Effects of dietary soybean isoflavones on non-specific immune responses and hepatic antioxidant abilities and mRNA expression of two heat shock proteins (HSPs) in juvenile golden pompano Trachinotus ovatus under pH stress

Fish & Shellfish Immunology 47 (2015) 1043e1053

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Effects of dietary soybean isoflavones on non-specific immune responses and hepatic antioxidant abilities and mRNA expression of two heat shock proteins (HSPs) in juvenile golden pompano Trachinotus ovatus under pH stress Chuanpeng Zhou a, b, *, Heizhao Lin a, c, **, Zhong Huang a, c, Jun Wang a, Yun Wang a, Wei Yu a, c a Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture, The South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, PR China b Guangdong Provincial Key Laboratory of Applied Marine Biology, PR China c Shenzhen Base of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 August 2015 Received in revised form 19 October 2015 Accepted 23 October 2015 Available online 28 October 2015

This study determined the effect of dietary soybean isoflavones on non-specific immunity and on mRNA expression of two HSPs in juvenile golden pompano Trachinotus ovatus under pH stress. Six diets were formulated to contain 0, 10, 20, 40, 60 and 80 mg/kg of soybean isoflavones. Each diet was fed to triplicate groups of fish in cylindrical tanks. After 56 days of feeding, 15 fish per tank were exposed to pH stress (pH z 9.2) for 24 h. Serum total protein (TP), respiratory burst activity (RBA), alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (AKP), lysozyme (LYZ), complement 3 (C3), complement 4 (C4), cortisol, hepatic total antioxidant capacity (T-AOC), superoxide dismutase (SOD), malondialdehyde (MDA), catalase (CAT) and the relative mRNA expression of heat shock protein 70 (HSP70) and 90 (HSP90) were investigated. The results showed that after pH stress, serum TP, RBA, LYZ, C4, hepatic T-AOC and CAT levels were significantly reduced (P < 0.05) while serum ALT, hepatic MDA and HSP70 and HSP90 mRNA expression levels were significantly increased (P < 0.05). On the other hand, supplementation with soybean isoflavones significantly reduced levels of serum ALT (20, 40, 60 mg/kg soybean isoflavones groups) and hepatic MDA (40, 60 and 80 mg/kg soybean isoflavones groups). Supplemented groups had increased serum TP content (40 mg/kg soybean isoflavones groups), RBA (20 and 40 mg/kg soybean isoflavones groups), LYZ (40 and 60 mg/kg soybean isoflavones groups), C3(20, 40, 60 and 80 mg/kg soybean isoflavones groups), hepatic SOD activity (40, 60 and 80 mg/kg soybean isoflavones groups) as well as increased relative mRNA expression of hepatic HSP70 (40, 60 and 80 mg/kg soybean isoflavones groups) and HSP90 (40 and 60 mg/kg soybean isoflavones groups) (P < 0.05). These results indicate that ingestion of a basal diet supplemented with 40e60 mg/kg soybean isoflavones could enhance resistance against pH stress in T. Ovatus to some degree. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Trachinotus ovatus Soybean isoflavones Non-specific immune responses Hepatic antioxidant abilities HSPs mRNA expression pH stress

1. Introduction Fish are exposed to stressors (e.g., environmental pollutants, extreme conditions or changes in water quality parameters, handling, transport, stocking density, invasion of bacteria and viruses) both in the wild and in artificial conditions such as in the

* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (C. Zhou), [email protected] (H. Lin). http://dx.doi.org/10.1016/j.fsi.2015.10.036 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

laboratory or in aquaculture [1e3]. All the adverse factors cause a stress response in fish [1]. In mariculture ponds, pH levels fluctuate from 7.3 to 8.4 because of carbon dioxide consumption [4e6]. High pH levels cause a stress response in fish, leading to oxidative stress [7], slow growth [8], disturbances in electrolytic balance [9,10] and a decrease in survival rate [11], which are sometimes accompanied by serious disease or even mass mortality [12]. Isoflavones are a class of molecules called flavonoids that belong to a large family of polyphenols [13], which are structurally similar to natural estrogens and known to exert several estrogen-like biological effects in animals [14]. It plays an important role in

