Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells

Marine Pollution Bulletin xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Marine Pollution Bulletin journal homepage: www.elsevier.com/locate/marpolbul

Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells Suraia Nusrin a, Steve K.H. Tong a, G. Chaturvedi a, Rudolf S.S. Wu b,d, John P. Giesy c,d, Richard Y.C. Kong a,d,⇑ a

Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region School of Biological Sciences, University of Hong Kong, Pokfulam, Hong Kong Special Administrative Region Department of Veterinary Biomedical Sciences and Toxicology Centre, University of Saskatchewan, Canada d State Key Laboratory in Marine Pollution, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region b c

a r t i c l e

i n f o

Keywords: Hypoxia-inducible factor miR-10b CYP11B1 CYP11B2 Aldosterone Cortisol

a b s t r a c t Although numerous studies have shown that hypoxia affects cortisol and aldosterone production in vivo, the underlying molecular mechanisms regulating the steroidogenic genes of these steroid hormones are still poorly known. MicroRNAs are post-transcriptional regulators that control diverse biological processes and this study describes the identification and validation of the hypoxia-inducible microRNA, miR-10b, as a negative regulator of the CYP11B1 and CYP11B2 steroidogenic genes in H295R human adrenocortical cells. Using the human TaqMan Low Density miRNA Arrays, we determined the miRNA expression patterns in H295R cells under normoxic and hypoxic conditions, and in cells overexpressing the human HIF-1a. Computer analysis using three in silico algorithms predicted that the hypoxia-inducible miR-10b molecule targets CYP11B1 and CYP11B2 mRNAs. Gene transfection studies of luciferase constructs containing the 30 -untranslated region of CYP11B1 or CYP11B2, combined with miRNA overexpression and knockdown experiments provide compelling evidence that CYP11B1 and CYP11B2 mRNAs are likely targets of miR-10b. Ó 2014 Published by Elsevier Ltd.

1. Introduction Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that controls the expression of a number of hypoxia-responsive genes to help cells adapt and survive under hypoxic stress (Semenza, 1998; Lisy and Peet, 2008). HIF-1 is a heterodimeric protein that consists of HIF-1a and HIF-1b subunits (Ke and Costa, 2006). Activation of HIF-1 under hypoxia is mediated through stabilization of the HIF-1a subunit at the post-translational level (Semenza, 1998), which is rapidly degraded under normoxia, via the ubiquitin–proteosome pathway (Lisy and Peet, 2008). Steroid hormones such as glucocorticoids are regulators of many physiological responses to stress, and are produced from cholesterol through a steroidogenic pathway that occurs in the mitochondrion of endocrine tissues. For example, adrenal cells from rats exposed to hypoxia showed a 3–4-fold reduction in ⇑ Corresponding author at: Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region. Tel.: +852 3442 7794; fax: +852 3442 0522. E-mail address: [email protected] (R.Y.C. Kong).

CYP11B2 (aldosterone synthase) mRNA without a change in other mitochondrial cytochrome P-450 enzymes (Raff et al., 1996). In vitro studies in bovine adrenocortical cells have found that hypoxia directly inhibits aldosterone synthesis (Raff et al., 1989) in the presence of known stimulators of aldosterone production such as ACTH, cAMP, potassium and Angiotensin II possibly through the inhibition of CYP11B2 (Raff et al., 1989; Raff and Kohandarvish, 1990; Brickner et al., 1992). Although numerous studies have reported that hypoxia affects steroidogenesis in the adrenal gland (Raff and Kohandarvish, 1990; Brickner et al., 1992; Raff et al., 1996; Bruder et al., 2002), the underlying molecular mechanisms remain poorly characterized. miRNAs are non-coding regulatory RNAs, 20–25 nucleotides in length, which are implicated in the regulation of numerous biological processes such as cell proliferation, differentiation, and metabolism (Karp and Ambros, 2005; Bartel, 2009). miRNAs regulate gene expression either directly through translational repression or by stimulating degradation of their target mRNAs (Bartel, 2009). It is estimated that 20–30% of all human genes are targeted by miRNAs (Krek et al., 2005). Although miRNAs are implicated in a diverse array of cellular processes during vertebrate development

http://dx.doi.org/10.1016/j.marpolbul.2014.04.002 0025-326X/Ó 2014 Published by Elsevier Ltd.

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

2

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

(Guo et al., 2009; Finnerty et al., 2010) and several studies have demonstrated that miRNAs are implicated in the physiological functions of various endocrine tissues (Baley and Li, 2012), the role of miRNAs in adrenal cell physiology remain largely unknown. Recent studies indicate that HIF-1 directly activates a number of hypoxia-responsive microRNAs (HRMs) such as miR-210 and miR-373 which are involved in the regulation of a variety of celland tissue-specific responses to hypoxia (Kulshreshtha et al., 2008; Crosby et al., 2009). Because HRMs are implicated in diverse physiological processes, we speculated that the effects of hypoxia on adrenal steroidogenesis may be mediated by certain HIF1regulated miRNAs. Here, we describe the identification and characterization of the hypoxia-responsive miR-10b as a negative regulator of CYP11B1 and CYP11B2, and its inhibitory effect on cortisol and aldosterone production in H295R human adrenocortical cells.

2. Materials and methods

Table 1 Gene primers for qRT-PCR analysis of steroidogenic enzyme genes. Primer name

Primer sequence (50 –30 )

Refs.

