- Email: [email protected]
Effects of dexamethasone on VEGF-induced MUC5AC expression in human primary bronchial epithelial cells: Implications for asthma
Journal Pre-proof Effects of dexamethasone on VEGF-induced MUC5AC expression in human primary bronchial epithelial cells: Implications for asthma Sung-Ho Kim, Qing-Mei Pei, Ping Jiang, Juan Liu, Rong-Fei Sun, Xue-Jiao Qian, Jiang-Bo Liu PII:
S0014-4827(20)30096-3
DOI:
https://doi.org/10.1016/j.yexcr.2020.111897
Reference:
YEXCR 111897
To appear in:
Experimental Cell Research
Received Date: 25 December 2019 Revised Date:
4 February 2020
Accepted Date: 5 February 2020
Please cite this article as: S.-H. Kim, Q.-M. Pei, P. Jiang, J. Liu, R.-F. Sun, X.-J. Qian, J.-B. Liu, Effects of dexamethasone on VEGF-induced MUC5AC expression in human primary bronchial epithelial cells: Implications for asthma, Experimental Cell Research (2020), doi: https://doi.org/10.1016/ j.yexcr.2020.111897. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Inc.
Effects of Dexamethasone on VEGF-induced MUC5AC Expression in Human Primary Bronchial Epithelial Cells: Implications for Asthma
Sung-Ho Kim1, Qing-Mei Pei2, Ping Jiang1, Juan Liu1, Rong-Fei Sun1, Xue-Jiao Qian1 and Jiang-Bo Liu1
1. Department of Respiration, Tianjin First Central Hospital, Tianjin, China 2. Department of Radiology, Tianjin Hospital of Integrated Traditional Chinese and Western Medicine, Tianjin, China.
Qing-Mei, Pei, [email protected] Ping Jiang, [email protected] Juan Liu, [email protected] Rong-Fei Sun, [email protected] Xue-Jiao Qian, [email protected] Jiang-Bo Liu, [email protected]
Correspondence should be addressed to: Sung-Ho Kim, MD, PhD Department of Respiration, Tianjin First Central Hospital
Fukanglu-24, Nankaiqu, Tianjin, 300192, China. E-mail: [email protected] Running title: Dexamethasone downregulates MUC5AC in Primary Bronchial Epithelial Cells
Abstract Mucins are major macromolecular components of lung mucus that are mainly responsible for the viscoelastic property of mucus. MUC5AC is a major mucin glycoprotein that is hypersecreted in asthmatic individuals. Vascular endothelial growth factor (VEGF) has been implicated in inflammatory and airway blood vessel remodeling in asthmatics. Our previous studies indicate that VEGF upregulates MUC5AC expression by interacting with VEGF receptor 2 (VEGFR2). It has been shown that dexamethasone (Dex) downregulates MUC5AC expression; however, the underlying mechanisms have not been completely elucidated. Therefore, we sought to investigate the effect of Dex on MUC5AC expression induced by VEGF and study the underlying mechanisms. We tested the effects of Dex on VEGFR2 and RhoA activation, caveolin-1 expression, and the association of caveolin-1 and VEGFR2 in primary bronchial epithelial cells. Dex downregulated MUC5AC mRNA and protein levels in a dose- and time- dependent manner, and suppressed the activation of VEGFR2 and RhoA induced by VEGF. Additionally, Dex upregulated caveolin-1 protein levels in a dose- and time-dependent manner. Furthermore, phospho-VEGFR2 expression was decreased through overexpression of caveolin-1 and increased after
caveolin-1 knockdown. Dex treatment attenuated the VEGF-decreased association of caveolin-1 and VEGFR2. Collectively, our findings suggest that Dex downregulates VEGF-induced MUC5AC expression by inactivating VEGFR2 and RhoA. Furthermore, decreased MUC5AC expression by Dex was related to the increased association of caveolin-1 with VEGFR2. Further studies characterizing these mechanisms are required to facilitate the development of improved treatment strategies for asthma.
Keywords: dexamethasone, MUC5AC, VEGF, asthma
Introduction Airway
mucus
overproduction
is
now
recognized
as
an
important
pathophysiological feature in asthma. Excessive secretion of airway mucus can generate mucous plugs that lead to impaired respiration and even death in some cases. [1]. Mucins are major components of lung mucus that are primarily responsible for the viscoelastic property of mucus. In asthma, mucins are typically overexpressed, thereby contributing to increased mucus production. MUC5AC, which is secreted mainly from goblet cells, is a major mucin glycoprotein that is known to be overproduced in asthma [2, 3]. It is well-known that vascular endothelial growth factor (VEGF) plays an important role in the pathophysiology of asthma. Studies have shown that VEGF levels are increased in lung tissues and sputum of asthmatic patients, with increased levels positively correlating with asthma disease severity. Furthermore, one study showed a significant reduction in goblet cell hyperplasia and basement membrane thickness following VEGF inhibition [4]. Our previous studies have shown that VEGF can upregulate MUC5AC protein expression in primary bronchial epithelial cells (PBECs) by activating VEGFR2 and RhoA [5]. Glucocorticoids (GCs) are first-line drugs for controlling airway inflammation in asthmatic patients. Dexamethasone (Dex) is a potent synthetic GC which is often used in the treatment of asthma. The regulatory mechanism of GCs on mucus hypersecretion is not clear but is thought to be secondary to their anti-inflammatory properties [6]. It has been demonstrated that Dex inhibits basal and TGF-α- induced
MUC5AC mRNA and protein expression in the lung cancer cell line NCI-H2929 [7, 8]. However, limited information is available regarding the effect of Dex on MUC5AC production induced by stimuli such as VEGF, which mimic airway inflammation in diseases such as asthma. Therefore, in the present study, we aimed to investigate the regulatory effect of Dex on VEGF-induced MUC5AC expression and elucidate the underlying mechanisms. METERIALS AND METHODS Antibodies and reagents Antibodies against MUC5AC, RhoA, phospho-VEGFR2 (Tyr1175), caveolin-1, and VEGFR2 were purchased from cell signaling technology (Danvers, MA). Antibody against β-actin was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The secondary antibodies were obtained from (Jackson Immunoresearch, West Grove, PA). Dex and VEGF were purchased from Sigma-Aldrich (St. Louis, MO). SU1498 was purchased from CalBiochem (La Jolla, CA). RU-486 was purchased from (Selleckchem, Munich, Germany). Cell culture PBECs were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were grown in RPMI-1640 with 10% fetal bovine serum (FBS) and maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air. All inhibitors were dissolved in dimethyl sulfoxide (DMSO; final concentration of 0.1%, vol/vol) and added to the medium. Vehicle controls contained the same amount of DMSO. Real-time reverse transcriptase–PCR
Total RNA was isolated from PBECs using an Easy-BLUE Total RNA Extraction Kit (iNtRON Biotechnologies, Shanghai, China) after exposure to VEGF. Total RNA (2 µg) was reverse transcribed using the oligo (dT) primer and MMLV reverse transcriptase (Promega, Madison, WI) at 42°C for 90 min. Real-time PCR was performed using an ABI Prism 7500 instrument according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA). The following primer pairs were used: MUC5AC, forward 5′- TCTGCAGCGAATCCTACTCG -3′ and reverse, 5′GGTTCTCTTCAATACGGGGG -3′, and GAPDH, forward 5′- GGCCAAAAGG GTCATCATC -3′ and reverse, 5′-GTGATGGCATGGACTGTGG-3′. After an initial hot start for 10 min, amplification was performed for 40 cycles consisting of denaturation for 10 s at 94°C, annealing for 30 s at 56°C, and extension for 40 s at 72°C. The amplification kinetics was recorded as sigmoid progress curves for which fluorescence was plotted against the number of amplification cycles. The threshold cycle number (CT) was used to define the initial amount of each template. The CT was the first cycle for which a detectable fluorescent signal was observed. The mRNA expression levels were determined and compared with the GAPDH standard. Western blot analysis The
cell
extracts
were
separated
by
10%
sodium
dodecyl
sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a nitrocellulose membrane. The membranes were blocked in blocking solution [5% non-fat dried milk in phosphate buffered saline (PBS)] for 2 h at room temperature and then probed with anti-MUC5AC, anti-Rho A, anti-phospho-VEGFR2,
