Mutation analysis of CYP11B1 and CYP11B2 in patients with increased 18-hydroxycortisol production

Molecular and Cellular Endocrinology 214 (2004) 167–174

Mutation analysis of CYP11B1 and CYP11B2 in patients with increased 18-hydroxycortisol production Jérˆome Nicod a , Bernhard Dick a , Felix J. Frey a , Paolo Ferrari b,∗ b

a Division of Nephrology and Hypertension, Inselspital, University of Berne, Berne, Switzerland Department of Nephrology, Fremantle Hospital, University of Western Australia, Alma Street, P.O. Box 480, Fremantle, WA 6959, Australia

Received 9 April 2003; accepted 21 October 2003

Abstract Background: In patients with glucocorticoid remediable aldosteronism (GRA), a rare hypertensive disorder caused by the presence of a chimeric aldosterone synthase (CYP11B2) and 11␤-hydroxylase (CYP11B1) gene, high level of urinary 18-hydroxycortisol (18OHF) excretion are observed. In some patients with hypertension, increased urinary 18OHF secretion is also found in the absence of the hybrid CYP11B1/CYP11B2 gene. We hypothesised that gene variants of CYP11B1 or CYP11B2 may be linked to this abnormal glucocorticoid production. Methods: The urinary steroid profile was analysed by gas chromatography/mass spectrometry in 429 hypertensive patients and 98 (23%) thereof tested positive for increased 18OHF excretion. After correction for total cortisol excretion, 12 subjects showed an abnormally high 18OHF excretion. For genotyping DNA was obtained from six of these patients. All were tested negative for the hybrid CYP11B1/CYP11B2 gene and were further analysed for mutations in all exons and promoter regions of both CYP11B1 and CYP11B2 by single strand conformation polymorphism (SSCP) and sequencing when appropriate. Results: The genetic analysis of the two genes revealed the presence of nine molecular variants in CYP11B2 and three in CYP11B1. In addition to published polymorphic sites, we identified two new variants in CYP11B2 but no new variants in CYP11B1. The newly identified CYP11B2 mutations are a C/T single nucleotide exchange located in the first intron and a double nucleotide exchange at the 3 -splice site of exon 8. The mutated sequence corresponds to the sequence of CYP11B1 indicating a gene conversion. This suggests that the mutant is not likely to affect splicing. Thus, none of the genetic variants identified explains the high urinary excretion of 18OHF. Conclusions: We present here a complete method for the genetic analysis of the CYP11B1 and CYP11B2 genes. By this method we could not identify genetic variants responsible for a GRA-like phenotype. The presence of high levels of 18OHF should not be used alone as a diagnosis tool for GRA. © 2003 Elsevier Ireland Ltd. All rights reserved. Keywords: Hypertension; Aldosteronism; CYP11B1; CYP11B2; Genetics; 18-Hydroxycortisol; Steroid biosynthesis; SSCP

1. Introduction The last steps in the synthesis of aldosterone and cortisol are mediated by two isozymes, aldosterone synthase and 11␤-hydroxylase. The aldosterone synthase enzyme, expressed in the zona glomerulosa of the adrenal gland, has three activities necessary to convert 11-deoxycorticosterone (DOC) to aldosterone, i.e. 11␤-hydroxylase, 18-hydroxylase and 18-oxidase activities (Curnow et al., 1991; Kawamoto et al., 1992). This enzyme is encoded by the CYP11B2 gene and is regulated by angiotensin II and potassium via protein kinase C (LeHoux et al., 2000, 2001). This enzyme is different from 11␤-hydroxylase, the product of the CYP11B1 ∗

Corresponding author. Tel.: +618-9431-3600; fax: +618-9431-3619. E-mail address: [email protected] (P. Ferrari).

gene, which is expressed in the zona fasciculata and reticularis, and converts 11-deoxycortisol to cortisol under the regulation of ACTH via cAMP and protein kinase A. Human CYP11B1 and CYP11B2 have 90% nucleotide sequence identity in the introns and 95% in the exons and lie in close proximity on chromosome 8q (Mornet et al., 1989; Chua et al., 1987). The condition known as “glucocorticoid remediable aldosteronism” (GRA) is an autosomal dominant form of hypertension caused by the inheritance of a hybrid gene, composed of the regulatory sequence from the CYP11B1 gene and the coding sequence from the CYP11B2 gene (Lifton et al., 1992). This hybrid gene is the result of an unequal crossing-over of the two genes leading to ACTH-regulated overproduction of aldosterone and of abnormal steroids, 18-hydroxycortisol (18OHF) and 18-oxocortisol (18oxoF)

0303-7207/$ – see front matter © 2003 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2003.10.056