GLUT-1 forward GLUT-1 reverse VEGF-A forward VEGF-A reverse b-Actin forward

CCAGCTGCCATTGCCGTT GACGTAGGGACCACACAGTTGC AACCATGAACTTTCTGCTGTCTTG TTCACCACTTCGTGATGATTCTG CACTCTTCCAGCCTTCCTTCC

b-Actin reverse

AGGTCTTTGCGGATGTCCAC

CYP21A2 forward CYP21A2 reverse CYP11B1 forward CYP11B1 reverse CYP11B2 forward CYP11B2 reverse

CGTGGTGCTGACCCGACTG

TCCCGAGGGCCTCTAGGA

This study This study This study This study Hilscherova et al. (2004) Hilscherova et al. (2004) Hilscherova et al. (2004) Hilscherova et al. (2004) Oskarsson et al. (2006)

GGGACAAGGTCAGCAAGATCTT

Oskarsson et al. (2006)

TTGTTCAAGCAGCGAGTGTTG

Oskarsson et al. (2006)

GCATCCTCGGGACCTTCTC

Oskarsson et al. (2006)

GGCTGCATCTTGAGGATGACAC

2.1. Cell culture H295R cells (ATCC CRL-2128; ATCC, Manassas, VA, USA) were cultured in a 1:1 mixture of Dulbecco’s Modified Eagle’s medium and Ham’s F-12 medium (DMEM/F12) (Sigma D-2906; Sigma, St. Louis, MO, USA) supplemented with 1.2 g/L Na2CO3, 5 ml/L of ITS + Premix (BD Bioscience; 354352), and 12.5 ml/L of BD NuSerum (BD Bioscience; 355100) at 37 °C in 5% CO2 as described previously (Hilscherova et al., 2004). Exposure of H295R cells (1.2  106) to normoxia (20% O2) or hypoxia (1% O2) was carried out at 37oC for 24 h. Normoxia or hypoxia condition was created in a CO2 incubator by mixing 1% O2, 94% N2 and 5% CO2 or 20% O2, 75% N2 and 5% CO2, respectively, using a gas mixer (WITT) and the O2 level was monitored using a gas meter (BW Technologies). 2.2. RNA isolation and first-strand cDNA synthesis Total RNA was isolated with TRIzol reagent (Invitrogen) according to manufacturer’s instructions. Contaminating genomic DNA was removed with RQ1 RNase-free DNase (Promega). First-strand cDNA was synthesized using 1 lg total RNA, 1.25 lL dNTP (10 mM), 2.4 lL random hexamer (50 ng/lL), 1 lL RNaseOUT (40 U; Invitrogen), and 1 lL M-MLVRT (H-) (200 U/lL; Promega) in a total volume of 25 lL in 1 MMLVRT reaction buffer at 42 °C for 50 min. The reaction was terminated by incubation at 70 °C for 15 min. 2.3. Real-time PCR Gene expression quantification was achieved by real-time PCR as previously described (Yu et al., 2012). PCR assays were conducted using the SYBR Green-based detection method (Kapa Biosystem, #KK4600) according to the manufacturer’s instructions. The primer sequences for real-time PCR are listed in Table 1. Melting curve analysis was performed at the end of each PCR thermal profile to assess amplification specificity. The identity of PCR amplicons was confirmed by DNA sequencing. Real-time PCR reactions for all samples were performed in triplicate using the 7500 Fast Real-time PCR System (ABI). Cycling conditions were as follows: 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 58 °C for 30 s, 1 min 72 °C and 7 min of final extension at 72 °C for one cycle. Quantification of SF-1, CITED-2, DAX-1 and NURR-77 expression was carried out using TaqMan gene expression assays (ABI) according to the manufacturer’s instructions.

2.4. Western blot analysis Cellular proteins were extracted in 100 lL of RIPA buffer with protease inhibitor and PMSF (Calbiochem). Protein concentration was determined using the Bradford assay (Bio-Rad, Hercules, CA). Proteins (50 lg) were separated on 9% sodium dodecyl sulphate polyacrylamide gel and transferred onto PVDF membranes (GE Health Care). Membranes were blocked in PBST (Phosphate-buffered saline with 0.1% of Tween-20) containing 3% nonfat milk (Carnation), and probed with anti-human CYP11B2 rabbit polyclonal antibody (Novus, #NBP1-56518) (1:500 dilution) overnight at 4 °C. The anti-CYP11B2 antibody was found in this study to specifically detect the human CYP11B2 (55 kDa) and does not cross react with CYP11B1 protein (65 kDa) (data not shown). Membranes were washed with PBS-T and incubated with the secondary antibody conjugated with horseradish peroxidase. Immunoreactivity was visualized by enhanced chemiluminescence (Amersham) according to the manufacturer’s protocol. 2.5. Measurement of aldosterone and cortisol by ELISA Quantification of aldosterone and cortisol in culture media was performed using ELISA as described by Hecker et al. (2006). Samples were centrifuged for 5 min at 5000g at room temperature, and the supernatant was collected for hormone extraction. Samples were spiked with 1,2,6,7-3H-labeled T (0.0002 lCi/lL) (PerkinElmer) prior to extraction for determination of extraction efficiency. Hormones were extracted twice with 2.5 mL diethyl ether, and centrifuged at 2000g for 10 min. The solvent phase containing the steroid hormones was evaporated under a stream of nitrogen, and the residue was reconstituted in 250 lL EIA buffer (Cayman Chemical) and diluted 1:2 or 1:3 for aldosterone and cortisol analysis, respectively. Aldosterone and cortisol were measured by competitive ELISA using commercial EIA kits (Cayman Chemical). 2.6. MicroRNA profiling Total RNA was isolated using the MirVanaTM miRNA isolation Kit (Ambion, Inc., TX, USA) according to the manufacturer’s instructions. MicroRNA profiling was carried out using the human TaqMan Low Density miRNA Arrays (TLDAs) (Invitrogen). Total RNA from each sample was reverse transcribed using the Megaplex RT Primers (Human Pools A and B; Applied Biosystems) according