anti-VEGFR2, anti-caveolin-1, and anti-β-actin for 1 h at room temperature. After washing three times in phosphatebuffered saline (PBS) containing 0.1% Tween-20 (PBS-T), the membranes were incubated with secondary antibodies for 1 h at room temperature. After washing an additional three times in PBS-T, the membranes were developed using an electrochemiluminescence (ECL) solution (Pierce, Rockford, IL, USA) and exposed to Kodak X-ray film. Transfection of small interfering RNA (siRNA) Caveolin-1 was transfected into PBECs according to a siRNA transfection protocol provided by Ambion (Austin, TX, USA). Briefly, after culturing PBECs in antibiotic-free RPMI-1640 at 37 C in a humidified atmosphere of 5% CO2 for 24 h, the siRNA duplex solution, which was diluted in siRNA transfection medium (Santa Cruz Biotechnology), was added to the PBECs. After transfection for 24 h, the medium was replaced with normal RPMI-1640, and PBECs were treated with VEGF. Scrambled siRNA, purchased from Santa Cruz Biotechnology, was transfected to PBECs as a negative standard. RhoA activity assays The activity of RhoA was assessed in PBECs by a pull-down assay for GTP-bound RhoA as previously described [9]. GTP-bound RhoA was precipitated from cell lysates with Rhotekin RBD (Upstate Biotechnology, Lake Placid, NY). After whsh the beads, and then the immunoprecipitate was resolved on 15% SDS-PAGE. Using an anti-RhoA antibody to detect active RhoA and total RhoA . Establishment of caveolin-1 overexpressing cell lines
To generate caveolin-1 overexpressing vectors, the caveolin-1-coding sequences were obtained by reverse transcription PCR and cloned into pMXs-based retroviral plasmid (Addgene). PBECs were infected as described [10], to establish caveolin-1 overexpressing PBECs, and PBECs infected with retrovirus containing blank pMXs vector were used as the control group. Immunoprecipitation Immunoprecipitation
and
immunoblotting
with
anti-caveolin-1
and
anti-VEGFR2 antibodies were performed as previously described[11]. After clarification, equal amounts of lysate were incubated overnight with 2 g of primary antibody rotating at 4°C. With the exception of the agarose-conjugated anti-VEGFR-2 and anti-caveolin antibodies, the immune complexes were collected by incubating the mixtures with 25 µl (50% suspension) of Protein A (rabbit primary antibody) or Protein G (mouse primary antibody) Sepharose beads. Immunoprecipitates were extensively washed, resuspended in 2 sample buffer, boiled, and resolved by SDS-PAGE. Statistical analysis All results are expressed as the mean ± SEM. The statistical evaluation of the results was performed by an independent t-test and an ANOVA with a Tukey post-hoc test. The results were significant with a value of p < 0.05. Results Dex significantly decreased VEGF-induced mRNA and protein expression of MUC5AC To evaluate the direct effect of Dex on VEGF-induced mRNA expression of
MUC5AC in PBECs, we performed real-time PCR. When PBECs were pre-treated with increasing doses of Dex at different times before VEGF stimulation, MUC5AC expression was downregulated in a dose- and time- dependent manner (Figure 1A, B). This suggests that Dex directly downregulates VEGF-induced expression of MUC5AC in PBECs. As shown in Figure 1C and D, Dex treatment also downregulated VEGF-induced protein expression of MUC5AC in a dose- and timedependent manner (Figure 1C, D). MUC5AC expression was only slightly affected by Dex alone compared with the group without VEGF challenge. No cytotoxic effect of dexamethasone treatment and/or VEGF stimulation was observed in our experimental conditions (data not shown). Dex inhibited VEGF-induced phosphorylation of VEGFR2 Our previous study demonstrated that VEGF-induced MUC5AC expression is dependent on VEGFR2 and RhoA activity [5]. Accordingly, we explored the effect of Dex on VEGFR2 activation. As shown in Figure 2A, the VEGF-induced phosphorylation of VEGFR2 was markedly attenuated in PBECs pre-treated with Dex. However, downregulation of VEGFR2 phosphorylation and MUC5AC expression were not seen in the presence of RU-486, a GR antagonist (Figure 2B and C). These results indicate that decreased VEGFR2 activation and MUC5AC expression by Dex were accomplished through GR activation. Dex inhibited VEGF-induced RhoA kinase activation To evaluate whether Dex regulated VEGF-induced RhoA kinase activation through VEGFR2 inactivation, we first confirmed the effect of VEGF/VEGFR2 interaction on RhoA kinase activation. When PBECs were pre-treated with various doses of the VEGFR2 inhibitor SU1498 for 2 h before VEGF (50 ng/ml) treatment, we found that VEGF-induced activation of RhoA kinase was markedly suppressed (Figure 3A). Next, we explored the effect of Dex on VEGF-induced RhoA kinase activation. As shown in Figure 3B, VEGF-induced RhoA kinase activation was markedly attenuated in PBECs pre-treated with Dex. However, the suppression of RhoA kinase activation was not observed in the presence of RU-486 (Figure 3B). These results suggest that Dex suppresses the activation of RhoA kinase by activating
GR and downregulating VEGFR2 phosphorylation. Dex upregulated caveolin-1 expression in PBECs It has been reported that Dex can upregulate caveolin-1 protein expression in bovine aortic endothelial cells [9]. Therefore, we performed western blot analysis to evaluate whether Dex also upregulates caveolin-1 expression in PBECs. Interestingly, we found that Dex upregulated caveolin-1 protein expression in PBECs in a dose- and time- dependent manner (Figure 4A, B). Caveolin-1 was a negative regulator of VEGFR-2 activity Our previous study demonstrated that overexpression of caveolin-1 resulted in a marked inhibition of VEGFR-2 activity compared to that in the vector control[5]. We first confirmed the effect of overexpression of caveolin-1 on VEGFR-2 activity (Figure 5A). In addition, to further confirm the inhibitory effect of caveolin-1 on VEGFR-2 activity, we constructed a caveolin-1 siRNA transfection reagent. As shown in Figure 5B, when PBECs were transfected with caveolin-1 siRNA or control siRNA for 48 h in the presence or absence of 50 ng/ml VEGF, VEGF-induced VEGFR-2 activation was increased in caveolin-1 siRNA transfected cells compared to negative control siRNA transfected cells. These data collectively indicate that Dex at least partially inhibits VEGF-induced RhoA activation, MUC5AC upregulation, and VEGFR2 activation by upregulating caveolin-1. VEGFR2 association with caveolin-1 was markedly reduced with VEGF stimulation and reversed by Dex pre-treatment It has been reported that caveolin-1 colocalizes with VEGFR2 on the plasma membrane caveolae in endothelial cells [10, 11]. Our previous study demonstrated that an association has been made between the caveolin-1 and VEGFR2 [5]. We first
confirmed the association between caveolin-1 and VEGFR2. As shown in Figure 6A, in unstimulated PBECs, caveolin-1 protein was detected in anti-VEGFR2 immunoprecipitates from protein extracts. However, the stimulation of PBECs with VEGF induced a rapid, time-dependent dissociation of caveolin-1 from VEGFR2, with complete dissociation 15 min after the addition of VEGF. We also investigated the effects of Dex on the interaction between VEGFR2 and caveolin-1. The VEGFR2/caveolin-1 interaction that was decreased by VEGF was attenuated by pre-treatment with Dex (Figure 6B). However, when cells were treated with the combination of Dex and RU-486, the effect of Dex on the VEGFR2/caveolin-1 interaction was decreased (Figure 6B). These results indicate that under resting and Dex-stimulated conditions, caveolin-1 may act as a negative regulator of VEGFR2 activity and that stimulation of the receptor by VEGF may promote activation of this signaling pathway by inducing the dissociation of VEGFR from the inhibitory action of caveolin-1. Discussion The molecular mechanisms of GCs in the treatment of asthma are not completely understood. An understanding of how GCs regulate mucin gene expression in cells exposed to inflammatory mediators is important because inhaled GCs are used to treat inflammation and mucin overproduction in patients with asthma. MUC5AC is upregulated in response to inflammation of the lungs caused by disorders such as bronchial asthma. Recent studies reported that Dex can downregulate MUC5AC expression induced by transforming growth factor (TGF)-α,