168

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

(Gomez-Sanchez et al., 1984a,b), because the abnormal enzyme of this hybrid gene is expressed ectopically in the zona fasciculata, thus exposing cortisol to aldosterone synthase activity. Since ACTH drives the abnormal steroidogenesis, GRA may be diagnosed by the dexamethasone suppression test (DST), where 3 days treatment with dexamethasone suppresses the high level of aldosterone. However, the gold-standard diagnosis test for GRA is the genetic test where the presence of the chimeric gene is determined by PCR amplification (Jonsson et al., 1995; MacConnachie et al., 1998). Mulatero et al. (1998) showed that several patients with dexamethasone suppressible hyperaldosteronism did not have the expected chimeric gene. It was later demonstrated that only 20% of patients with primary aldosteronism suppressed after DST had a positive genetic test for the classical chimeric gene (Fardella et al., 2000). Therefore, it has been speculated that other genetic variations in CYP11B1 or CYP11B2 might mimic the GRA phenotype. In vitro experiments demonstrated that point mutations in the CYP11B1 gene were sufficient for its product to acquire partial or full aldosterone synthase activity (Curnow et al., 1997; Bottner et al., 1998). Engineered CYP11B2 enzymes with mutated amino acids in the N-terminus resulted in increased 11␤-hydroxylation and 18-hydroxylation activities with or without decreased 18-oxidase activity (Bottner et al., 1998). However, to date no mutation of this kind has been demonstrated in patients with a positive DST (Fardella et al., 2001; Pilon et al., 1999; Mulatero et al., 1998, 2001). Some authors reported that the presence of high levels of 18OHF in the urine or plasma is a more efficient diagnosis of the presence of the chimeric gene than the DST (Fardella et al., 2000; Mosso et al., 2001). This suggests that in patients with a possible genetic form of primary aldosteronism the DST might not detect those subjects likely to carry a mutation in CYP11B1 or CYP11B2 genes. In some patients with hypertension, increased urinary 18OHF secretion is also found, along with low-renin hypertension with or without hypokalemia. Although classic GRA would seem likely, the chimeric CYP11B1/CYP11B2 gene cannot be detected. Thus, we hypothesize that in subjects presenting high urinary levels of 18OHF, but without the hybrid CYP11B1/CYP11B2 gene, the abnormal excretion of 18OHF

may be an intermediate phenotype of genetic variations on CYP11B1 or CYP11B2 genes. To test this hypothesis, we designed a complete method based on the single strand conformation polymorphism (SSCP) for the genetic analysis of the nine exons and the promoter of CYP11B1 and CYP11B2.

2. Methods 2.1. Subjects Between August 2000 and December 2001, we analysed the individual urinary steroid profiles of 429 patients with hypertension. For each analysis, a 24 h urine collection was obtained from each patient. The urinary steroid profile was analysed by gas chromatography (GC)–mass spectrometry (MS) on a Hewlett Packard GC–MS using routine method previously described (Ferrari et al., 2001). Of the 429 patients, 98 (23%) tested positive for increased levels of urinary 18-hydroxycortisol (18OHF) according to the limits published by Shackleton (1986). Urinary 18OHF excretion occurs also in normal subjects, but the magnitude of its excretion is in proportion with the substrate (cortisol) production. Thus, the ratio of 18OHF to total cortisol metabolites was calculated as an index of 18-hydroxylation activity. This ratio has already been used previously for characterisation of patients with primary aldosteronism (Irony et al., 1990). Aldosterone secretion was quantitated by GC-MS analysis of urinary tetrahydroaldosterone (THAldo) excretion. The normal range has been reported to range between 6 and 63 ␮g/24 h (Shackleton, 1986). Plasma renin and aldosterone as well as serum electrolytes were assessed in all patients as previously described (Ferrari et al., 2001). 2.2. DNA preparation, PCR amplification and SSCP analysis Genomic DNA was isolated from peripheral blood leukocytes using a commercial kit (Nucleon BACC3 DNA extraction kit, Amersham Intl., Buckinghamshire, UK). Using the two-tubes long PCR method described by MacConnachie et al. (1998), the presence of the CYP11B1/CYP11B2 chimeric gene was excluded in all subjects (Table 1).

Table 1 Biochemical characteristics of the 6 subjects with increased urinary 18-hydroxycortisol (18OHF) excretion Subject

1 2 3 4 5 6

Gender

Female Male Male Female Female Female

Age (years)

69 44 67 74 23 53

THAldo: tetrahydroaldosterone.

Plasma

Urinary

Renin (ng/l)

Aldosterone (pmol/l)

THAldo (␮g/24 h)

18OHF/total cortisol ratio

3.1 2.2 1.6 1.8 1.5 1.1

453 330 308 255 195 180

45 32 38 24 23 16

0.10 0.11 0.21 0.08 0.08 0.08

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

169

Table 2 Oligonucleotide primers for the SSCP analysis of the CYP11B2 gene with amplified fragment size and endonuclease digestion if required Product size (bp)