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

to manufacturer’s instructions, and the cDNA products preamplified using the Megaplex PreAmp Primers (Applied Biosystems) according to the manufacturer’s instructions. TLDAs were run on a 7900HT thermocycler (Applied Biosystems) using sequence detection systems (SDS) software version 2.4. PCR thermal-cycling conditions were as follows: 40 cycles of 60 °C for 2 min, 42 °C for 1 min and 50 °C for 1 s and finally 85 °C for 5 min for each sample. MicroRNA expression was normalized using the endogenous control U6 snRNA. Relative quantification (RQ) was performed using the 2D(DCT) method). The degree of induction or inhibition (DDCT) was calculated as fold difference which is expressed as: Xexp/ Xcon = 2DDCT. Xexp and Xcon represent the degree of expression in test and control samples, respectively. Site predictions for miRNAs were performed using three in silico algorithms – TargetScan (http://www.targetscan.org/), PicTar (http://pictar.bio.nyu.edu/), and Sanger microRNA target (http://microrna.sanger.ac.uk/) – to identify target binding sites within the 30 -UTR of the CYP21A2, CYP11B1 and CYP11B2 genes. 2.7. Overexpression and knockdown of miR-10b Overexpression and knockdown of miR-10b were carried out by electroporation of pre-miR-10b (100 nM) and antimiR-10b (100 nM) molecules (purchased from Ambion), respectively, into H295R cells using the Neon electroporation system (Invitrogen). Twenty-four hours after electroporation, the medium was replaced and cells incubated under hypoxia or normoxia for a further 24 h, and total RNA extracted for qRT-PCR analysis. Quantification of miR-10b expression was carried out using the TaqMan MicroRNA Assay kit for hsa-miR-10b (ABI) according to the manufacturer’s instructions. All reactions were run in triplicate and relative miRNA expression was normalized against U6 snRNA. 2.8. Construction of luciferase reporter plasmids of CYP11B1/B2 30 UTR An 879-bp and 1233-bp fragment of the 30 -UTR of CYP11B1 and CYP11B2, respectively, were amplified by PCR using genomic DNA from H295R cells and the following two pairs of primers: For CYP11B1: 50 -GCAAAGCTTACACCTCCAGGTGGAGACAC (forward) and 50 -CAGACTAGTCCCCACATGACTCTTCCATC (reverse); and for CYP11B2: 50 -GCAAAGCTTGAAGCACTTCCTGGTGGAGA (forward) and 50 -CAGACTAGTAGCTGGCTGCTGAGATCTTT (reverse). Both forward and reverse primers contain SpI and HindII restriction sites, respectively. The PCR products of the CYP11B1 and CYP11B2 30 UTR fragments were double-digested with SpI and HindIII, and cloned into the pMIR-REPORT luciferase vector (Ambion) which resulted in linking each 3-UTR fragment to the CMV-driven luciferase reporter gene. The plasmids are designated pMIR-B1-WT and pMIR-B2-WT. Two mutant constructs with mutations that disrupt the putative miR-10b binding sites in the 30 -UTR of CYP11B1 and CYP11B2 were prepared using the GENEARTÒ Site-Directed Mutagenesis System (Invitrogen). For mutation of the mir-10b binding site in CYP11B1, the following primers were used: 50 -ATCACGTC TCTGCACCCGATTCCCCAGCCTGGCCACCAG (forward) and 50 -CTGG TGGCCAGGCTGGGGAATCGGGTGCAGAGACGTGAT (reverse). For mutation of the mir-10b binding in CYP11B2, the following primers were used: 5-GTCTTGCATCTGCACCCGATTCCCCAGCCT GGCCACCAG (forward) and 50 -CTGGTGGCCAGGCTGGGGAATCGG GTGCAGATGCAAGAC. The corresponding mutant plasmids are designated pMIR-B1-MUT and pMIR-B2-MUT. The plasmid clones were verified by DNA sequencing. 2.9. Luciferase reporter assay Hela cells at a density of 1  105 per well in 24-well plates were cotransfected with pMIR-REPORT luciferase vectors with or