pro-inflammatory cytokines such as IL-1β, and by external agents, such as viruses and LPS [12-15]. However, the mechanisms through which Dex reduces MUC5AC expression in airway epithelial cells have not been fully elucidated. Understanding the regulatory mechanisms of Dex in airway mucus hypersecretion is of potential clinical value and can provide further insights into new treatment strategies of airway diseases such as asthma. Since hypersecretion of mucus is associated with abnormal epithelial cell growth and differentiation, both growth factors and inflammatory mediators may play an important role in the stimulation of mucin production from goblet cells [16]. Therefore, we investigated the regulatory effects of Dex on VEGF-induced MUC5AC expression and relevant signal transduction pathways in human PBECs. Caveolae are flask-shaped plasma membrane invaginations that are abundant in cholesterol and sphingolipids. Caveolin-1 is one of the major structural proteins of the caveolae and plays an important role in the formation and mobility of these structures. Studies have found markedly decreased caveolin-1 levels in endobronchial biopsies of asthmatic patients compared to those in the controls. Specifically, this decrease was most evident in bronchial epithelial cells. Furthermore, studies involving cultured PBECs of asthmatics showed lower caveolin-1 expression compared to that in the control cells [17]. The enzyme Rho-kinase is also associated with airway mucus secretion in patients with asthma. In one study, the Rho-A/Rho kinase inhibitor, fasudil, reduced MUC5AC expression in ovalbumin-challenged mice [18]. In terms of the relationship between Rho and caveolin, Rho activation is increased in smooth muscle following genetic ablation of caveolin-1 [19]. Concurrent with these findings,
our previous studies have shown that caveolae are required for VEGF-induced activation of RhoA [5, 20]. In the present study, we found that Dex downregulated the VEGF-induced RhoA activation and upregulated caveolin-1 expression in PBECs. GCs exert an anti-inflammatory effect through the GC receptor, which binds to GC response elements to regulate the transcription of specific genes [21]. It has been reported that the GC Dex can upregulate caveolin-1 expression in rat-derived lung epithelial cell lines [22]. Specifically, Dex relieves lung injury effectively in a rat model by upregulating the expression of caveolin-1 [23]. Moreover, caveolae formation and caveolin-1 expression are dependent upon Dex in both a primary differentiating rat alveolar culture and the human alveolar cell line A549 [22]. Consistent with this study, we also found that Dex upregulates caveolin-1 expression in PBECs and inhibits VEGF-induced VEGFR2 and RhoA activation, as well as decreases MUC5AC expression. However, because our findings were all derived from in vitro experiments, further studies comprising animal experiments need to be performed to support the direct effect of Dex on VEGF-induced MUC5AC expression and RhoA activation. We focused on VEGF because this angiogenic growth factor is a potent stimulator of angiogenesis in asthma and because VEGFR2 signaling is modulated by caveolae microdomains and caveolin-1 [9, 10]. It has been shown that both VEGFR2 and caveolin-1 are localized on caveolae in several cell lines [10, 11, 24]. Several studies conducted on different receptor tyrosine kinases (RTK) suggest that the important role of caveolin-1 on RTK transportation to late endosome combined with a
decrease in caveolin-1 may result in enhanced growth factor signaling [25, 26]. Recent studies observed that VEGF stimulation can cause a rapid dissociation of caveolin-1 from the inactive form of VEGFR2. This interaction between caveolin-1 and VEGFR2 inhibits VEGFR2 activity [10]. In the present study, we observed an inhibitory effect of Dex and caveolin-1 on VEGF responses. Conversely, knockdown of caveolin-1 with RU-486 treatment counteracted thes attenuation of signaling responses to VEGF induced by Dex. Collectively, these results indicate that the inhibitory effects of Dex are mediated, at least in part, through genomic mechanisms. The following two pathways for VEGFR2 internalization have been proposed: caveolae-mediated endocytosis and clathrin-mediated internalization [27]. The central question of whether or not VEGFR2 uses the caveolar pathway for internalization could not be clearly answered through our present study; therefore, further research is needed to elucidate the signaling mechanisms. Conclusions In conclusion, the present study indicates that pre-treatment with Dex attenuates VEGF-induced MUC5AC expression in PBECs via inhibiting VEGFR2 and RhoA activity. The mechanism through which Dex suppresses MUC5AC expression may involve the upregulation of caveolin-1, which may also promote the suppression of the VEGFR2 signaling pathway. To the best of our knowledge, the current study provides the first evidence regarding the inhibitory role of Dex in VEGF-induced MUC5AC upregulation in bronchial epithelial cells, suggesting an effective therapeutic target in inflammatory diseases such as asthma.
Funding This work was supported by Technology Fund of Tianjin First Central Hospital (Grant No. 2019CM11). Declaration of Competing Interest Authors declare no conflicts of interest in this study Acknowledgements We acknowledge the facilities supported by the Tianjin First Central Hospital. Authors’ contributions Acquisition of data: Q-MP, R-FS, X-JQ, and J-BL. Analysis and interpretation of data: S-HK, PJ. Drafting of manuscript: S-HK
References [1]
D.F. Rogers, P.J. Barnes, Treatment of airway mucus hypersecretion, Ann Med 38 (2006) 116-125.
[2]
Y. Xia, P.C. Cai, F. Yu, L. Xiong, X.L. He, S.S. Rao, F. Chen, X.P. Yang, W.L. Ma, H. Ye, IL-4-induced caveolin-1-containing lipid rafts aggregation contributes to MUC5AC synthesis in bronchial epithelial cells, Respir Res 18 174.
[3]
C.L. Ordonez, R. Khashayar, H.H. Wong, R. Ferrando, R. Wu, D.M. Hyde, J.A. Hotchkiss, Y. Zhang, A. Novikov, G. Dolganov, J.V. Fahy, Mild and moderate asthma is associated with airway goblet cell hyperplasia and abnormalities in mucin gene expression, Am J Respir Crit Care Med 163 (2001) 517-523.
[4]
Q.M. Pei, P. Jiang, M. Yang, X.J. Qian, J.B. Liu, H. Zheng, L.H. Zhao, S.H. Kim, Upregulation of a disintegrin and metalloproteinase-33 by VEGF in human airway smooth muscle cells: Implications for asthma, Cell Cycle 15 2819-2826.
[5]
S.H. Kim, Q.M. Pei, P. Jiang, J. Liu, R.F. Sun, X.J. Qian, J.B. Liu, Upregulation of MUC5AC by VEGF in human primary bronchial epithelial cells: implications for asthma, Respir Res 20 (2019) 282.
[6]
R. Newton, Molecular mechanisms of glucocorticoid action: what is important?, Thorax 55 (2000) 603-613.
[7]
Y. Chen, T.J. Nickola, N.L. DiFronzo, A.M. Colberg-Poley, M.C. Rose, Dexamethasone-mediated
repression of MUC5AC gene expression in human lung epithelial cells, Am J Respir Cell Mol Biol 34 (2006) 338-347. [8]
Y. Nishimoto, A. Hisatsune, H. Katsuki, T. Miyata, K. Yokomizo, Y. Isohama, Glycyrrhizin attenuates mucus production by inhibition of MUC5AC mRNA expression in vivo and in vitro, J Pharmacol Sci 113 76-83.
[9]
J. Igarashi, T. Hashimoto, K. Shoji, K. Yoneda, I. Tsukamoto, T. Moriue, Y. Kubota, H. Kosaka, Dexamethasone induces caveolin-1 in vascular endothelial cells: implications for attenuated responses to VEGF, Am J Physiol Cell Physiol 304 C790-800.
[10]
L. Labrecque, I. Royal, D.S. Surprenant, C. Patterson, D. Gingras, R. Beliveau, Regulation of vascular endothelial growth factor receptor-2 activity by caveolin-1 and plasma membrane cholesterol, Mol Biol Cell 14 (2003) 334-347.
[11]
W.X. Liao, L. Feng, H. Zhang, J. Zheng, T.R. Moore, D.B. Chen, Compartmentalizing VEGF-induced ERK2/1 signaling in placental artery endothelial cell caveolae: a paradoxical role of caveolin-1 in placental angiogenesis in vitro, Mol Endocrinol 23 (2009) 1428-1444.
[12]
S. Takami, T. Mizuno, T. Oyanagi, H. Tadaki, T. Suzuki, K. Muramatsu, T. Takizawa, H. Arakawa, Glucocorticoids inhibit MUC5AC production induced by transforming growth factor-alpha in human respiratory cells, Allergol Int 61 451-459.
[13]
H.P. Hauber, T. Goldmann, E. Vollmer, B. Wollenberg, P. Zabel, Effect of dexamethasone and ACC on bacteria-induced mucin expression in human airway mucosa, Am J Respir Cell Mol Biol 37 (2007) 606-616.
[14]
L. Chen, T. Wang, J.Y. Zhang, S.F. Zhang, D.S. Liu, D. Xu, X. Wang, Y.J. Chen, F.Q. Wen, Toll-like receptor 4 relates to lipopolysaccharide-induced mucus hypersecretion in rat airway, Arch Med Res 40 (2009) 10-17.