Digestion products

+5 -CAGTTCTCCCATGACGTGATATGT-3

415

HaeII → 124 + 291

Exon 2

+5 -AGCACTAAAGTTGAAAGGTTCCAG-3 −5 -CAGCTCTCAGCTCCCAACTC-3

352

Exon 3

+5 -CTGCAGGCCGATTCCCCTTG-3 −5 -TGGCCACTCCAGGGTCTCTG-3

348

Exon 4

+5 -CCTTGTGCTCAGCAGTGCAT-3 −5 -GTGGTGGAGAAGGAGAAATTGG-3

307

Exon 5

+5 -ATTTGGGTGTCGGGGCAGTCT-3 −5 -GAGTCCTCCAGCTGCCTCTCAACC-3

595

Exon 6

+5 -TCCTCCTGTGCAAGGTC-3 −5 -AGGGCCACAGGGAGGCCTCA-3

242

Exon 7

+5 -GGTGCTGAGAGCACAGG-3 −5 -GGATCAGGGAATGACTG-3

203

Exon 8

+5 -CCCTCGAGCTGAGAACCTCC-3 −5 -AATCACACCATGCAAGC-3−

344

Exon 9

+5 -TAATTGTTGCACCTGGG-3 −5 -TTGCTATTTGACAAGCCTGGCAAG-3

386

Exon 1

−5 -GAATGGCAGTGCTGAGTGCC-3

Thereafter, two long fragments containing exons 1–5 and exons 5–9 of CYP11B2 were amplified with primers annealing to DNA regions different of the CYP11B1 DNA sequence. The DNA (100–200 ng) was amplified in a 50 ␮l reaction mixture containing 1.5 or 2.5 mM MgCl2 , 0.4 mM of each primer, 0.4 mM of d-NTP and 1 U of QIA-Taq polymerase (QIAGEN, Valencia, CA) in the presence of the buffer provided with the enzyme. Thirty-two cycles of PCR were performed: 30 s at 94 ◦ C, 30 s at 65◦ C and 5 min at 72 ◦ C. Primers were 5 -CAAGGCTCCCTCTCATCTCACGATAAGATA-3 and 5 -CCGGAATTCCTCCAGCTGCCTCTCAACC-3 for the amplification of exons 1–5 and 5 -ATTTGGGTGTCGGGGCAGTCT-3 and 5 -TTGCTATTTGACAAGCCTGGCAAG3 for the amplification of exons 5–9 of CYP11B2 leading to long fragments of, respectively, 4283 and 2715 bp length. These long fragments were then purified after separation on 1% agarose gel using the QIAEX II Agarose Gel Extraction Kit (QIAGEN, Valencia, CA) and used as templates for amplification of the exons. Exons were amplified using the primers described in Table 2 in a 50 ␮l reaction mixture containing 3 mM MgCl2 , 0.4 mM of each primer, 0.2 mM of d-NTP and 1 U of AmpliTaq Gold polymerase (Perkin-Elmer Corp., Forster City, CA). Thirty cycles of PCR were performed: 30 s at 94 ◦ C, 30 s at 58 ◦ C and 1 min at 72 ◦ C. Selected fragments were additionally digested using an appropriate endonuclease to obtain shorter fragments (see Table 2). Following conditions formerly described by Skinner et al. (1996), all nine exons of CYP11B1 gene were also amplified and, for five of them, also digested by an endonuclease. Specificity of the amplification of exons was assessed by using

BshNI → 325 + 270

long fragments of one gene as template for the amplification of an exon of the second gene. Using our conditions, we could not see any false amplification (data not shown). Additionally, the last 400 bp of the promoter region of CYP11B2 were amplified. Genomic DNA was used as a template (100–200 ng) in a 50 ␮l reaction mixture containing 3 mM MgCl2, 0.5 mM of each primer, 0.2 mM of d-NTP and 2.5 U of AmpliTaq Gold polymerase. Thirty-five cycles of PCR were performed: 30 s at 94 ◦ C, 30 s at 52 ◦ C and 1 min at 72 ◦ C. The primers were 5 -CAGGGGGTACGTGGACATTT-3 and 5 -CTCTGCCTTTGCCCTGAGT-3 . This PCR amplification yields a 464 bp product which was digested at 37 ◦ C with BshNI to give 267 and 197 bp fragments. Promoter of CYP11B1 was also amplified using the same conditions but with a different set of primers specific for this gene (5 -TGGTTTAATACAATTCATGCCAAC-3 and 5 -ATGCACACCTCTGCCTTTG-3 ) leading to a 351 bp long fragment containing the 311 last nucleotides of the promoter. The amplicon was digested for 2 h at 65 ◦ C in presence of the TaiI restriction enzyme yielding two fragments of 97 and 254 bp long. All PCR products, directly after amplification or following enzymatic digestion, were analysed by SSCP on 12% acrylamide gels containing 7.25% glycerol using a two-buffer system (Liechti-Gallati et al., 1999). Four microliters of the PCR sample were loaded and DNA was visualised by silver staining (Lovati et al., 2001). Any variations detected by this technique were characterised by directly sequencing the PCR amplified fragment with an ABI PRISM Model 377.

170

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

2.3. CYP11B2 exon 8 3 slice site mutation genotyping The presence of the double CGTA/TGTG mutation identified in the 3 -splice site region of exon 8 of the CYP11B2 gene was assessed in 100 unrelated patients and controls. Subjects chosen for this analysis were 40 healthy controls, 30 hypertensive and 30 end-stage renal disease patients from our DNA bank. Genotyping was done by specific restriction enzyme digestion. Exon 8 of all subjects was amplified using the primers designed for the SSCP analysis (see Table 2). After amplification, the 344 bp long PCR fragments were digested with the TaiI enzyme. The wild-type allele digestion leads to three fragments of 184, 78 and 82 bp, the mutated allele to two fragments of 184 and 160 bp long. Separation was done by running the digested fragment on 12% polyacrilamide gel.