3

without premiR-10b (100 nM) or scrambled oligos (Ambion) using Lipofectamine 2000 reagent (Invitrogen). Twenty-four hours posttransfection, cells were harvested and lysed with Glo lysis buffer (Promega). Reporter assays were performed using a dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions. Results are expressed as relative luciferase unit (RLU), and b-gal expression from the control plasmid was used to normalize variability due to differences in cell viability and transfection efficiency. Microplate was read using the FLUOstar Optima instrument (BMG Labtech, Durham, NC, USA). Data are expressed as mean ± SD from three independent experiments. 2.10. Statistical analysis Student’s t-test was used to test the null hypothesis that there is no significant difference between each individual parameter measured in the control and treatment groups over time. The data are expressed as mean ± S.E.M, and a p < 0.05 was considered statistically significant. All statistical calculations were performed using Prism 3.02 (GraphPad, SanDiego, CA). 3. Results 3.1. Effects of hypoxia on expression of steroidogenic genes and production of corticosteroid hormones in H295R cells In order to confirm that the HIF-1 pathway is induced in H295R cells under our experimental conditions, VEGF-A and GLUT-1 (gene targets of HIF-1) mRNA levels were measured by quantitative RT-PCR (qRT-PCR) using gene-specific primers (Table 1), and were found to be upregulated in hypoxic H295R cells by 3.5 ± 0.17 (p < 0.0005) and 4.8 ± 0.19 (p < 0.0005) fold, respectively (data not shown). The induction of GLUT-1 and VEGF-A mRNA indicated that the hypoxic conditions used in the study were appropriate. Cortisol and aldosterone (corticosteroids) are produced from progesterone by the concerted activities of 21-hydroxylase (CYP21A2), 11b-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2) enzymes (Quinn and Williams, 1988). The effect of hypoxia on the expression of these genes was measured by qRT-PCR using gene-specific primers (Table 1). As shown in Fig. 1A, CYP21A2 and CYP11B2 were significantly upregulated by 2.49 ± 0.42 (p < 0.05) and 5.3 ± 0.73 (p < 0.005) fold, respectively, in hypoxic H295R cells. However, although CYP11B2 mRNA was increased under hypoxia, Western blot analysis demonstrated that the CYP11B2 protein was downregulated 0.38 ± 0.02-fold (p < 0.0001) (Fig. 1B), which suggests that the CYP11B2 mRNA transcripts were likely subjected to translational suppression in hypoxic H295R cells resulting in a reduction in the CYP11B2 protein. No significant difference in CYP11B1 expression was detected in H295R cells under normoxic and hypoxic conditions. 3.2. Hypoxia effects on adrenal transcription regulatory genes CYP21A2, CYP11B1 and CYP11B2 are known to be regulated by a number of transcription regulatory factors such as CITED2 (CBP/ 300-interacting transactivator 2), DAX-1 (Dosage-sensitive sex reversal-1), NURR 77 and NOR1 (members of the NGFI-B nuclear orphan receptor superfamily, and SF-1 (Steroidogenic Factor-1) (Bassett et al., 2002; Romero et al., 2007; Nogueira et al., 2009; Nogueira and Rainey, 2010). As shown in Fig. 1C, the expressions of NURR-77, CITED2 and NOR-1 were upregulated by 2.9 ± 0.47 (p < 0.01), 2.9 ± 0.19 (p < 001), and 1.8 ± 0.19 (p < 0.05) fold, respectively, while SF-1 and DAX-1 were significantly downregulated to 0.47 ± 0.05 (p < 0.005) and 0.19 ± 0.01 (p < 0.0001) fold, respectively, in hypoxic H295R cells.

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

4

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

Fig. 1. Hypoxia effects on expression of steroidogenic and transcription regulatory genes, and production of corticosteroid hormones (cortisol and aldosterone) in H295R cells. (A) Expression of CYP21A, CYP11B1 and CYP11B2 was measured by qRT-PCR; (B) western blot analysis of CYP11B2 (lane 1, normoxia; lane 2, hypoxia) and histogram of the corresponding CYP11B2 protein levels; CYP11B2 protein was normalized to b-actin; (C) expression of five transcription regulatory genes – SF1, Nurr77, CITED-2, DAX-1 and NOR-1 was measured by qRT-PCR; and (D) Aldosterone and cortisol levels in normoxic and hypoxic H295R cells were measured using commercial ELISA kits. Relative expression values were normalized to 18S rRNA and are presented as fold change relative to the normoxic controls. Data are presented as mean ± SEM. Asterisk (*) indicates significant difference between normoxia and hypoxia groups; * p < 0.05, ** p < 0.005, *** p < 0.0005.

3.3. Aldosterone and cortisol levels Aldosterone and cortisol levels were measured in the spent medium of H295R cells cultured under normoxic and hypoxic conditions. As shown in Fig. 1D, the aldosterone and cortisol levels in hypoxic H295R cells were significantly reduced 0.31 ± 0.08 (p = 0.0002) and 0.61 ± 0.14-fold (p = 0.04), respectively, of that in normoxic cells. This finding is consistent with previous reports in bovine and human adrenal cells where these hormones were found to be significantly reduced under hypoxia (Brickner et al., 1992; Raff et al., 2005).

The expression pattern of miR-10b was further examined in normoxic, hypoxic, HIF1a-overexpressing and -knockdown H295R cells by real-time PCR using TaqMan MicroRNA Individual assays (Applied Biosystem). Fig. 2 shows that miR-10b is upregulated by 1.48 ± 0.03 (p = 0.001) and 1.3 ± 0.06 (p = 0.05) fold, respectively, in hypoxic and HIF1a-overexpressing cells, but is downregulated 0.74 ± 0.006 (p = 0.0001) fold in HIF-1a-knockdown cells. The differential expression pattern of miR-10b in H295R cells under these conditions suggests that miR-10b is likely regulated by HIF-1.