[15]
Y. Chen, L.M. Garvin, T.J. Nickola, A.M. Watson, A.M. Colberg-Poley, M.C. Rose, IL-1beta induction of MUC5AC gene expression is mediated by CREB and NF-kappaB and repressed by dexamethasone, Am J Physiol Lung Cell Mol Physiol 306 L797-807.
[16]
M.C. Rose, J.A. Voynow, Respiratory tract mucin genes and mucin glycoproteins in health and disease, Physiol Rev 86 (2006) 245-278.
[17]
S.N. Bains, E. Tourkina, C. Atkinson, K. Joseph, B. Tholanikunnel, H.W. Chu, E.C. Riemer, R. Martin, S. Hoffman, Loss of caveolin-1 from bronchial epithelial cells and monocytes in human subjects with asthma, Allergy 67 1601-1604.
[18]
T. Xie, G. Luo, Y. Zhang, X. Wang, M. Wu, G. Li, Rho-kinase inhibitor fasudil reduces allergic airway inflammation and mucus hypersecretion by regulating STAT6 and NFkappaB, Clin Exp Allergy 45 1812-1822.
[19]
Y. Shakirova, J. Bonnevier, S. Albinsson, M. Adner, B. Rippe, J. Broman, A. Arner, K. Sward, Increased Rho activation and PKC-mediated smooth muscle contractility in the absence of caveolin-1, Am J Physiol Cell Physiol 291 (2006) C1326-1335.
[20]
T. Wu, B. Zhang, F. Ye, Z. Xiao, A potential role for caveolin-1 in VEGF-induced fibronectin upregulation in mesangial cells: involvement of VEGFR2 and Src, Am J Physiol Renal Physiol 304 F820-830.
[21]
M. Wang, P. Gao, X. Wu, Y. Chen, Y. Feng, Q. Yang, Y. Xu, J. Zhao, J. Xie, Impaired anti-inflammatory action of glucocorticoid in neutrophil from patients with steroid-resistant asthma, Respir Res 17 153.
[22]
J. Barar, L. Campbell, A.J. Hollins, N.P. Thomas, M.W. Smith, C.J. Morris, M. Gumbleton, Cell
selective glucocorticoid induction of caveolin-1 and caveolae in differentiating pulmonary alveolar epithelial cell cultures, Biochem Biophys Res Commun 359 (2007) 360-366. [23]
G. Wang, H.L. Chen, F. Ren, J. Li, Y.Q. Li, [Expression of Cav-1, AQP1 and AQP5 in lung of acute pancreatitis-associated lung injury rats and the therapeutic role of Qingyitang], Zhonghua Yi Xue Za Zhi 90 2564-2569.
[24]
C. Casalou, R. Fragoso, J.F. Nunes, S. Dias, VEGF/PLGF induces leukemia cell migration via P38/ERK1/2 kinase pathway, resulting in Rho GTPases activation and caveolae formation, Leukemia 21 (2007) 1590-1594.
[25]
H. Schmidt-Glenewinkel, E. Reinz, S. Bulashevska, J. Beaudouin, S. Legewie, A. Alonso, R. Eils, Multiparametric image analysis reveals role of Caveolin1 in endosomal progression rather than internalization of EGFR, FEBS Lett 586 1179-1189.
[26]
P. Cipriani, P. Di Benedetto, D. Capece, F. Zazzeroni, V. Liakouli, P. Ruscitti, I. Pantano, O. Berardicurti, F. Carubbi, E. Alesse, R. Giacomelli, Impaired Cav-1 expression in SSc mesenchymal cells upregulates VEGF signaling: a link between vascular involvement and fibrosis, Fibrogenesis Tissue Repair 7 13.
[27]
S. Mukherjee, M. Tessema, A. Wandinger-Ness, Vesicular trafficking of tyrosine kinase receptors and associated proteins in the regulation of signaling and vascular function, Circ Res 98 (2006) 743-756.
Figure legends Figure 1. Effects of Dex on VEGF-induced MUC5AC mRNA and protein expression. PBECs were incubated with Dex (10-9 to 10-7 M) for 9 h before VEGF (50 ng/ml) stimulation for 15 min, and then real-time PCR performed. The values are normalized relative to the GAPDH standard (A). PBECs were incubated with Dex (10-7 M) for indicated times before VEGF (50 ng/ml) stimulation for 15 min, and then real-time PCR performed. The values are normalized relative to the GAPDH standard (B). PBECs were incubated with Dex (10-9 to 10-7 M) for 24 h before VEGF (50 ng/ml) stimulation for 15 min, and then western blotting analysis for MUC5AC was performed. β-actin was used as a loading control (C). PBECs were incubated with Dex (10-7 M) for indicated times before VEGF (50 ng/ml) stimulation for 15 min, and then western blotting analysis for MUC5AC was performed. β-actin was used as a loading control (D). All data are representative of three independent experiments. Values represent the means ± SEM. *p < 0.05 versus control; #p < 0.05, versus VEGF alone；n=3.
##
p < 0.01
Figure 2. Effects of Dex on VEGF-induced phospho-VEGFR2 expression. PBECs were incubated with Dex (10-7 M) or vehicle for 24 h before treatment with VEGF (50 ng/ml) for indicated times, and then western blotting analysis for phospho-VEGFR2 was performed. VEGFR2 was used as a loading control. (A). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 24 h before treatment with VEGF (50 ng/ml) for 15 min, and then western blotting analysis for phospho-VEGFR2 was performed. VEGFR2 was used as a loading control. (B). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 24 h before treatment with VEGF (50 ng/ml) for 15 min, and then western blotting analysis for MUC5AC was performed. β-actin was used as a loading control (C). All data are representative of three independent experiments. Values represent the means ± SEM. *p < 0.05 versus control; #p < 0.05 versus VEGF alone；n=3. Figure 3. Effects of Dex on VEGF-induced RhoA/Rho kinase activation. PBECs were incubated with indicated doses of SU1498 for 2 h before treatment with VEGF (50 ng/ml) for 24 h, and then western blotting analysis for RhoA activation was performed. Total RhoA was used as a loading control (A). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 2 h before treatment with VEGF (50 ng/ml) for 24 h and then western blotting analysis for RhoA activation was performed. Total RhoA was used as a loading control (B). All data are representative of three independent experiments. Values represent the means ± SEM. *p < 0.05 versus control; #p < 0.05 versus VEGF alone；n=3. Figure 4. Effects of Dex on caveolin-1 protein expression. PBECs were incubated with various doses of Dex for 24 h, and then western blotting analysis for caveolin-1 was performed. β-actin was used as a loading control (A). PBECs were incubated with Dex (10-7 M) for indicated times, and then western blotting analysis for caveolin-1 was performed. β-actin was used as a loading control (B). All data are representative of three independent experiments. Values represent the means ± SEM. *
p < 0.05 versus control；n=3.
Figure 5. Effects of caveolin-1 on VEGF-induced phospho-VEGFR2 expression. PBECs were transiently transfected with caveolin-1 cDNAs for 48 h before VEGF
treatment for 15 min, and then VEGFR-2 was immuneprecipitated from cell extracts and
phosphorylation
was
monitored
by
Western
blotting
with
an
anti-phospho-VEGFR2 antibody. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (A). PBECs were transfected with either control siRNA or caveolin-1 siRNA for 48 h before VEGF treatment for 15 min, and then VEGFR-2 was immuneprecipitated from cell extracts and phosphorylation was monitored by Western blotting with an anti-phospho-VEGFR2 antibody. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (B). Data was representative of three independent experiments. Figure 6. Effects of VEGF and Dex on the association of VEGFR2 with caveolin-1. PBECs were incubated with VEGF (50 ng/ml) for indicated times, and then VEGFR2 was immunopricipitated from PBECs lysates, and its association with caveolin-1 was assessed by Western blot. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (A). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 2 h before treatment with VEGF (50 ng/ml) for 15 min, and then VEGFR2 was immunopricipitated from PBECs lysates, and its association with caveolin-1 was assessed by Western blot. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (B). All data are representative of three independent experiments.
Dex significantly decreased VEGF-induced mRNA and protein expression of MUC5AC
Dex inhibited VEGF-induced phosphorylation of VEGFR2 a n d RhoA kinase activation Caveolin-1 was a negative regulator of VEGFR-2 activity and association with VEGFR2 was markedly reduced with VEGF stimulation and reversed by Dex pretreatment Collectively, our findings suggest that Dex downregulates VEGF-induced MUC5AC expression by inactivating VEGFR2 and RhoA. Furthermore, decreased MUC5AC expression by Dex was related to the increased association of caveolin-1 with VEGFR2. Further studies characterizing these mechanisms are required to facilitate the development of improved treatment strategies for asthma.