3. Results Fig. 1 shows the relationship between urinary 18OHF and total urinary cortisol metabolites and between the ratio of urinary 18OHF to total cortisol metabolites in relationship with total urinary cortisol metabolites in the 98

patients with increased absolute urinary 18OHF excretion. There was a linear relationship between absolute urinary 18OHF excretion and the excretion of total urinary cortisol metabolites (R = 0.855, P < 0.0001). However, 12 subjects had a ratio of urinary 18OHF to total cortisol metabolites in relationship with total urinary cortisol metabolites higher than the upper limit of 0.075, suggesting overproduction of 18OHF independent from cortisol production. For further genotyping DNA was obtained from 6 of these subjects (Table 1). The 12 patients with a high ratio of urinary 18OHF to total cortisol metabolites were compared to 70 randomly selected subjects with a normal ratio with respect to baseline demographical and biochemical data. Age (high versus normal, 54 ± 12 years versus 50 ± 15 years), untreated systolic (175 ± 22 mmHg versus 174 ± 28 mmHg) and diastolic (102 ± 12 mmHg versus 101 ± 14 mmHg) blood pressure did not differ between the two groups. Patients with increased 18OHF to total cortisol metabolites ratio were compared to subjects with a normal ratio. Patients with a high ratio were found to have lower serum potassium (3.7 ± 0.4 mmol/l versus 4.1 ± 0.4 mmol/l, P < 0.02), higher serum sodium (142±2 mmol/l versus 141±2 mmol/l, P < 0.05), and plasma aldosterone-to-renin ratios (180 ± 67 pmol/ng versus 81 ± 42 pmol/ng, P < 0.0001). Plasma

Urinary 18OHF (µg/24h)

3000

2000

1000

0

Ratio of urinary 18OHF to total cortisol metabolites

0.25 0.20 0.15 0.10 0.05 0.00

0

10000

20000

30000

40000

50000

60000

70000

Total urinary cortisol metabolites (µg/24h)

Fig. 1. Top panel: Relationship between urinary 18-hydroxycortisol (18OHF) and total urinary cortisol metabolites. Bottom panel: Between the ratio of urinary 18OHF to total cortisol metabolites in relationship with total urinary cortisol metabolites in the 98 patients with increased absolute urinary 18OHF excretion.

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

171

Table 3 Molecular variants in CYP11B1 and CYP11B2 detected by SSCP and identified by sequencing Location

Alleles

Positiona

Function

dbSNP

CYP11B1 Exon 1 Exon 2 Intron 3

G/A C/T A/G

225 636 212

Silent Silent Intronic

rs6410 rs6406 rs6387

CYP11B2 Promoter Intron 1 Exon 3 Exon 3 Exon 5 Exon 6 Intron 6 Intron 6 Exon 7 Exon 8 3 -UTR

C/T C/T C/T A/G G/A A/C G/A G/A T/C CGTA/TGTG G/A

267 1205 3309 3323 4101 5160 5513 5541 5596 5916–9 6547

Non-coding Intronic Silent K173R Silent Silent Intronic Intronic V386A Silent Untranslated

rs4546 rs4539 rs4540 rs4538 rs6397 rs6435 rs4541 rs3097

a

The positions refer to the Genbank sequences D13752 for CYP11B2, D16153 for exons 1 and 2 of CYP11B1 and D16154 for intron 3 of CYP11B1.

immunorecative renin was significantly lower (2.0±0.7 ng/l versus 8.9 ± 6.7 ng/l, P < 0.0001), while plasma aldosterone tended to be higher (359 ± 151 pmol/l versus 223 ± 103 pmol/l, P = 0.06) in the same patients. There were no significant differences in these variables between the six patients who underwent genotyping and the remaining patients who were not available for genetic testing. Dexamethasone suppression was not carried out routinely in these patients. 3.1. CYP11B2 Using SSCP analysis of CYP11B2 conducted on all exons and promoter region, two new molecular variants of CYP11B2 were detected. In addition, the –344 C/T polymorphism in the steroidogenic factor-1 (SF-1) binding site of the promoter region (White and Slutsker, 1995) and eight other polymorphisms already described in the National Center for Biotechnology Information (NCBI), accessible on the dbSNP website (http://www.ncbi. nlm.nih.gov/SNP/index.html) were also identified. The list of genetic variations with the corresponding dbSNP identification number if applicable is reported in Table 3. One of the new mutations is a C/T single nucleotide exchange located in intron 1, at position 1205 according to the Genbank D13752 sequence. This variation is a polymorphism found in five of the six subjects. The second new mutation identified is a heterozygote mutation present in one subject on the 3 -splice site of exon 8. As shown in Fig. 2, SSCP analysis of this exon reveals an additional band only in patient 6. This variant consists in the simultaneous mutation of two single bases separated by two basepairs. The CCAC↓GTAG splice sequence is changed to CCAT ↓ GTGG which can modify the splicing at this ¯ ¯

Fig. 2. SSCP gel of the exon 8 of CYP11B2. The letter C identifies the control, numbers 2–7 refer to the patients. An additional band, located at the end of the arrow, is seen in patient 6. This difference in pattern reveals a variance in the nucleic acid sequence of the fragment, as compared to the others. Direct sequencing of the fragment demonstrated that it corresponds to the double mutation in the 3 -splice site.

point. Subcloning of the amplified PCR fragment in a pCR 2.1-TOPO vector (Invitrogen Corp., San Diego, USA) followed by sequencing confirmed that the two mutated bases were carried on the same allele. The mutated sequence corresponds to the sequence of CYP11B1 (see Fig. 3), which may indicate a gene conversion. This mutation was not present in 100 unrelated subjects suggesting that it is not polymorphic. Sequencing of the mutant allele also showed that the conversion concerns a very short fragment, because after 9 bp in the 3 and 45 bp in the 5 direction, the sequence is not converted anymore. This mutant is not likely to affect the splicing because it is an effective splice site for CYP11B1. Two polymorphisms lead to a modification of the protein sequence. In exon 7, the valine at position 386 is changed by an alanine (V386A) and in exon 3, the lysine at codon 173 is substituted by an arginine (K173R). Effects of these two polymorphisms were already assessed in vitro and were shown to have no or very little influence on the aldosterone synthase activity (Pascoe et al., 1992; Shizuta et al., 1995; Fardella et al., 1996; Portrat-Doyen et al., 1998). We did not find any new variation in the promoter region of CYP11B2. The band patterns show differences but they were due to the presence of the –344 T/C polymorphism in the streoidogenic factor-1 (SF-1) binding site (White and Slutsker, 1995).

