor ERalpha but a highly specific antagonist for ERbeta. Environ. Health Perspect. 118, 1267e1272. Miyawaki, J., Sakayama, K., Kato, H., Yamamoto, H., Masuno, H., 2007. Perinatal and postnatal exposure to bisphenol A increases adipose tissue mass and serum cholesterol level in mice. J. Atheroscler. Thromb. 14, 245e252. Moral, R., Wang, R., Russo, I.H., Lamartiniere, C.A., Pereira, J., Russo, J., 2008. Effect of prenatal exposure to the endocrine disruptor bisphenol A on mammary gland morphology and gene expression signature. J. Endocrinol. 196, 101e112. Naderi, M., Wong, M.Y., Gholami, F., 2014. Developmental exposure of zebrafish (Danio rerio) to bisphenol-S impairs subsequent reproduction potential and hormonal balance in adults. Aquat. Toxicol. 148, 195e203. Nanjappa, M.K., Simon, L., Akingbemi, B.T., 2012. The industrial chemical bisphenol A (BPA) interferes with proliferative activity and development of steroidogenic capacity in rat Leydig cells. Biol. Reprod. 86 (135), 1e12. National Toxicology Program, 2008. Chemical Information Profile for Bisphenol AF [CAS No. 1478-61-1]: Supporting Nomination for Toxicological Evaluation by the National Toxicology Program. http://ntp.niehs.nih.gov/ntp/htdocs/Chem_Ba ckground/ExSumPdf/BisphenolAF_093008_508.pdf. Peretz, J., Craig, Z.R., Flaws, J.A., 2012. Bisphenol A inhibits follicle growth and induces atresia in cultured mouse antral follicles independently of the genomic estrogenic pathway. Biol. Reprod. 87, 63e63. Rainey, W.E., Saner, K., Schimmer, B.P., 2004. Adrenocortical cell lines. Mol. Cell. Endocrinol. 228, 23e38. Rezg, R., El-Fazaa, S., Gharbi, N., Mornagui, B., 2014. Bisphenol A and human chronic diseases: current evidences, possible mechanisms, and future perspectives. Environ. Int. 64, 83e90. Rochester, J.R., 2013. Bisphenol A and human health: a review of the literature. Reprod. Toxicol. 42, 132e155. Roelofs, M.J., van den Berg, M., Bovee, T.F., Piersma, A.H., van Duursen, M.B., 2015. Structural bisphenol analogues differentially target steroidogenesis in murine MA-10 Leydig cells as well as the glucocorticoid receptor. Toxicology 329, 10e20. Rosenmai, A.K., Dybdahl, M., Pedersen, M., Alice van Vugt-Lussenburg, B.M., Wedebye, E.B., Taxvig, C., Vinggaard, A.M., 2014. Are structural analogues to bisphenol a safe alternatives? Toxicol. Sci. 139, 35e47. Rotroff, D.M., Dix, D.J., Houck, K.A., Knudsen, T.B., Martin, M.T., McLaurin, K.W., Reif, D.M., Crofton, K.M., Singh, A.V., Xia, M., Huang, R., Judson, R.S., 2013. Using in vitro high throughput screening assays to identify potential endocrinedisrupting chemicals. Environ. Health. Perspect. 121, 7e14. Sasano, H., Parker, K.L., 2000. Developmental roles of the steroidogenic acute regulatory protein (StAR) as revealed by StAR knockout mice. Mol. Endocrinol. 14, 1462e1471. Sewer, M.B., Waterman, M.R., 2003. ACTH modulation of transcription factors responsible for steroid hydroxylase gene expression in the adrenal cortex. Microsc. Res. Tech. 61, 300e307. Shi, J., Jiao, Z., Zheng, S., Li, M., Zhang, J., Feng, Y., Yin, J., Shao, B., 2015. Long-term effects of bisphenol AF (BPAF) on hormonal balance and genes of hypothalamus-pituitary-gonad axis and liver of zebrafish (Danio rerio), and the impact on offspring. Chemosphere 128, 252e257. Song, S., Song, M., Zeng, L., Wang, T., Liu, R., Ruan, T., Jiang, G., 2014. Occurrence and profiles of bisphenol analogues in municipal sewage sludge in China. Environ. Pollut. 186, 14e19. Stroheker, T., Picard, K., Lhuguenot, J.C., Canivenc-Lavier, M.C., Chagnon, M.C., 2004. Steroid activities comparison of natural and food wrap compounds in human breast cancer cell lines. Food Chem. Toxicol. 42, 887e897. Thuillier, R., Manku, G., Wang, Y., Culty, M., 2009. Changes in MAPK pathway in neonatal and adult testis following fetal estrogen exposure and effects on rat testicular cells. Microsc. Res. Tech. 72, 773e786. U.S. Food and Drug Administration, 2013. Amended the Regulation 21 CFR175 as Regards No Longer Use Bisphenol a in the Coating of Packaging for Powdered and Liquid Infant Formula. Ulleras, E., Ohlsson, A., Oskarsson, A., 2008. Secretion of cortisol and aldosteroneas a vulnerable target for adrenal endocrine disruption e screening of 30selected chemicals in the human H295R cell model. J. Appl. Toxicol. 28, 1045e1053. Vandenberg, L.N., 2014. Non-monotonic dose responses in studies of endocrine disrupting chemicals: bisphenol a as a case study. Dose Response 12, 259e276. Vandenberg, L.N., Colborn, T., Hayes, T.B., Heindel, J.J., Jacobs Jr., D.R., Lee, D.H., Shioda, T., Soto, A.M., vom Saal, F.S., Welshons, W.V., Zoeller, R.T., Myers, J.P., 2012. Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr. Rev. 33, 378e455. Wang, C., Ruan, T., Liu, J., He, B., Zhou, Q., Jiang, G., 2015. Perfluorooctyl iodide stimulates steroidogenesis in H295R cells via a cyclic adenosine monophosphate signaling pathway. Chem. Res. Toxicol. 28, 848e854. Wetherill, Y.B., Akingbemi, B.T., Kanno, J., McLachlan, J.A., Nadal, A., Sonnenschein, C., Watson, C.S., Zoeller, R.T., Belcher, S.M., 2007. In vitro molecular mechanisms of bisphenol A action. Reprod. Toxicol. 24, 178e198. Yamasaki, K., Noda, S., Imatanaka, N., Yakabe, Y., 2004. Comparative study of the