Acquisition of data: Q-MP, R-FS, X-JQ, and J-BL. Analysis and interpretation of data: S-HK, PJ. Drafting of manuscript: S-HK
S0014-4827(20)30096-3
DOI:
https://doi.org/10.1016/j.yexcr.2020.111897
Reference:
YEXCR 111897
To appear in:
Experimental Cell Research
Received Date: 25 December 2019 Revised Date:
4 February 2020
Accepted Date: 5 February 2020
Please cite this article as: S.-H. Kim, Q.-M. Pei, P. Jiang, J. Liu, R.-F. Sun, X.-J. Qian, J.-B. Liu, Effects of dexamethasone on VEGF-induced MUC5AC expression in human primary bronchial epithelial cells: Implications for asthma, Experimental Cell Research (2020), doi: https://doi.org/10.1016/ j.yexcr.2020.111897. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Inc.
Effects of Dexamethasone on VEGF-induced MUC5AC Expression in Human Primary Bronchial Epithelial Cells: Implications for Asthma
Sung-Ho Kim1, Qing-Mei Pei2, Ping Jiang1, Juan Liu1, Rong-Fei Sun1, Xue-Jiao Qian1 and Jiang-Bo Liu1
1. Department of Respiration, Tianjin First Central Hospital, Tianjin, China 2. Department of Radiology, Tianjin Hospital of Integrated Traditional Chinese and Western Medicine, Tianjin, China.
Qing-Mei, Pei, [email protected] Ping Jiang, [email protected] Juan Liu, [email protected] Rong-Fei Sun, [email protected] Xue-Jiao Qian, [email protected] Jiang-Bo Liu, [email protected]
Correspondence should be addressed to: Sung-Ho Kim, MD, PhD Department of Respiration, Tianjin First Central Hospital
Fukanglu-24, Nankaiqu, Tianjin, 300192, China. E-mail: [email protected] Running title: Dexamethasone downregulates MUC5AC in Primary Bronchial Epithelial Cells
Abstract Mucins are major macromolecular components of lung mucus that are mainly responsible for the viscoelastic property of mucus. MUC5AC is a major mucin glycoprotein that is hypersecreted in asthmatic individuals. Vascular endothelial growth factor (VEGF) has been implicated in inflammatory and airway blood vessel remodeling in asthmatics. Our previous studies indicate that VEGF upregulates MUC5AC expression by interacting with VEGF receptor 2 (VEGFR2). It has been shown that dexamethasone (Dex) downregulates MUC5AC expression; however, the underlying mechanisms have not been completely elucidated. Therefore, we sought to investigate the effect of Dex on MUC5AC expression induced by VEGF and study the underlying mechanisms. We tested the effects of Dex on VEGFR2 and RhoA activation, caveolin-1 expression, and the association of caveolin-1 and VEGFR2 in primary bronchial epithelial cells. Dex downregulated MUC5AC mRNA and protein levels in a dose- and time- dependent manner, and suppressed the activation of VEGFR2 and RhoA induced by VEGF. Additionally, Dex upregulated caveolin-1 protein levels in a dose- and time-dependent manner. Furthermore, phospho-VEGFR2 expression was decreased through overexpression of caveolin-1 and increased after
caveolin-1 knockdown. Dex treatment attenuated the VEGF-decreased association of caveolin-1 and VEGFR2. Collectively, our findings suggest that Dex downregulates VEGF-induced MUC5AC expression by inactivating VEGFR2 and RhoA. Furthermore, decreased MUC5AC expression by Dex was related to the increased association of caveolin-1 with VEGFR2. Further studies characterizing these mechanisms are required to facilitate the development of improved treatment strategies for asthma.
Keywords: dexamethasone, MUC5AC, VEGF, asthma
Introduction Airway
mucus
overproduction
is
now
recognized
as
an
important
pathophysiological feature in asthma. Excessive secretion of airway mucus can generate mucous plugs that lead to impaired respiration and even death in some cases. [1]. Mucins are major components of lung mucus that are primarily responsible for the viscoelastic property of mucus. In asthma, mucins are typically overexpressed, thereby contributing to increased mucus production. MUC5AC, which is secreted mainly from goblet cells, is a major mucin glycoprotein that is known to be overproduced in asthma [2, 3]. It is well-known that vascular endothelial growth factor (VEGF) plays an important role in the pathophysiology of asthma. Studies have shown that VEGF levels are increased in lung tissues and sputum of asthmatic patients, with increased levels positively correlating with asthma disease severity. Furthermore, one study showed a significant reduction in goblet cell hyperplasia and basement membrane thickness following VEGF inhibition [4]. Our previous studies have shown that VEGF can upregulate MUC5AC protein expression in primary bronchial epithelial cells (PBECs) by activating VEGFR2 and RhoA [5]. Glucocorticoids (GCs) are first-line drugs for controlling airway inflammation in asthmatic patients. Dexamethasone (Dex) is a potent synthetic GC which is often used in the treatment of asthma. The regulatory mechanism of GCs on mucus hypersecretion is not clear but is thought to be secondary to their anti-inflammatory properties [6]. It has been demonstrated that Dex inhibits basal and TGF-α- induced
MUC5AC mRNA and protein expression in the lung cancer cell line NCI-H2929 [7, 8]. However, limited information is available regarding the effect of Dex on MUC5AC production induced by stimuli such as VEGF, which mimic airway inflammation in diseases such as asthma. Therefore, in the present study, we aimed to investigate the regulatory effect of Dex on VEGF-induced MUC5AC expression and elucidate the underlying mechanisms. METERIALS AND METHODS Antibodies and reagents Antibodies against MUC5AC, RhoA, phospho-VEGFR2 (Tyr1175), caveolin-1, and VEGFR2 were purchased from cell signaling technology (Danvers, MA). Antibody against β-actin was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The secondary antibodies were obtained from (Jackson Immunoresearch, West Grove, PA). Dex and VEGF were purchased from Sigma-Aldrich (St. Louis, MO). SU1498 was purchased from CalBiochem (La Jolla, CA). RU-486 was purchased from (Selleckchem, Munich, Germany). Cell culture PBECs were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were grown in RPMI-1640 with 10% fetal bovine serum (FBS) and maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air. All inhibitors were dissolved in dimethyl sulfoxide (DMSO; final concentration of 0.1%, vol/vol) and added to the medium. Vehicle controls contained the same amount of DMSO. Real-time reverse transcriptase–PCR
Total RNA was isolated from PBECs using an Easy-BLUE Total RNA Extraction Kit (iNtRON Biotechnologies, Shanghai, China) after exposure to VEGF. Total RNA (2 µg) was reverse transcribed using the oligo (dT) primer and MMLV reverse transcriptase (Promega, Madison, WI) at 42°C for 90 min. Real-time PCR was performed using an ABI Prism 7500 instrument according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA). The following primer pairs were used: MUC5AC, forward 5′- TCTGCAGCGAATCCTACTCG -3′ and reverse, 5′GGTTCTCTTCAATACGGGGG -3′, and GAPDH, forward 5′- GGCCAAAAGG GTCATCATC -3′ and reverse, 5′-GTGATGGCATGGACTGTGG-3′. After an initial hot start for 10 min, amplification was performed for 40 cycles consisting of denaturation for 10 s at 94°C, annealing for 30 s at 56°C, and extension for 40 s at 72°C. The amplification kinetics was recorded as sigmoid progress curves for which fluorescence was plotted against the number of amplification cycles. The threshold cycle number (CT) was used to define the initial amount of each template. The CT was the first cycle for which a detectable fluorescent signal was observed. The mRNA expression levels were determined and compared with the GAPDH standard. Western blot analysis The
cell
extracts
were
separated
by
10%
sodium
dodecyl
sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a nitrocellulose membrane. The membranes were blocked in blocking solution [5% non-fat dried milk in phosphate buffered saline (PBS)] for 2 h at room temperature and then probed with anti-MUC5AC, anti-Rho A, anti-phospho-VEGFR2,