3.4. MicroRNA profiling and selection of miR-10b for further analysis

3.5. Effects of miR-10b on CYP21A2, CYP11B1 and CYP11B2 expression and corticosteroid production

MicroRNA profiling experiments were performed on total RNA isolated from normoxic and hypoxic H295R cells as well as H295R cells transfected with the pLenti6-HIF1a plasmid that overexpresses the human HIF-1a (Nusrin, 2013). One hundred and twenty miRNAs were found to be upregulated in hypoxic H295R cells (as compared to normoxic cells) and 70 miRNAs were upregulated in H295R cells overexpressing the human HIF-1a protein (data not shown). Computer analysis of these upregulated miRNAs using three different algorithms – TargetScan (http://www.targetscan.org/), PicTar (http://pictar.bio.nyu.edu/), and Sanger microRNA target (http://microrna.sanger.ac.uk/) – identified miR-10b to have target binding sites in both the 30 -UTR of CYP11B1 and CYP11B2, which suggests that miR-10b may have an important role in post-transcriptional regulation of these two genes under hypoxia.

To investigate the effect of miR-10b on the regulation of CYP21A2, CYP11B1 and CYP11B2, H295R cells were transfected with synthetic pre-miR-10b, anti-miR-10b inhibitor or scrambled control sequences, and total RNA extracted 48 h post-transfection for qRT-PCR analyses. As shown in Fig. 3A and B, qRT-PCR confirmed the overexpression and knockdown of miR-10b by 36.7 ± 7.8 and 0.66 ± 0.03-fold, respectively, in H295R cells following pre-miR10b and anti-miR-10b transfection, respectively (p < 0.05). Overexpression of miR-10b significantly reduced CYP11B1 mRNA 0.29 ± 0.07fold and CYP11B2 mRNA 0.4 ± 0.01 (p < 0.05) fold relative to the scrambled control miRNAs; but had no significant effect on CYP21A2 expression (Fig. 3C). Interestingly, knockdown of miR-10b in H295R cells resulted in increased expression of CYP11B1 and CYP11B2 by 1.4 ± 0.07 (p = 0.008) and 2.1 ± 0.29 (p = 0.025) fold, respectively (Fig. 3D). These observations are consistent with the notion that

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

5

Fig. 2. Expression pattern of miR-10b. (A) Expression of miR-10b in normoxic and hypoxic H295R cells; (B) miR-10b expression in H295R cells transfected with the pLenti6HIF1a (HIF1a overexpression) plasmid or control pLenti6 vector under normoxia; and (C) miR-10b expression in H295R cells transfected with HIF-1a siRNA, HIF-1ai (HIF1a knockdown) or negative RNAi control under hypoxia. Expression levels were normalized to U6 snRNA. Data are presented as mean ± SEM. Asterisks (*) indicate significant difference between control and treated H295R cells under normoxia or hypoxia; * p < 0.05, *** p < 0.0005.

CYP11B1 and CYP11B2 (but not CYP21A2) mRNAs are direct targets of miR-10b. To determine the effect of miR-10b on corticosteroid production, aldosterone and cortisol levels were measured in the culture media of H295R cells following pre-miR-10b or anti-miR-10b transfection. Overexpression of miR-10b significantly reduced cortisol level 0.44 ± 0.17-fold (p = 0.032) and aldosterone level 0.36 ± 0.13-fold (p = 0.009) relative to H295R cells transfected with the scrambled control oligos (Fig. 4), which corresponded to the reduction in CYP11B1 and CYP11B2 expression, respectively (Fig. 3C). Interestingly, knockdown of miR-10b (following antimiR-10b transfection) significantly increased aldosterone production by 1.72 ± 0.16-fold (p = 0.027) relative to cells transfected with scrambled control oligos. In contrast, although a modest increase in cortisol level was observed in response to anti-miR-10b challenge (0.62 ± 0.25-fold; p = 0) relative to pre-miR-10b-transfected cells (0.44 ± 0.17-fold; p = 0.027), the increase was not statistically significant. 3.6. Analysis of the 30 -UTRs of CYP11B1 and CYP11B2 using luciferase reporter assays

pMIR-B2-WT reporter constructs, respectively. Additionally, mutant constructs with mutations that disrupt the putative miR10b binding sites in the 30 -UTR of CYP11B1 (pMIR-B1-MUT) and CYP11B2 (pMIR-B2-MUT) (Fig. 5A and B) were also prepared using the GENEART Site-Directed Mutagenesis System (Invitrogen). All constructs were verified by DNA sequencing. The constructs were cotransfected with premiR-10b or scrambled oligos (control) into HeLa cells followed by measurement of their luciferase activities. Overexpression of pre-miR-10b in HeLa cells significantly reduced the luciferase activity of the wild type CYP11B1-30 -UTR construct (pMIR-B1-WT) 0.79 ± 0.02-fold (p = 0.0007), and this inhibition was abolished when the miR-10b binding was mutated in the mutant CYP11B1-30 -UTR construct (pMIR-B1-MUT) (Fig. 6A). As expected, miR-10b had no effect on the endogenous luciferase activity of the control pMIR-REPORT vector. Similarly, overexpression of pre-miR-10b significantly reduced the luciferase activity of the wild type CYP11B2 30 -UTR construct (pMIR-B2-WT) 0.75 ± 0.044 fold (p = 0.0046), and the inhibitory effect was abolished in the mutant CYP11B2-30 -UTR construct (pMIR-B2-MUT) where the miR-10b binding site has been eliminated (Fig. 6B). 4. Discussion