Y. Feng et al. / Chemosphere 147 (2016) 9e19 uterotrophic potency of 14 chemicals in a uterotrophic assay and their receptorbinding affinity. Toxicol. Lett. 146, 111e120. Yamasaki, K., Takeyoshi, M., Sawaki, M., Imatanaka, N., Shinoda, K., Takatsuki, M., 2003. Immature rat uterotrophic assay of 18 chemicals and Hershberger assay of 30 chemicals. Toxicology 183, 93e115. Yang, X., Liu, Y., Li, J., Chen, M., Peng, D., Liang, Y., Song, M., Zhang, J., Jiang, G., 2014a. Exposure to bisphenol AF disrupts sex hormone levels and vitellogenin expression in zebrafish. Environ. Toxicol. http://dx.doi.org/10.1002/tox.22043. Yang, Y., Guan, J., Yin, J., Shao, B., Li, H., 2014b. Urinary levels of bisphenol analogues in residents living near a manufacturing plant in south China. Chemosphere 112, 481e486. Yang, Y., Lu, L., Zhang, J., Yang, Y., Wu, Y., Shao, B., 2014c. Simultaneous

19

determination of seven bisphenols in environmental water and solid samples by liquid chromatography-electrospray tandem mass spectrometry. J. Chromatogr. A 1328, 26e34. Zhang, X., Chang, H., Wiseman, S., He, Y., Higley, E., Jones, P., Wong, C.K., AlKhedhairy, A., Giesy, J.P., Hecker, M., 2011. Bisphenol A disrupts steroidogenesis in human H295R cells. Toxicol. Sci. 121, 320e327. Zhou, W., Liu, J., Liao, L., Han, S., Liu, J., 2008. Effect of bisphenol A on steroid hormone production in rat ovarian theca-interstitial and granulosa cells. Mol. Cell. Endocrinol. 283, 12e18. Ziv-Gal, A., Craig, Z.R., Wang, W., Flaws, J.A., 2013. Bisphenol A inhibits cultured mouse ovarian follicle growth partially via the aryl hydrocarbon receptor signaling pathway. Reprod. Toxicol. 42, 58e67.