172

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

exon 8 CYP11B2 wt CCTCGGGCGGCGCCTGGCAGAGGCAGAGATGCTGCTGCTGCTGCACCACGTAAGCAGGCCTGG CYP11B2 mut CCTCGGGCGGCGCCTGGCAGAGGCAGAGATGCTGCTGCTGCTGCACCATGTGAGCAGGCCTGG * * * * CYP11B1 wt CCTTGGGCGGCGCCTGGCAGAGGCAGAGATGCTGCTGCTGCTGCACCATGTGAGCAGGCCCGG

45 b p

9bp

Fig. 3. Exon 8 site sequences of CYP11B1, CYP11B2 wild-type and CYP11B2 mutant. The figure shows the three sequences. Mutated bases are underlined, the asterisks indicate bases which differ between CYP11B1 and CYP11B2.

3.2. CYP11B1 This gene showed less variability compared to CYP11B2, but we were able to detect three polymorphisms (see Table 3). None of these polymorphisms affect the protein sequence. No molecular variant was found in the promoter region in either patients or control subjects. A search for conversion of the CYP11B1 gene carrying the exon 5 of CYP11B2 as described by Mulatero et al. (Mosso et al., 2001) was also performed in all patients, but none tested positive for such gene conversion.

4. Discussion Previous studies seeking for genetic variations in CYP11B1 and CYP11B2 have been conducted on patients with a positive DST, but who did not have the chimeric CYP11B1/CYP11B2 gene (Fardella et al., 2001; Pilon et al., 1999; Mulatero et al., 1998, 2001). These analyses were conducted on the promoter of CYP11B2 and the exons 3–9 of CYP11B1. These regions of the two genes are those expected to lead to a GRA phenotype in case of non-conservative mutations (Curnow et al., 1997; Mulatero et al., 1998). However, so far no new molecular variant in these genes was found in patients (Fardella et al., 2001; Pilon et al., 1999; Mulatero et al., 1998, 2001). In the present study, we have selected subjects without classic GRA, but who had high levels of urinary 18OHF, along with a phenotype that suggested activation of the mineralocorticoid axis. We extended the genetic analysis to all exons of CYP11B1 and CYP11B2 and the corresponding promoter regions in these patients. Increased urinary levels of 18OHF are found in up to 23% of hypertensive patients, although in most cases this increase is in parallel with an increase in total cortisol excretion. This can be explained by the fact that some degree of 18OHF excretion is a normal occurrence of cortisol metabolism. Using the ratio of 18OHF to total cortisol metabolites allows one to estimate an excessively high 18OHF production. With this selection criteria, 12 (2.8%) patients demonstrate increased 18OHF independent of cortisol excretion. This abnormal steroid is found in higher quantity not only in GRA

but also in patients with aldosterone producing adenoma. In contrast, 18OHF is not present in primary aldosteronism due to bilateral hyperplasia (Miyamori et al., 1992; Ulick et al., 1993; Kikuchi et al., 2000). In our patients, the presence of adenoma and hyperplasia was excluded by clinical investigations. None of the six subjects whose DNA was available for genetic testing were carriers of the chimeric CYP11B1/CYP11B2 gene. High levels of 18OHF have already been reported in essential hypertensive patients, but no explanation was given for these findings (Gomez-Sanchez et al., 1987; De Matteo et al., 1997). The 18OHF itself has no biological activity (Gomez-Sanchez et al., 1984a,b; Ulick et al., 1983). It has been postulated that abnormally high concentrations of 18-hydroxyglucocorticoids may be responsible for impaired 11␤-hydroxylation (Jamieson et al., 1996), but it was demonstrated later that neither 18OHF, nor 18oxoF affect the activity of 11␤-hydroxylase or aldosterone synthase (Fisher et al., 2001). Thus, if 18OHF cannot activate the mineralocorticoid receptor and does not affect the activity of 11␤-hydroxylase or aldosterone synthase, its presence may only be a marker of an intermediate phenotype. One cause for the increased 18OHF synthesis in the absence of classic GRA may be a genetic alteration of either CYP11B1 or CYP11B2. It was shown in vitro that the product of the CYP11B1 gene may acquire aldosterone synthase activity if serine 288 and valine 320 are replaced by the corresponding CYP11B2 residues, glycine and alanine, showing full aldosterone synthase activity if exons 4–6 are replaced (Curnow et al., 1997). In addition, association of the V320A and N335D mutations in CYP11B1 leads to an enzyme with 20% of the CYP11B2 wild-type activity which can be sufficient to increase the 18OHF synthesis (Bottner et al., 1998). However, not only exons 4–6 of CYP11B1 may be involved. Mutations of the CYP11B2 enzyme in the N-terminal amino acids lead to an increase of the 11␤-hydroxylation and 18-hydroxylation activities with D147E and I112P with a reduced 18-oxidation activity, except for D147E where aldosterone production is also increased (Mulatero et al., 2001; Bechtel et al., 2002; Fisher et al., 2000). In Dahl Rat Model (Cover et al., 1995) and in Milan Hypertensive Rats (Lloyd-MacGilp et al., 2002), mutations in CYP11B2 were found to affect aldosterone production but no physiologic consequences