anti-VEGFR2, anti-caveolin-1, and anti-β-actin for 1 h at room temperature. After washing three times in phosphatebuffered saline (PBS) containing 0.1% Tween-20 (PBS-T), the membranes were incubated with secondary antibodies for 1 h at room temperature. After washing an additional three times in PBS-T, the membranes were developed using an electrochemiluminescence (ECL) solution (Pierce, Rockford, IL, USA) and exposed to Kodak X-ray film. Transfection of small interfering RNA (siRNA) Caveolin-1 was transfected into PBECs according to a siRNA transfection protocol provided by Ambion (Austin, TX, USA). Briefly, after culturing PBECs in antibiotic-free RPMI-1640 at 37 C in a humidified atmosphere of 5% CO2 for 24 h, the siRNA duplex solution, which was diluted in siRNA transfection medium (Santa Cruz Biotechnology), was added to the PBECs. After transfection for 24 h, the medium was replaced with normal RPMI-1640, and PBECs were treated with VEGF. Scrambled siRNA, purchased from Santa Cruz Biotechnology, was transfected to PBECs as a negative standard. RhoA activity assays The activity of RhoA was assessed in PBECs by a pull-down assay for GTP-bound RhoA as previously described [9]. GTP-bound RhoA was precipitated from cell lysates with Rhotekin RBD (Upstate Biotechnology, Lake Placid, NY). After whsh the beads, and then the immunoprecipitate was resolved on 15% SDS-PAGE. Using an anti-RhoA antibody to detect active RhoA and total RhoA . Establishment of caveolin-1 overexpressing cell lines
To generate caveolin-1 overexpressing vectors, the caveolin-1-coding sequences were obtained by reverse transcription PCR and cloned into pMXs-based retroviral plasmid (Addgene). PBECs were infected as described [10], to establish caveolin-1 overexpressing PBECs, and PBECs infected with retrovirus containing blank pMXs vector were used as the control group. Immunoprecipitation Immunoprecipitation
and
immunoblotting
with
anti-caveolin-1
and
anti-VEGFR2 antibodies were performed as previously described[11]. After clarification, equal amounts of lysate were incubated overnight with 2 g of primary antibody rotating at 4°C. With the exception of the agarose-conjugated anti-VEGFR-2 and anti-caveolin antibodies, the immune complexes were collected by incubating the mixtures with 25 µl (50% suspension) of Protein A (rabbit primary antibody) or Protein G (mouse primary antibody) Sepharose beads. Immunoprecipitates were extensively washed, resuspended in 2 sample buffer, boiled, and resolved by SDS-PAGE. Statistical analysis All results are expressed as the mean ± SEM. The statistical evaluation of the results was performed by an independent t-test and an ANOVA with a Tukey post-hoc test. The results were significant with a value of p < 0.05. Results Dex significantly decreased VEGF-induced mRNA and protein expression of MUC5AC To evaluate the direct effect of Dex on VEGF-induced mRNA expression of
MUC5AC in PBECs, we performed real-time PCR. When PBECs were pre-treated with increasing doses of Dex at different times before VEGF stimulation, MUC5AC expression was downregulated in a dose- and time- dependent manner (Figure 1A, B). This suggests that Dex directly downregulates VEGF-induced expression of MUC5AC in PBECs. As shown in Figure 1C and D, Dex treatment also downregulated VEGF-induced protein expression of MUC5AC in a dose- and timedependent manner (Figure 1C, D). MUC5AC expression was only slightly affected by Dex alone compared with the group without VEGF challenge. No cytotoxic effect of dexamethasone treatment and/or VEGF stimulation was observed in our experimental conditions (data not shown). Dex inhibited VEGF-induced phosphorylation of VEGFR2 Our previous study demonstrated that VEGF-induced MUC5AC expression is dependent on VEGFR2 and RhoA activity [5]. Accordingly, we explored the effect of Dex on VEGFR2 activation. As shown in Figure 2A, the VEGF-induced phosphorylation of VEGFR2 was markedly attenuated in PBECs pre-treated with Dex. However, downregulation of VEGFR2 phosphorylation and MUC5AC expression were not seen in the presence of RU-486, a GR antagonist (Figure 2B and C). These results indicate that decreased VEGFR2 activation and MUC5AC expression by Dex were accomplished through GR activation. Dex inhibited VEGF-induced RhoA kinase activation To evaluate whether Dex regulated VEGF-induced RhoA kinase activation through VEGFR2 inactivation, we first confirmed the effect of VEGF/VEGFR2 interaction on RhoA kinase activation. When PBECs were pre-treated with various doses of the VEGFR2 inhibitor SU1498 for 2 h before VEGF (50 ng/ml) treatment, we found that VEGF-induced activation of RhoA kinase was markedly suppressed (Figure 3A). Next, we explored the effect of Dex on VEGF-induced RhoA kinase activation. As shown in Figure 3B, VEGF-induced RhoA kinase activation was markedly attenuated in PBECs pre-treated with Dex. However, the suppression of RhoA kinase activation was not observed in the presence of RU-486 (Figure 3B). These results suggest that Dex suppresses the activation of RhoA kinase by activating
GR and downregulating VEGFR2 phosphorylation. Dex upregulated caveolin-1 expression in PBECs It has been reported that Dex can upregulate caveolin-1 protein expression in bovine aortic endothelial cells [9]. Therefore, we performed western blot analysis to evaluate whether Dex also upregulates caveolin-1 expression in PBECs. Interestingly, we found that Dex upregulated caveolin-1 protein expression in PBECs in a dose- and time- dependent manner (Figure 4A, B). Caveolin-1 was a negative regulator of VEGFR-2 activity Our previous study demonstrated that overexpression of caveolin-1 resulted in a marked inhibition of VEGFR-2 activity compared to that in the vector control[5]. We first confirmed the effect of overexpression of caveolin-1 on VEGFR-2 activity (Figure 5A). In addition, to further confirm the inhibitory effect of caveolin-1 on VEGFR-2 activity, we constructed a caveolin-1 siRNA transfection reagent. As shown in Figure 5B, when PBECs were transfected with caveolin-1 siRNA or control siRNA for 48 h in the presence or absence of 50 ng/ml VEGF, VEGF-induced VEGFR-2 activation was increased in caveolin-1 siRNA transfected cells compared to negative control siRNA transfected cells. These data collectively indicate that Dex at least partially inhibits VEGF-induced RhoA activation, MUC5AC upregulation, and VEGFR2 activation by upregulating caveolin-1. VEGFR2 association with caveolin-1 was markedly reduced with VEGF stimulation and reversed by Dex pre-treatment It has been reported that caveolin-1 colocalizes with VEGFR2 on the plasma membrane caveolae in endothelial cells [10, 11]. Our previous study demonstrated that an association has been made between the caveolin-1 and VEGFR2 [5]. We first
confirmed the association between caveolin-1 and VEGFR2. As shown in Figure 6A, in unstimulated PBECs, caveolin-1 protein was detected in anti-VEGFR2 immunoprecipitates from protein extracts. However, the stimulation of PBECs with VEGF induced a rapid, time-dependent dissociation of caveolin-1 from VEGFR2, with complete dissociation 15 min after the addition of VEGF. We also investigated the effects of Dex on the interaction between VEGFR2 and caveolin-1. The VEGFR2/caveolin-1 interaction that was decreased by VEGF was attenuated by pre-treatment with Dex (Figure 6B). However, when cells were treated with the combination of Dex and RU-486, the effect of Dex on the VEGFR2/caveolin-1 interaction was decreased (Figure 6B). These results indicate that under resting and Dex-stimulated conditions, caveolin-1 may act as a negative regulator of VEGFR2 activity and that stimulation of the receptor by VEGF may promote activation of this signaling pathway by inducing the dissociation of VEGFR from the inhibitory action of caveolin-1. Discussion The molecular mechanisms of GCs in the treatment of asthma are not completely understood. An understanding of how GCs regulate mucin gene expression in cells exposed to inflammatory mediators is important because inhaled GCs are used to treat inflammation and mucin overproduction in patients with asthma. MUC5AC is upregulated in response to inflammation of the lungs caused by disorders such as bronchial asthma. Recent studies reported that Dex can downregulate MUC5AC expression induced by transforming growth factor (TGF)-α,