1044

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

antiestrogenic [15], antioxidant effects [16], anti-inflammatory effects [17,18], anticancer [19], cardioprotective [20], enzymeinhibitory effects [21], antifungal effect [22], enhancing nonspecific immunes [23e25] and anti-stress [26]. Golden pompano (Trachinotus ovatus) is an economically important warm-water farmed marine fish species in southern China [27,28]. However, in recent years, there was an increase in disease in T. ovatus especially diseases caused by stress. Various immunostimulants (i.g., levamisole, glucan, glucan plus vitamin C, yeast RNA, lipopolisaccharide, growth hormone, zeranol and kitosan) have been widely used in aquaculture, and their stimulating effects on disease and stress resistance have been documented [1,29e40]. In previous study, we evaluated the effect of different levels of dietary soybean isoflavones on growth, innate immune responses, hepatic antioxidant abilities and disease resistance of T. ovatus. Our results indicated that weight gain and specific rate increased with the level of dietary soybean isoflavones increasing. For optimal WG, the minimum dietary soybean isoflavones level was 40 mg/kg [28]. However, to date, no information has been published that investigates the effect of dietary soybean isoflavones on the anti-pH stress response for T. ovatus. Therefore, we sought to determine the effect of soybean isoflavones on non-specific immune responses, hepatic antioxidant abilities and two HSPs genes expressions in juvenile T. ovatus under high pH stress conditions (pH z 9.2), which would provide some suggestions for prevention of disease and alleviation of stress. 2. Materials and methods 2.1. Fish, soybean isoflavones (SI), and diet We obtained 450 healthy juvenile T. ovatus that were of similar size (mean weight 15.69 ± 0.03 g) from the Shenzhen Experimental Station of South China Sea Fisheries Research Institute of Chinese Academy of Fishery Sciences, China. The fish were placed in 18 sea cages (1.0 m
1.0 m
1.0 m, N ¼ 25 fish/cage) and were acclimated for 14 days. Following acclimation, we randomly divided the 18 sea cages into six groups (N ¼ 3 cages/group): the control group was fed a basic diet (Table 1) and five treatment groups were fed a basal diet supplemented with 15.7, 25.6, 45.9, 65.8 and 85.2 mg/kg of soybean isoflavones, respectively. The basal diet was formulated to contain about 43.05% crude protein and 9.45% lipid. Six diets were formulated to contain 0.0, 10.0, 20.0, 40.0, 60.0 and 80.0 mg soybean isoflavones (SI, purity, 98%, Shaanxi Sciphar Hi-tech Industry Co., Ltd., China) per kg, respectively. However, the analyzed Soybean isoflavones levels were 5.4, 15.7, 25.6, 45.9, 65.8 and 85.2 mg/kg for the six diets, which were determined by high-performance liquid chromatography (LC-20A, Shimadzu, Japan) with an ODS column (4.6
250 mm, 5 mm). The mobile phase (flow rate 1.0 ml/min) was 45% methanol (Shanghai Reagent, Shanghai, China), the effluent was monitored by a UV-detector (wave length ¼ 260 nm) [41,42]. The test diets were prepared by thoroughly mixing the dry ingredients with oil and then adding cold distilled water until a stiff dough resulted. The feed was then pelleted into 1 mm granular feed using a pelletizer (Institute of Chemical Engineering, South China University of Technology, Guangzhou, China) and then air-dried, sealed in plastic bags and stored frozen at 20  C until used. 2.2. Rearing management We cultured the fish in the sea cages. The fish were fed by hand twice daily (08:00 h and 16:00 h) at a rate of 3.0%e4.0% wet body weight during the experiment. The amount of feed was adjusted

Table 1 Formulation and composition of experimental diet. Ingredients

(%)

Proximate composition

(%)

Fish meala Soy protein concentrate Corn starch Microcrystalline cellulose Carboxyl-methyl cellulose Fish oil Calcium biphosphate Vitamin mixtureb Mineral mixturec Choline chloride Lecithin

40.00 25.00 16.80 6.20 2.00 6.00 1.00 1.00 1.00 0.50 0.50

Crude protein Crude lipid Ash Gross energy (MJ kg1)d

43.05 9.45 8.81 16.79

a White fishmeal was north pacific white fishmeal and purchased from American Seafoods Company, Seattle, Washington, USA. b Mineral premix (mg or g kg1 diet): NaF, 2 mg; KI, 0.8 mg; CoCl2$6H2O (1%), 50 mg; CuSO4$5H2O, 10 mg; FeSO4$H2O, 80 mg; ZnSO4$H2O, 50 mg; MnSO4$H2O, 60 mg; MgSO4$7H2O, 1200 mg; Ca(H2PO4)2$H2O, 3000 mg; NaCl, 100 mg; zoelite, 15.447 g (Niu et al., 2013). c Vitamin premix (mg or g kg1 diet): thiamin, 25 mg; riboflavin, 45 mg; pyridoxine HCl, 20 mg; vitamin B12, 0.1 mg; vitamin K3,10 mg; inositol, 800 mg; pantothenic acid, 60 mg; niacin acid, 200 mg; folic acid, 20 mg; biotin, 1.20 mg; retinal acetate, 32 mg; cholecalciferol, 5 mg; a-tocopherol, 120 mg; ascorbic acid, 2000 mg; choline chloride, 2500 mg; ethoxyquin 150 mg; wheat middling, 14.012 g (Niu et al., 2013). d Gross energy were calculated using energy equivalents 23.64, 39.54, and 17.15 kJ g1 for protein, lipid and digestible carbohydrate, respectively.