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

(for instance on blood pressure) were found. Mutations in the human CYP11B2 gene analogous to those found in the Dahl salt-resistant rat were created and assessed in vitro (Fardella et al., 1995). K251R was found to produce four times as much 18-hydroxycorticosterone and 50–80% more aldosterone than wild-type. However, to date it has not been possible to find any genetic variations in human subjects that may be linked to an alteration in CYP11B2 or CYP11B1 activities (Fardella et al., 2001; Pilon et al., 1999; Mulatero et al., 1998, 2001). Production of 18OHF requires the 17-hydroxylase activity normally found in the zona fasciculata (and not the zona glomerulosa), as well as the C18 activities of CYP11B2, whose expression is normally limited to the adrenal zona glomerulosa. Specificity in aldosterone and cortisol synthesis is due to the zonal differentiation in the expression of the two isozymes resulting from transcription regulation of the two genes (Rainey, 1999). One of the factors which may play a key role in controlling zonal differentiation is SF-1. Ad4/SF-1 regulatory elements are found in both promoters but SF-1 increases CYP11B1 transcription while it decreases CYP11B2 (Wang et al., 2000; Bassett et al., 2002). Mutations on these regulatory elements or in close proximity may have an influence on the transcription of the genes and permit their ectopic expression. For this reasons we designed primers to analyse the most important regulatory regions of the promoters. However, with the described SSCP protocol, we were not able to detect genetic variations in the regulatory region or in the coding regions of CYP11B1 and CYP11B2, which could explain an elevated synthesis of 18OHF. This does not exclude the presence of genetic variation in non-coding regions, especially further upstream in the promoter. In conclusion, we describe a complete SSCP method for the analysis of the coding regions and promoters of CYP11B2 and CYP11B1. This technique allowed us to detect known polymorphisms as well as a new mutation in the 3 -splice site of exon 8 of CYP11B2, probably due to a gene conversion between CYP11B1 and CYP11B2. This method may be used as a rapid screen to detect mutations in relevant regions of CYP11B1 and CYP11B2 in a large group of patients and the same primers can then be used for the sequencing. Similarly to the DST screening, the presence of increased urinary levels of 18OHF is not sufficient as a biochemical screening test for GRA. Molecular variants in CYP11B1 or CYP11B2, that may explain increased 18OHF production in a subset of patients with hypertension, cannot be ascribed to mutations in the promoter and coding regions of these genes.

Acknowledgements Authors are indebted to Prof. N. Haites in Edinburgh for providing GRA positive sample. This study was supported by grants of the Cloëtta Foundation and the Swiss National Foundation for Scientific Research (No. 3100-58889).

173

References Bassett, M.H., Zhang, Y., Clyne, C., White, P.C., Rainey, W.E., 2002. Differential regulation of aldosterone synthase and 11␤-hydroxylase transcription by steroidogenic factor-1. J. Mol. Endocrinol. 28, 125– 135. Bechtel, S., Belkina, N., Bernhardt, R., 2002. The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme. Eur. J. Biochem. 269, 1118–1127. Bottner, B., Denner, K., Bernhardt, R., 1998. Conferring aldosterone synthesis to human CYP11B1 by replacing key amino acid residues with CYP11B2-specific ones. Eur. J. Biochem. 252, 458–466. Chua, S.C., Szabo, P., Vitek, A., Grzeschik, K.H., John, M., White, P.C., 1987. Cloning of cDNA encoding steroid 11 beta-hydroxylase (P450c11). Proc. Natl. Acad. Sci. U.S.A. 84, 7193–7197. Cover, C.M., Wang, J.M., St Lezin, E., Kurtz, T.W., Mellon, S.H., 1995. Molecular variants in the P450c11AS gene as determinants of aldosterone synthase activity in the Dahl rat model of hypertension. J. Biol. Chem. 270, 16555–16560. Curnow, K.M., Tusie-Luna, M.T., Pascoe, L., Natarajan, R., Gu, J.L., Nadler, J.L., White, P.C., 1991. The product of the CYP11B2 gene is required for aldosterone biosynthesis in the human adrenal cortex. Mol. Endocrinol. 5, 1513–1522. Curnow, K.M., Mulatero, P., Emeric-Blanchouin, N., Aupetit-Faisant, B., Corvol, P., Pascoe, L., 1997. The amino acid substitutions Ser288Gly and Val320Ala convert the cortisol producing enzyme, CYP11B1, into an aldosterone producing enzyme. Nat. Struct. Biol. 4, 32–35. De Matteo, R., May, C.N., Coghlan, J.P., Kurosawa, T., Yoshimura, T., Chiba, H., McDougall, J.G., 1997. Investigation of the mineralocorticoid and hypertensinogenic activity of 18-hydroxycortisol in conscious sheep. Steroids 62, 351–357. Fardella, C.E., Rodriguez, H., Hum, D.W., Mellon, S.H., Miller, W.L., 1995. Artificial mutations in P450c11AS (aldosterone synthase) can increase enzymatic activity: a model for low-renin hypertension? J. Clin. Endocrinol. Metab. 80, 1040–1043. Fardella, C.E., Rodriguez, H., Montero, J., Zhang, G., Vignolo, P., Rojas, A., Villarroel, L., Miller, W.L., 1996. Genetic variation in P450c11AS in Chilean patients with low renin hypertension. J. Clin. Endocrinol. Metab. 81, 4347–4351. Fardella, C.E., Mosso, L., Gomez-Sanchez, C., Cortes, P., Soto, J., Gomez, L., Pinto, M., Huete, A., Oestreicher, E., Foradori, A., Montero, J., 2000. Primary hyperaldosteronism in essential hypertensives: prevalence, biochemical profile, and molecular biology. J. Clin. Endocrinol. Metab. 85, 1863–1867. Fardella, C.E., Pinto, M., Mosso, L., Gomez-Sanchez, C., Jalil, J., Montero, J., 2001. Genetic study of patients with dexamethasone-suppressible aldosteronism without the chimeric CYP11B1/CYP11B2 gene. J. Clin. Endocrinol. Metab. 86, 4805–4807. Ferrari, P., Sansonnens, A., Dick, B., Frey, F.J., 2001. In vivo 11␤HSD-2 activity: variability, salt-sensitivity, and effect of licorice. Hypertension 38, 1330–1336. Fisher, A., Friel, E.C., Bernhardt, R., Gomez-Sanchez, C., Connell, J.M., Fraser, R., Davies, E., 2001. Effects of 18-hydroxylated steroids on corticosteroid production by human aldosterone synthase and 11beta-hydroxylase. J. Clin. Endocrinol. Metab. 86, 4326–4329. Fisher, A., Fraser, R., McConnell, J., Davies, E., 2000. Amino acid residue 147 of human aldosterone synthase and 11beta-hydroxylase plays a key role in 11beta-hydroxylation. J. Clin. Endocrinol. Metab. 85, 1261–1266. Gomez-Sanchez, E.P., Gomez-Sanchez, C.E., Smith, J.S., Ferris, M.W., Foecking, M., 1984a. Receptor binding and biological activity of 18-hydroxycortisol. Endocrinology 115, 462–466. Gomez-Sanchez, C.E., Montgomery, M., Ganguly, A., Holland, O.B., Gomez-Sanchez, E.P., Grim, C.E., Weinberger, M.H., 1984b. Elevated urinary excretion of 18-oxocortisol in glucocorticoid-suppressible aldosteronism. J. Clin. Endocrinol. Metab. 59, 1022–1024.