pro-inflammatory cytokines such as IL-1β, and by external agents, such as viruses and LPS [12-15]. However, the mechanisms through which Dex reduces MUC5AC expression in airway epithelial cells have not been fully elucidated. Understanding the regulatory mechanisms of Dex in airway mucus hypersecretion is of potential clinical value and can provide further insights into new treatment strategies of airway diseases such as asthma. Since hypersecretion of mucus is associated with abnormal epithelial cell growth and differentiation, both growth factors and inflammatory mediators may play an important role in the stimulation of mucin production from goblet cells [16]. Therefore, we investigated the regulatory effects of Dex on VEGF-induced MUC5AC expression and relevant signal transduction pathways in human PBECs. Caveolae are flask-shaped plasma membrane invaginations that are abundant in cholesterol and sphingolipids. Caveolin-1 is one of the major structural proteins of the caveolae and plays an important role in the formation and mobility of these structures. Studies have found markedly decreased caveolin-1 levels in endobronchial biopsies of asthmatic patients compared to those in the controls. Specifically, this decrease was most evident in bronchial epithelial cells. Furthermore, studies involving cultured PBECs of asthmatics showed lower caveolin-1 expression compared to that in the control cells [17]. The enzyme Rho-kinase is also associated with airway mucus secretion in patients with asthma. In one study, the Rho-A/Rho kinase inhibitor, fasudil, reduced MUC5AC expression in ovalbumin-challenged mice [18]. In terms of the relationship between Rho and caveolin, Rho activation is increased in smooth muscle following genetic ablation of caveolin-1 [19]. Concurrent with these findings,
our previous studies have shown that caveolae are required for VEGF-induced activation of RhoA [5, 20]. In the present study, we found that Dex downregulated the VEGF-induced RhoA activation and upregulated caveolin-1 expression in PBECs. GCs exert an anti-inflammatory effect through the GC receptor, which binds to GC response elements to regulate the transcription of specific genes [21]. It has been reported that the GC Dex can upregulate caveolin-1 expression in rat-derived lung epithelial cell lines [22]. Specifically, Dex relieves lung injury effectively in a rat model by upregulating the expression of caveolin-1 [23]. Moreover, caveolae formation and caveolin-1 expression are dependent upon Dex in both a primary differentiating rat alveolar culture and the human alveolar cell line A549 [22]. Consistent with this study, we also found that Dex upregulates caveolin-1 expression in PBECs and inhibits VEGF-induced VEGFR2 and RhoA activation, as well as decreases MUC5AC expression. However, because our findings were all derived from in vitro experiments, further studies comprising animal experiments need to be performed to support the direct effect of Dex on VEGF-induced MUC5AC expression and RhoA activation. We focused on VEGF because this angiogenic growth factor is a potent stimulator of angiogenesis in asthma and because VEGFR2 signaling is modulated by caveolae microdomains and caveolin-1 [9, 10]. It has been shown that both VEGFR2 and caveolin-1 are localized on caveolae in several cell lines [10, 11, 24]. Several studies conducted on different receptor tyrosine kinases (RTK) suggest that the important role of caveolin-1 on RTK transportation to late endosome combined with a
decrease in caveolin-1 may result in enhanced growth factor signaling [25, 26]. Recent studies observed that VEGF stimulation can cause a rapid dissociation of caveolin-1 from the inactive form of VEGFR2. This interaction between caveolin-1 and VEGFR2 inhibits VEGFR2 activity [10]. In the present study, we observed an inhibitory effect of Dex and caveolin-1 on VEGF responses. Conversely, knockdown of caveolin-1 with RU-486 treatment counteracted thes attenuation of signaling responses to VEGF induced by Dex. Collectively, these results indicate that the inhibitory effects of Dex are mediated, at least in part, through genomic mechanisms. The following two pathways for VEGFR2 internalization have been proposed: caveolae-mediated endocytosis and clathrin-mediated internalization [27]. The central question of whether or not VEGFR2 uses the caveolar pathway for internalization could not be clearly answered through our present study; therefore, further research is needed to elucidate the signaling mechanisms. Conclusions In conclusion, the present study indicates that pre-treatment with Dex attenuates VEGF-induced MUC5AC expression in PBECs via inhibiting VEGFR2 and RhoA activity. The mechanism through which Dex suppresses MUC5AC expression may involve the upregulation of caveolin-1, which may also promote the suppression of the VEGFR2 signaling pathway. To the best of our knowledge, the current study provides the first evidence regarding the inhibitory role of Dex in VEGF-induced MUC5AC upregulation in bronchial epithelial cells, suggesting an effective therapeutic target in inflammatory diseases such as asthma.
Funding This work was supported by Technology Fund of Tianjin First Central Hospital (Grant No. 2019CM11). Declaration of Competing Interest Authors declare no conflicts of interest in this study Acknowledgements We acknowledge the facilities supported by the Tianjin First Central Hospital. Authors’ contributions Acquisition of data: Q-MP, R-FS, X-JQ, and J-BL. Analysis and interpretation of data: S-HK, PJ. Drafting of manuscript: S-HK
References [1]
D.F. Rogers, P.J. Barnes, Treatment of airway mucus hypersecretion, Ann Med 38 (2006) 116-125.
[2]
Y. Xia, P.C. Cai, F. Yu, L. Xiong, X.L. He, S.S. Rao, F. Chen, X.P. Yang, W.L. Ma, H. Ye, IL-4-induced caveolin-1-containing lipid rafts aggregation contributes to MUC5AC synthesis in bronchial epithelial cells, Respir Res 18 174.
[3]
C.L. Ordonez, R. Khashayar, H.H. Wong, R. Ferrando, R. Wu, D.M. Hyde, J.A. Hotchkiss, Y. Zhang, A. Novikov, G. Dolganov, J.V. Fahy, Mild and moderate asthma is associated with airway goblet cell hyperplasia and abnormalities in mucin gene expression, Am J Respir Crit Care Med 163 (2001) 517-523.
[4]
Q.M. Pei, P. Jiang, M. Yang, X.J. Qian, J.B. Liu, H. Zheng, L.H. Zhao, S.H. Kim, Upregulation of a disintegrin and metalloproteinase-33 by VEGF in human airway smooth muscle cells: Implications for asthma, Cell Cycle 15 2819-2826.
[5]
S.H. Kim, Q.M. Pei, P. Jiang, J. Liu, R.F. Sun, X.J. Qian, J.B. Liu, Upregulation of MUC5AC by VEGF in human primary bronchial epithelial cells: implications for asthma, Respir Res 20 (2019) 282.
[6]
R. Newton, Molecular mechanisms of glucocorticoid action: what is important?, Thorax 55 (2000) 603-613.
[7]
Y. Chen, T.J. Nickola, N.L. DiFronzo, A.M. Colberg-Poley, M.C. Rose, Dexamethasone-mediated
repression of MUC5AC gene expression in human lung epithelial cells, Am J Respir Cell Mol Biol 34 (2006) 338-347. [8]
Y. Nishimoto, A. Hisatsune, H. Katsuki, T. Miyata, K. Yokomizo, Y. Isohama, Glycyrrhizin attenuates mucus production by inhibition of MUC5AC mRNA expression in vivo and in vitro, J Pharmacol Sci 113 76-83.
[9]
J. Igarashi, T. Hashimoto, K. Shoji, K. Yoneda, I. Tsukamoto, T. Moriue, Y. Kubota, H. Kosaka, Dexamethasone induces caveolin-1 in vascular endothelial cells: implications for attenuated responses to VEGF, Am J Physiol Cell Physiol 304 C790-800.
[10]
L. Labrecque, I. Royal, D.S. Surprenant, C. Patterson, D. Gingras, R. Beliveau, Regulation of vascular endothelial growth factor receptor-2 activity by caveolin-1 and plasma membrane cholesterol, Mol Biol Cell 14 (2003) 334-347.
[11]
W.X. Liao, L. Feng, H. Zhang, J. Zheng, T.R. Moore, D.B. Chen, Compartmentalizing VEGF-induced ERK2/1 signaling in placental artery endothelial cell caveolae: a paradoxical role of caveolin-1 in placental angiogenesis in vitro, Mol Endocrinol 23 (2009) 1428-1444.
[12]
S. Takami, T. Mizuno, T. Oyanagi, H. Tadaki, T. Suzuki, K. Muramatsu, T. Takizawa, H. Arakawa, Glucocorticoids inhibit MUC5AC production induced by transforming growth factor-alpha in human respiratory cells, Allergol Int 61 451-459.
[13]
H.P. Hauber, T. Goldmann, E. Vollmer, B. Wollenberg, P. Zabel, Effect of dexamethasone and ACC on bacteria-induced mucin expression in human airway mucosa, Am J Respir Cell Mol Biol 37 (2007) 606-616.
[14]
L. Chen, T. Wang, J.Y. Zhang, S.F. Zhang, D.S. Liu, D. Xu, X. Wang, Y.J. Chen, F.Q. Wen, Toll-like receptor 4 relates to lipopolysaccharide-induced mucus hypersecretion in rat airway, Arch Med Res 40 (2009) 10-17.
[15]
Y. Chen, L.M. Garvin, T.J. Nickola, A.M. Watson, A.M. Colberg-Poley, M.C. Rose, IL-1beta induction of MUC5AC gene expression is mediated by CREB and NF-kappaB and repressed by dexamethasone, Am J Physiol Lung Cell Mol Physiol 306 L797-807.
[16]
M.C. Rose, J.A. Voynow, Respiratory tract mucin genes and mucin glycoproteins in health and disease, Physiol Rev 86 (2006) 245-278.