every two weeks to account for increasing body weight. During the experiment, we measured the water temperature at 8:00 and 16:00 each day and checked the water quality once a week. The mean water quality indices were: water temperature ranged from 27  C to 31  C, DO > 6 mg L1, ammonia nitrogen <0.05 mg L1, and pH 7.40e8.00. After 56 days, fish from each cage were counted and weighed. 2.3. pH challenge experiment At the end of the rearing experiment, 20 fish of similar size were sampled from each cage and subjected to a pH stress (high pH level: 9.2) test for 24 h in cylindrical tanks (500-L) with running water after the first sampling (0 h), according to the methods described in Li and Chen (2008). Water temperature ranged from 27  C to 29  C, and the flow rate was 2.2 L/min, DO > 6 mg L1, ammonia nitrogen <0.05 mg L1. Adding 4 N NaOH (Manufacturer: Tianjin Yongda Chemical Reagent Company limited, China) adjusted the water pH level. During the stress experiment, there was no feeding and minimal human interference to prevent additional stress. 2.4. Sampling and processing At the end of the rearing experiment, blood samples were collected from three fish per tank before stress (0 h) and on hours 3, 6, 12 or 24 after high pH stress, respectively. Fish were netted quickly and anesthetized with diluted eugenol (1: 10000; Shanghai Reagent Corp., China), and then blood was sampled from the caudal vein using a 2 mL heparinized syringes. Blood samples were collected into anticoagulation tubes in order to obtain serum. After collection, 50 ml whole blood was used for analysis of respiratory burst activity. The remaining whole blood was centrifuged (3000
g at 4  C for 10 min) to obtain serum (stored at 20  C for further analysis). The abdominal cavity of fish was cut open immediately after blood collection. About 0.1 g of liver was frozen in liquid nitrogen and stored at 80  C for determination of gene expression. Another piece of liver was stored at 20  C to measure antioxidant ability.

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

2.5. Analysis and measurement 2.5.1. Serum total protein (TP), respiratory burst activity (RBA) measurement Serum TP content was tested by ROCHE-P800 automatic biochemical analyzer (Roche, Basel, Switzerland). The RBA of phagocytes was determined by the nitro-blue-tetrazolium (NBT; Sigma, USA) assay described in previous study [43] with some modifications by Kumari and Sahoo, (2005) [44]. Dimethylformamide was used as the blank, and the optical density of supernatant was measured at 540 nm. 2.5.2. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) measurement Serum ALT, AST and AKP activities were all tested by ROCHEP800 automatic biochemical analyzer (Roche, Basel, Switzerland) [45,46]. 2.5.3. Serum lysozyme (LYZ), complement 3 (C3) and complement 4 (C4) measurement The LYZ activity was measured using turbidimetric assay according to the method in previous study [47]. The serum C3 and C4 levels were determined using immune turbidimetric method described in our previous study [27]. 2.5.4. Hepatic total antioxidative capacity (T-AOC), superoxide dismutase (SOD), malondialdehyde (MDA) and catalase (CAT) measurement Hepatic samples were homogenized in ice-cold phosphate buffer (1:10 dilution) (phosphate buffer: 0.064 M, pH 6.4). The homogenate was then centrifuged for 20 min (4  C, 3000
g) and aliquots of the supernatant were used to quantify hepatic T-AOC, SOD, MDA and CAT. T-AOC was measured by the method described in the other study using commercial kits (Jiancheng Institute of Biotechnology, Nanjing, China) [48]. SOD activity and MDA content were measured using a xanthine oxides [49] and barbituric acid reaction chronometry [50], respectively. CAT activity was determined by the decomposition of hydrogen peroxide [51]. We measured the hepatopancreas protein content using the Folin method [52], with bovine serum albumin as the standard. 2.5.5. Real-time PCR measurement of hepatic HSP70 and HSP90 Total RNA was extracted from liver tissues of T. ovatus using RNAiso Plus (Takara Co. Ltd. Dalian, China) according to the manufacturer's protocol, the quality of total RNA was detected by electrophoresis on 1% agarose gel. We generated cDNA from 500 ng DNase-treated RNA using ExScript™ RT-PCR Kit (Takara). The reverse transcription-PCR reaction conditions were as follows: 37  C for 15 min, 85  C for 5 s, and 4  C thereafter. Each of the samples contained six independent individuals respectively to eliminate the individual differences. b-Actin was amplified as an internal control using primers b-Actin-F and bActin-R, while HSP70-F and HSP70-R, HSP90-F and HSP90-R were used to amplify HSP70 and HSP90, respectively (Table 2). All primers were synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China). They amplified a single PCR product with the expected size as determined by agarose gel electrophoresis analysis. The PCR products were 123e152 bp long. We used real-time PCR to determine mRNA levels with an SYBR Green I fluorescence kit. Real-time PCR was performed in a Mini Opticon Real-Time Detector (Bio-Rad, USA). The fluorescent quantitative PCR reaction solution consisted of 12.5 mL SYBR® premix Ex Taq™ (2
), 0.5 mL PCR Forward Primer (10 mM), 0.5 mL PCR Reverse Primer (10 mM), 2.0 mL RT reaction mix (cDNA solution), 9.5 mL dH2O. The reaction conditions were as follows: 95  C for 2 min,