To determine whether miR-10b binds to the 30 -UTR of CYP11B1 and CYP11B2 to downregulate expression of these genes, luciferase reporter assays were performed. An 879-bp 30 -UTR fragment of the CYP11B1 gene and a 1233-bp 30 -UTR fragment of the CYP11B2 gene, which contain the wild-type miR-10b binding site (Fig. 5A and B), were cloned into the pMIR-REPORT vector (Ambion). This resulted in fusion of the 30 -UTR fragments of CYP11B1 and CYP11B2 to a CMV-driven luciferase reporter to generate the pMIR-B1-WT and

This study demonstrated that hypoxia differentially regulates the expression of three steroidogenic enzyme genes that are involved in the biosynthesis of cortisol and aldosterone in H295R cells. Previous studies have reported that CYP11B2 expression and aldosterone synthesis are downregulated under hypoxia in rat and bovine adrenocortical cells (Raff and Kohandarvish, 1990; Brickner et al., 1992; Raff et al., 1996; Bruder et al., 2002). In the

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

6

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

Fig. 3. Overexpression and knockdown of miR-10b. (A) Overexpression of miR-10b was performed by electroporation of H295R cells with pre-miR-10b molecules under normoxia; (B) miR-10b knockdown was performed by electroporation of H295R cells with anti-miR-10b inhibitor molecules under hypoxia; (C) effect of miR-10b overexpression on CYP21A2, CYP11B1 and CYP11B2 expression; (D) effect of miR-10b knockdown on CYP21A2, CYP11B1 and CYP11B2 expression; relative mRNA expression and miR-10b values were normalized to 18S rRNA and U6 snRNA, respectively. Fold change in miR-10b is relative to the respective negative scrambled controls. Data are presented as mean ± SEM. Asterisks (*) indicate significant difference between control and pre-miR-10b or anti-miR-10b; * p < 0.05.

Fig. 4. Effect of miR-10b on production of stress steroid hormones in H295R cells. pre-miR-10b data are relative to cells transfected with control (scrambled) pre-miR, and anti-miR-10b data are relative to cells transfected with control (scrambled) antimiR molecules. Data are presented as mean ± SD. Asterisks (*) indicate significant difference between control and premiR/antimiR-transfected cells, * p 6 0.05, ** p 6 0.005.

current study, we demonstrated that although CYP11B2 mRNA is upregulated in H295R cells under hypoxia, the CYP11B2 protein and aldosterone levels were downregulated 0.38 ± 0.02 (p < 0.0001) fold (Fig. 1B) and 0.31 ± 0.08 (p = 0.0002) fold (Fig. 1D), respectively, relative to the normoxic control. A number of transcription regulatory factors such as CITED2, DAX-1, NURR-77 and NOR1 (NGFI-B nuclear orphan receptor superfamily) and SF-1 have been shown to play an important role in CYP21A2, CYP11B1 and/or CYP11B2 gene regulation (Bassett et al., 2002; Romero et al., 2007; Nogueira et al., 2009; Nogueira

Fig. 5. miR-10b binding sites in the 30 -UTR of CYP11B1 and CYP11B2 genes. Seed sequence of the putative miR-10b in the 30 -UTR of (A) CYP11B1 and (B) CYP11B2. The top strand in each pair is in the 50 –30 orientation, and the bottom strand is in the 30 – 50 orientation, with the predicted base pairing between the 30 -UTR (miR-binding site) and the miRNA seed sequence indicated by vertical lines. The wild-type seed sequence and complementary bases in the 30 -UTR are highlighted in blue; mutations in the 30 -UTR binding sites that disrupt base pairing are represented in red. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

and Rainey, 2010). For example, it has been demonstrated that CYP21A2 and CYP11B2 promoter activity are directly activated by NURR-77 and NOR-1 in gene transfection studies (Nogueira et al., 2009). Moreover, Bassett et al. (2004) have described the binding of NURR-77 to cognate DNA elements in the 50 -flanking sequence

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

7

aldosterone) production (Fig. 4). Further gene transfection studies using luciferase reporter constructs fused to the wild-type or mutated forms of the 30 -UTRs of CYP11B1 (Fig. 6A) or CYP11B2 (Fig. 6B) demonstrated that an increase in miR-10b levels reduces the activity of the luciferase genes of the wild-type 30 -UTR constructs (but not the mutant counterparts), which provided additional confirmation that miR-10b negatively regulates CYP11B1 and CYP11B2 mRNAs via binding site to the 30 -UTR sequence. Many studies have reported that hypoxia affects steroidogenesis in the adrenal gland and may potentially disrupt normal adrenal functions that could contribute to adrenal hyperplasia. To better understand the possible role(s) of miRNAs and HIFs in hypoxic dysregulation of steroid hormone production and the different forms of adrenal disorders, further investigations on other hypoxia- or HIF-inducible miRNAs are warranted. Acknowledgements This work was supported by a Seed Collaborative Research Fund (SCRF) (PJ9369101) from the State Key Laboratory in Marine Pollution (SKLMP). The authors wish to acknowledge the support of an instrumentation grant from the Canada Foundation for Infrastructure. Prof. Giesy was supported by the Canada Research Chair program, an at-large Chair Professorship at the Department of Biology and Chemistry and State Key Laboratory in Marine Pollution, City University of Hong Kong, and the Einstein Professor Program of the Chinese Academy of Sciences. Fig. 6. Effect of miR-10b on CYP11B1-30 -UTR luciferase activity. (A) HeLa cells cotransfected with WT (pMIR-B1-WT) or mutant CYP11B1-30 -UTR (pMIR-B1-MUT) luciferase constructs plus the scrambled oligos (control) or pre-miR-10b; (B) HeLa cells cotransfected with WT (pMIR-B2-WT) or mutant CYP11B2-30 -UTR (pMIR-B2MUT) luciferase constructs plus the scrambled oligos (control) or pre-miR-10b. Data represent mean ± SEM from 3 independent experiments. Asterisk (*) indicates significant difference between control and premiR-10b- transfected H295R cells, * p < 0.05, *** p < 0.0005.