[17]
S.N. Bains, E. Tourkina, C. Atkinson, K. Joseph, B. Tholanikunnel, H.W. Chu, E.C. Riemer, R. Martin, S. Hoffman, Loss of caveolin-1 from bronchial epithelial cells and monocytes in human subjects with asthma, Allergy 67 1601-1604.
[18]
T. Xie, G. Luo, Y. Zhang, X. Wang, M. Wu, G. Li, Rho-kinase inhibitor fasudil reduces allergic airway inflammation and mucus hypersecretion by regulating STAT6 and NFkappaB, Clin Exp Allergy 45 1812-1822.
[19]
Y. Shakirova, J. Bonnevier, S. Albinsson, M. Adner, B. Rippe, J. Broman, A. Arner, K. Sward, Increased Rho activation and PKC-mediated smooth muscle contractility in the absence of caveolin-1, Am J Physiol Cell Physiol 291 (2006) C1326-1335.
[20]
T. Wu, B. Zhang, F. Ye, Z. Xiao, A potential role for caveolin-1 in VEGF-induced fibronectin upregulation in mesangial cells: involvement of VEGFR2 and Src, Am J Physiol Renal Physiol 304 F820-830.
[21]
M. Wang, P. Gao, X. Wu, Y. Chen, Y. Feng, Q. Yang, Y. Xu, J. Zhao, J. Xie, Impaired anti-inflammatory action of glucocorticoid in neutrophil from patients with steroid-resistant asthma, Respir Res 17 153.
[22]
J. Barar, L. Campbell, A.J. Hollins, N.P. Thomas, M.W. Smith, C.J. Morris, M. Gumbleton, Cell
selective glucocorticoid induction of caveolin-1 and caveolae in differentiating pulmonary alveolar epithelial cell cultures, Biochem Biophys Res Commun 359 (2007) 360-366. [23]
G. Wang, H.L. Chen, F. Ren, J. Li, Y.Q. Li, [Expression of Cav-1, AQP1 and AQP5 in lung of acute pancreatitis-associated lung injury rats and the therapeutic role of Qingyitang], Zhonghua Yi Xue Za Zhi 90 2564-2569.
[24]
C. Casalou, R. Fragoso, J.F. Nunes, S. Dias, VEGF/PLGF induces leukemia cell migration via P38/ERK1/2 kinase pathway, resulting in Rho GTPases activation and caveolae formation, Leukemia 21 (2007) 1590-1594.
[25]
H. Schmidt-Glenewinkel, E. Reinz, S. Bulashevska, J. Beaudouin, S. Legewie, A. Alonso, R. Eils, Multiparametric image analysis reveals role of Caveolin1 in endosomal progression rather than internalization of EGFR, FEBS Lett 586 1179-1189.
[26]
P. Cipriani, P. Di Benedetto, D. Capece, F. Zazzeroni, V. Liakouli, P. Ruscitti, I. Pantano, O. Berardicurti, F. Carubbi, E. Alesse, R. Giacomelli, Impaired Cav-1 expression in SSc mesenchymal cells upregulates VEGF signaling: a link between vascular involvement and fibrosis, Fibrogenesis Tissue Repair 7 13.
[27]
S. Mukherjee, M. Tessema, A. Wandinger-Ness, Vesicular trafficking of tyrosine kinase receptors and associated proteins in the regulation of signaling and vascular function, Circ Res 98 (2006) 743-756.
Figure legends Figure 1. Effects of Dex on VEGF-induced MUC5AC mRNA and protein expression. PBECs were incubated with Dex (10-9 to 10-7 M) for 9 h before VEGF (50 ng/ml) stimulation for 15 min, and then real-time PCR performed. The values are normalized relative to the GAPDH standard (A). PBECs were incubated with Dex (10-7 M) for indicated times before VEGF (50 ng/ml) stimulation for 15 min, and then real-time PCR performed. The values are normalized relative to the GAPDH standard (B). PBECs were incubated with Dex (10-9 to 10-7 M) for 24 h before VEGF (50 ng/ml) stimulation for 15 min, and then western blotting analysis for MUC5AC was performed. β-actin was used as a loading control (C). PBECs were incubated with Dex (10-7 M) for indicated times before VEGF (50 ng/ml) stimulation for 15 min, and then western blotting analysis for MUC5AC was performed. β-actin was used as a loading control (D). All data are representative of three independent experiments. Values represent the means ± SEM. *p < 0.05 versus control; #p < 0.05, versus VEGF alone；n=3.
##
p < 0.01
Figure 2. Effects of Dex on VEGF-induced phospho-VEGFR2 expression. PBECs were incubated with Dex (10-7 M) or vehicle for 24 h before treatment with VEGF (50 ng/ml) for indicated times, and then western blotting analysis for phospho-VEGFR2 was performed. VEGFR2 was used as a loading control. (A). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 24 h before treatment with VEGF (50 ng/ml) for 15 min, and then western blotting analysis for phospho-VEGFR2 was performed. VEGFR2 was used as a loading control. (B). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 24 h before treatment with VEGF (50 ng/ml) for 15 min, and then western blotting analysis for MUC5AC was performed. β-actin was used as a loading control (C). All data are representative of three independent experiments. Values represent the means ± SEM. *p < 0.05 versus control; #p < 0.05 versus VEGF alone；n=3. Figure 3. Effects of Dex on VEGF-induced RhoA/Rho kinase activation. PBECs were incubated with indicated doses of SU1498 for 2 h before treatment with VEGF (50 ng/ml) for 24 h, and then western blotting analysis for RhoA activation was performed. Total RhoA was used as a loading control (A). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 2 h before treatment with VEGF (50 ng/ml) for 24 h and then western blotting analysis for RhoA activation was performed. Total RhoA was used as a loading control (B). All data are representative of three independent experiments. Values represent the means ± SEM. *p < 0.05 versus control; #p < 0.05 versus VEGF alone；n=3. Figure 4. Effects of Dex on caveolin-1 protein expression. PBECs were incubated with various doses of Dex for 24 h, and then western blotting analysis for caveolin-1 was performed. β-actin was used as a loading control (A). PBECs were incubated with Dex (10-7 M) for indicated times, and then western blotting analysis for caveolin-1 was performed. β-actin was used as a loading control (B). All data are representative of three independent experiments. Values represent the means ± SEM. *
p < 0.05 versus control；n=3.
Figure 5. Effects of caveolin-1 on VEGF-induced phospho-VEGFR2 expression. PBECs were transiently transfected with caveolin-1 cDNAs for 48 h before VEGF
treatment for 15 min, and then VEGFR-2 was immuneprecipitated from cell extracts and
phosphorylation
was
monitored
by
Western
blotting
with
an
anti-phospho-VEGFR2 antibody. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (A). PBECs were transfected with either control siRNA or caveolin-1 siRNA for 48 h before VEGF treatment for 15 min, and then VEGFR-2 was immuneprecipitated from cell extracts and phosphorylation was monitored by Western blotting with an anti-phospho-VEGFR2 antibody. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (B). Data was representative of three independent experiments. Figure 6. Effects of VEGF and Dex on the association of VEGFR2 with caveolin-1. PBECs were incubated with VEGF (50 ng/ml) for indicated times, and then VEGFR2 was immunopricipitated from PBECs lysates, and its association with caveolin-1 was assessed by Western blot. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (A). PBECs were incubated with Dex (10-7 M) and/or RU-486 (1 µM) for 2 h before treatment with VEGF (50 ng/ml) for 15 min, and then VEGFR2 was immunopricipitated from PBECs lysates, and its association with caveolin-1 was assessed by Western blot. Actin in the supernatant was probed to ensure equal immunoprecipitation across conditions (B). All data are representative of three independent experiments.
Dex significantly decreased VEGF-induced mRNA and protein expression of MUC5AC
Dex inhibited VEGF-induced phosphorylation of VEGFR2 a n d RhoA kinase activation Caveolin-1 was a negative regulator of VEGFR-2 activity and association with VEGFR2 was markedly reduced with VEGF stimulation and reversed by Dex pretreatment Collectively, our findings suggest that Dex downregulates VEGF-induced MUC5AC expression by inactivating VEGFR2 and RhoA. Furthermore, decreased MUC5AC expression by Dex was related to the increased association of caveolin-1 with VEGFR2. Further studies characterizing these mechanisms are required to facilitate the development of improved treatment strategies for asthma.
Acquisition of data: Q-MP, R-FS, X-JQ, and J-BL. Analysis and interpretation of data: S-HK, PJ. Drafting of manuscript: S-HK