174

J. Nicod et al. / Molecular and Cellular Endocrinology 214 (2004) 167–174

Gomez-Sanchez, C.E., Gomez-Sanchez, E.P., Holland, O.B., 1987. Role of 18-hydroxylated cortisols in hypertension. J. Steroid. Biochem. 27, 971–975. Irony, I., Kater, C.E., Biglieri, E.G., Shackleton, C.H., 1990. Correctable subsets of primary aldosteronism. Primary adrenal hyperplasia and renin responsive adenoma. Am. J. Hypertens. 3, 576–582. Jamieson, A., Ingram, M.C., Inglis, G.C., Davies, E., Fraser, R., Connell, J.M., 1996. Altered 11␤-hydroxylase activity in glucocorticoid-suppressible hyperaldosteronism. J. Clin. Endocrinol. Metab. 81, 2298–2302. Jonsson, J.R., Klemm, S.A., Tunny, T.J., Stowasser, M., Gordon, R.D., 1995. A new genetic test for familial hyperaldosteronism type I aids in the detection of curable hypertension. Biochem. Biophys. Res. Commun. 207, 565–571. Kawamoto, T., Mitsuuchi, Y., Toda, K., Yokoyama, Y., Miyahara, K., Miura, S., Ohnishi, T., Ichikawa, Y., Nakao, K., Imura, H., et al., 1992. Role of steroid 11␤-hydroxylase and steroid 18-hydroxylase in the biosynthesis of glucocorticoids and mineralocorticoids in humans. Proc. Natl. Acad. Sci. U.S.A. 89, 1458–1462. Kikuchi, E., Yanaihara, H., Nakashima, J., Homma, K., Ohigashi, T., Asakura, H., Tachibana, M., Shibata, H., Saruta, T., Murai, M., 2000. Urinary steroid profile in adrenocortical tumors. Biomed. Pharmacother. 54 (1), 194s–197s. LeHoux, J.G., Dupuis, G., Lefebvre, A., 2000. Regulation of CYP11B2 gene expression by protein kinase C. Endocr. Res. 26, 1027–1031. LeHoux, J.G., Dupuis, G., Lefebvre, A., 2001. Control of CYP11B2 gene expression through differential regulation of its promoter by atypical and conventional protein kinase C isoforms. J. Biol. Chem. 276, 8021– 8028. Liechti-Gallati, S., Schneider, V., Neeser, D., Kraemer, R., 1999. Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease. Eur. J. Hum. Genet. 7, 590–598. Lifton, R.P., Dluhy, R.G., Powers, M., Rich, G.M., Gutkin, M., Fallo, F., Gill Jr., J.R., Feld, L., Ganguly, A., Laidlaw, J.C., et al., 1992. Hereditary hypertension caused by chimaeric gene duplications and ectopic expression of aldosterone synthase. Nat. Genet. 2, 66–74. Lloyd-MacGilp, S.A., Torielli, L., Bechtel, S., Tripodi, G., GomezSanchez, C.E., Zagato, L., Bernhardt, R., Kenyon, C.J., 2002. Mutations in aldosterone synthase gene of Milan hypertensive rats: phenotypic consequences. Am. J. Physiol. Endocrinol. Metab. 282, E608– E617. Lovati, E., Richard, A., Frey, B.M., Frey, F.J., Ferrari, P., 2001. Genetic polymorphisms of the renin-angiotensin-aldosterone system in end-stage renal disease. Kidney Int. 60, 46–54. MacConnachie, A.A., Kelly, K.F., McNamara, A., Loughlin, S., Gates, L.J., Inglis, G.C., Jamieson, A., Connell, J.M., Haites, N.E., 1998. Rapid diagnosis and identification of cross-over sites in patients with glucocorticoid remediable aldosteronism. J. Clin. Endocrinol. Metab. 83, 4328–4331. Miyamori, I., Takeda, Y., Takasaki, H., Itoh, Y., Iki, K., Takeda, R., 1992. Determination of urinary 18-hydroxycortisol in the diagnosis of primary aldosteronism. J. Endocrinol. Invest. 15, 19–24. Mornet, E., Dupont, J., Vitek, A., White, P.C., 1989. Characterization of two genes encoding human steroid 11␤-hydroxylase (P-450(11) beta). J. Biol. Chem. 264, 20961–20967.