of the human CYP11B2 gene. In addition, Romero et al. (2007) have reported the stimulatory effect of NURR-77 and CITED2 on CYP11B1 and CYP11B2 expression in H295R cells. Among the five transcription regulatory factors examined in the present study, we found that NURR-77, CITED2 and NOR-1 were significantly upregulated under hypoxia in H295R cells (Fig. 1C), an observation that is consistent with results reported in numerous other studies (Choi et al., 2004; Agrawal et al., 2008; Martorell et al., 2009). All in all, these results suggest that the hypoxic induction of CYP11B2 mRNA levels in hypoxic H295R cells (Fig. 1A) may be associated with the increased expression of NURR-77, CITED2 and/or NOR-1 (Fig. 1C). SF-1 is a master regulator of adrenal steroidogenesis and is known to play an important role in adrenocortical function and development (Hammer et al., 2005). It has been demonstrated previously that SF-1 activates CYP11B1 expression in both human (NCI-H295R) and mouse (Y-1) adrenal cells (Bassett et al., 2002) and it is possible that the absence of CYP11B1 induction in hypoxic H295R cells may be related to the reduced expression of SF-1 (Fig. 1A and D). Recent studies have demonstrated that miRNAs play important roles in adrenal steroidogenesis and reproductive functions through the regulation of steroid hormones namely aldosterone, androgen, and estrogen (Romero et al., 2008; Sirotkin et al., 2009). In this study, through microRNA expression profiling and bioinformatic analysis, we have identified the hypoxia-inducible miR-10b as a putative negative regulator of CYP11B1 and CYP11B2. Overexpression and knockdown of miR-10b in H295R cells confirmed that miR-10b negatively regulates CYP11B1 and CYP11B2 mRNA abundance (Fig. 3C and D) and corticosteroid (cortisol and

References Agrawal, A., Gajghate, S., Smith, H., Anderson, D.G., Albert, T.J., Shapiro, I.M., Risbud, M.V., 2008. Cited2 modulates hypoxia-inducible factor-dependent expression of vascular endothelial growth factor in nucleus pulposus cells of the rat intervertebral disc. Arthritis Rheum. 58 (12), 3798–3808. Baley, J., Li, J., 2012. MicroRNAs and ovarian function. J. Ovarian Res. 5, 8. Bartel, D.P., 2009. MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233. Bassett, M.H., Zhang, Y., Clyne, C., White, P.C., Rainey, W.E., 2002. Differential regulation of aldosterone synthase and 11betahydroxylase transcription by steroidogenic factor-1. J. Mol. Endocrinol. 28, 125–135. Bassett, M.H., Suzuki, T., Sasano, H., White, P.C., Rainey, W.E., 2004. The orphan nuclear receptors NURR1 and NGFIB regulate adrenal aldosterone production. J. Mol. Endocrinol. 18, 279–290. Brickner, R.C., Jankowski, B.M., Raff, H., 1992. The conversion of corticosterone to aldosterone is the site of oxygen sensitivity of the bovine adrenal zona glomerulosa. Endocrinology 130, 88–92. Bruder, E.D., Nagler, A.K., Raff, H., 2002. Oxygen-dependence of ACTH-stimulated aldosterone and corticosterone synthesis in the rat adrenal cortex: developmental aspects. J. Endocrinol. 172 (3), 595–604. Choi, J.W., Park, S.C., Kang, G.H., Liu, J.O., Youn, H.D., 2004. Nur77 activated by hypoxia-inducible factor-1a overproduces proopiomelanocortin in von HippelLindau-mutated renal cell. Cancer Res. 64, 35–39. Crosby, M.E., Kulshreshtha, R., Ivan, M., Glazer, P.M., 2009. MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 69, 1221–1229. Finnerty, J.R., Wang, W.-X., Hébert, S.S., Wilfred, B.R., Mao, G., Nelson, P.T., 2010. The miR-15/107 group of microRNA genes: evolutionary biology, cellular functions, and roles in human diseases. J. Mol. Biol. 402, 491–509. Guo, C.J., Pan, Q., Jiang, B., Chen, G.Y., Li, D.G., 2009. Effects of upregulated expression of microRNA-16 on biological properties of culture-activated hepatic stellate cells. Apoptosis 14, 1331–1340. Hammer, G.D., Parker, K.L., Schimmer, B.P., 2005. Mini review: transcriptional regulation of adrenocortical development. Endocrinology 146, 1018–1024. Hecker, M., Newsted, J.L., Murphy, M.B., Higley, E.B., Jones, P.D., Wu, R., Giesy, J.P., 2006. Human adrenocarcinoma (H295R) cells for rapid in vitro determination of effects on steroidogenesis: hormone production. Toxicol. Appl. Pharmacol. 217, 114–124. Hilscherova, K., Jones, P.D., Gracia, T., Newsted, J.L., Zhang, X.W., Sanderson, J.T., Yu, R.M.K., Wu, R.S.S., Giesy, J.P., 2004. Assessment of the effects of chemicals on the expression of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol. Sci. 81, 178–189. Karp, X., Ambros, V., 2005. Developmental biology. Encountering microRNAs in cell fate signaling. Science 310, 1288–1289. Ke, Q., Costa, M., 2006. Hypoxia inducible factor 1. Mol. Pharmacol. 70, 1469–1480. Krek, A., Grun, D., Poy, M.N., Wolf, R., Rosenberg, L., EEpstein, JP., da Piedade, M.I., Gunsalus, K.C., Stoffel, M., Rajewsky, N., 2005. Combinatorial microRNA target predictions. Nat. Genet. 37, 495–500.