Mosso, L., Gomez-Sanchez, C.E., Foecking, M.F., Fardella, C., 2001. Serum 18-hydroxycortisol in primary aldosteronism, hypertension, and normotensives. Hypertension 38, 688–691. Mulatero, P., Veglio, F., Pilon, C., Rabbia, F., Zocchi, C., Limone, P., Boscaro, M., Sonino, N., Fallo, F., 1998. Diagnosis of glucocorticoid-remediable aldosteronism in primary aldosteronism: aldosterone response to dexamethasone and long polymerase chain reaction for chimeric gene. J. Clin. Endocrinol. Metab. 83, 2573– 2575. Mulatero, P., Curnow, K.M., Aupetit-Faisant, B., Foekling, M., Gomez-Sanchez, C., Veglio, F., Jeunemaitre, X., Corvol, P., Pascoe, L., 1998. Recombinant CYP11B genes encode enzymes that can catalyze conversion of 11-deoxycortisol to cortisol, 18-hydroxycortisol, and 18-oxocortisol. J. Clin. Endocrinol. Metab. 83, 3996– 4001. Mulatero, P., Glorioso, N., Fallo, F., Soro, A., Morra di Cella, S., Carra, R., Filigheddu, F., Veglio, F., 2001. Absence of D147E mutation of CYP11B2 gene in hypertensive patients with increased corticosterone and aldosterone production. Eur. J. Endocrinol. 144, 397– 400. Pascoe, L., Curnow, K.M., Slutsker, L., Rosler, A., White, P.C., 1992. Mutations in the human CYP11B2 (aldosterone synthase) gene causing corticosterone methyloxidase II deficiency. Proc. Natl. Acad. Sci. U.S.A. 89, 4996–5000. Pilon, C., Mulatero, P., Barzon, L., Veglio, F., Garrone, C., Boscaro, M., Sonino, N., Fallo, F., 1999. Mutations in CYP11B1 gene converting 11beta-hydroxylase into an aldosterone-producing enzyme are not present in aldosterone-producing adenomas. J. Clin. Endocrinol. Metab. 84, 4228–4231. Portrat-Doyen, S., Tourniaire, J., Richard, O., Mulatero, P., Aupetit-Faisant, B., Curnow, K.M., Pascoe, L., Morel, Y., 1998. Isolated aldosterone synthase deficiency caused by simultaneous E198D and V386A mutations in the CYP11B2 gene. J. Clin. Endocrinol. Metab. 83, 4156–4161. Rainey, W.E., 1999. Adrenal zonation: clues from 11beta-hydroxylase and aldosterone synthase. Mol. Cell Endocrinol. 151, 151–160. Shackleton, C.H., 1986. Profiling steroid hormones and urinary steroids. J. Chromatogr. 379, 91–156. Shizuta, Y., Kawamoto, T., Mitsuuchi, Y., Miyahara, K., Rosler, A., Ulick, S., Imura, H., 1995. Inborn errors of aldosterone biosynthesis in humans. Steroids 60, 15–21. Skinner, C.A., Rumsby, G., Honour, J.W., 1996. Single strand conformation polymorphism (SSCP) analysis for the detection of mutations in the CYP11B1 gene. J. Clin. Endocrinol. Metab. 81, 2389– 2393. Ulick, S., Land, M., Chu, M.D., 1983. 18-Oxocortisol, a naturally occurring mineralocorticoid agonist. Endocrinology 113, 2320–2322. Ulick, S., Blumenfeld, J.D., Atlas, S.A., Wang, J.Z., Vaughan Jr., E.D., 1993. The unique steroidogenesis of the aldosteronoma in the differential diagnosis of primary aldosteronism. J. Clin. Endocrinol. Metab. 76, 873–878. Wang, X.L., Bassett, M., Zhang, Y., Yin, S., Clyne, C., White, P.C., Rainey, W.E., 2000. Transcriptional regulation of human 11␤-hydroxylase (hCYP11B1). Endocrinology 141, 3587–3594. White, P.C., Slutsker, L., 1995. Haplotype analysis of CYP11B2. Endocr. Res. 21, 437–442.