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002

8

S. Nusrin et al. / Marine Pollution Bulletin xxx (2014) xxx–xxx

Kulshreshtha, R., Davuluri, R.V., Calin, G.A., Ivan, M., 2008. A microRNA component of the hypoxic response. Cell Death Differ. 15, 667–671. Lisy, K., Peet, D.J., 2008. Turn me on: regulating HIF transcriptional activity. Cell Death Differ. 15, 642–649. Martorell, L., Gentile, M., Rius, J., Rodríguez, C., Crespo, J., Badimon, L., MartínezGonza´lez, J., 2009. The hypoxia-inducible factor 1/NOR-1 axis regulates the survival response of endothelial cells to hypoxia. Mol. Cell. Biol. 29 (21), 5828–5842. Nogueira, E.F., Rainey, W.E., 2010. Regulation of aldosterone synthase by activator transcription factor/cAMP response element-binding protein family members. Endocrinology 151 (3), 1060–1070. Nogueira, E.F., Xing, Y., Morris, C.A., Rainey, W.E., 2009. Role of angiotensin IIinduced rapid response genes in the regulation of enzymes needed for aldosterone synthesis. J. Mol. Endocrinol. 42, 319–330. Nusrin, S., 2013. Role of Hypoxia-inducible Factors (HIFs) and microRNAs on regulation of stress steroid production in H295R human adrenocortical cells. PhD thesis. City University of Hong Kong. Oskarsson, A., Ullerås, E., Plant, K.E., Hinson, J.P., Goldfarb, P.S., 2006. Steroidogenic gene expression in H295R cells and the human adrenal gland: adrenotoxic effects of lindane in vitro. J. Appl. Toxicol. 26, 484–492. Quinn, S.J., Williams, G.H., 1988. Regulation of aldosterone secretion. Ann. Rev. Physiol. 50, 409–426. Raff, H., Kohandarvish, S., 1990. The effect of oxygen on aldosterone release from bovine adrenocortical cells in vitro: PO2 versus steroidogenesis. Endocrinology 127, 682–687.

Raff, H., Ball, D.L., Goodfriend, T.L., 1989. Low oxygen selectively inhibits aldosterone secretion from bovine adrenocortical cells in vitro. Am. J. Physiol.: Endocrinol. Metab. 256, E640–E644. Raff, H., Jankowski, B.M., Engeland, W.C., Oaks, M.K., 1996. Hypoxia in vivo inhibits aldosterone synthesis and aldosterone synthase mRNA in rats. J. Appl. Physiol. 81, 604–610. Romero, D.G., Rilli, S., Plonczynski, M.W., Yanes, L.L., Zhou, M.Y., Gomez-Sanchez, E.P., Gomez-Sanchez, C.E., 2007. Adrenal transcription regulatory genes modulated by angiotensin II and their role in steroidogenesis. Physiol. Genomics 30, 26–34. Romero, D.G., Plonczynski, M.W., Carvajal, C.A., Gomez-Sanchez, E.P., GomezSanchez, C.E., 2008. Microribonucleic acid-21 increases aldosterone secretion and proliferation in H295R human adrenocortical cells. Endocrinology 149 (5), 2477–2483. Semenza, G.L., 1998. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr. Opin. Genet. Dev. 8, 588–594. Sirotkin, A.V., Ovcharenko, D., Grossmann, R., Lauková, M., Mlyncek, M., 2009. Identification of microRNAs controlling human ovarian cell steroidogenesis via a genome-scale screen. J. Cell Physiol. 219 (2), 415–420. Yu, M.K., Chu, L.H., Tan, T.F., Li, V., Chan, A., Giesy, J.P., Cheng, S.H., Wu, S.S., Kong, Y.C., 2012. Leptin-mediated modulation of steroidogenic gene expression in hypoxic zebrafish embryos: implications for the disruption of sex steroids. Environ. Sci. Technol. 46, 9112–9119.

Please cite this article in press as: Nusrin, S., et al. Regulation of CYP11B1 and CYP11B2 steroidogenic genes by hypoxia-inducible miR-10b in H295R cells. Mar. Pollut. Bull. (2014), http://dx.doi.org/10.1016/j.marpolbul.2014.04.002