1045

Table 2 Sequences of primers used in this study. Primers

Sequence (50 e30 )

HSP70-F HSP70-R HSP90-F HSP90-R b-Actin-F b-Actin-R

TTGAGGAGGCTGCGCACAGCTTGTG ACGTCCAGCAGCAGCAGGTCCT GATGAAAAGGCGTTTGAGAAAATGAT TGTTGCAGGCTTGATG TTGAGTACAC TACGAGCTGCCTGACGGACA GGCTGTGATCTCCTTCTGC

followed by 45 cycles consisting of 95  C for 10 s, 60  C for 20 s, and 72  C for 20 s. The florescent flux was then recorded and the reaction continued at 72  C for 3 min. We measured the dissolution rate between 65 and 92  C. Each increase of 0.2  C was maintained for 1 s and the fluorescent flux was recorded. We calculated the relative quantification of the target genes transcript (HSP70 and HSP90) with a chosen reference gene transcript (b-Actin) using the 2DDCT method [53]. This mathematical algorithm computes an expression ratio based on real-time PCR efficiency and the crossing point deviation of the sample versus a control. We measured the PCR efficiency by constructing a standard curve using a serial dilution of cDNA; DDCT ¼ (CT, Target  CT, b-Actin) time x  (CT, Target  CT, b-Actin) time 0. 2.6. Data statistics and analysis Statistical analysis was performed using SPSS 19.0 (SPSS Inc., Michigan Avenue, Chicago, IL, USA) for Windows. Data were expressed as mean ± SEM and subjected to a one-way ANOVA followed by Duncan's multiple range test. P < 0.05 was considered to be significant.

3. Results 3.1. The effect of soybean isoflavones on serum TP and RBA in juvenile T. ovatus Fig. 1A showed that serum TP levels in all groups decreased under pH stress. Before stress (0 h), the TP level in fish fed a diet with 40 mg/kg soybean isoflavones was significantly higher than that of the control (P < 0.05). After pH stress, the TP level in fish fed the 40 mg/kg soybean isoflavones diet was still significantly higher than that of the control group 3 h, 6 h, 12 h and 24 h after pH stress (P < 0.05), respectively. Serum TP levels in fish fed the 20 and 60 mg/kg soybean isoflavones diets were significantly higher than those of the control group 12 h and 24 h after pH stress (P < 0.05), respectively. Serum TP levels in fish fed diets with 10 and 80 mg/kg soybean isoflavones were significantly higher than those of the control group 24 h after pH stress (P < 0.05). Under pH stress, RBA levels in all groups tended to increase at first and then decrease (Fig. 1B). Before stress, the RBA level in fish fed a diet with 40 mg/kg soybean isoflavones was significantly higher than that of the control (P < 0.05). After pH stress, the RBA level in fish fed the 40 mg/kg soybean isoflavones diet was still significantly higher than that of the control group 3 h, 12 h and 24 h after pH stress (P < 0.05), respectively. Serum RBA level in fish fed the 60 mg/kg soybean isoflavones diet was significantly higher than that of the control group 3 h and 24 h after pH stress (P < 0.05), respectively. Serum RBA level in fish fed diet with 80 mg/kg soybean isoflavones was significantly higher than those of the control group 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05).

1046

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

Fig. 1. Effect of various levels of isoflavones on serum total protein content (A), respiratory burst activity (B) of juvenile T. Ovatus under pH stress. Notes: Different capital letters above the bars indicate significant differences (P < 0.05) at different time points in the same group in Duncan's test; different small letters above the bars indicate significant differences (P < 0.05) in different groups of the same point in Duncan's test; data are expressed as mean ± SEM (n ¼ 9); the same below.

3.2. The effect of soybean isoflavones on serum ALT, AST and AKP on juvenile T. ovatus Fig. 2A indicated that serum ALT activity in all groups increased under pH stress. Before pH stress, the differences among the ALT levels of all groups were not significant (P > 0.05). After stress, the ALT activity in fish fed the 80 mg/kg soybean isoflavones group was significantly higher than that of the control 6 h, 12 h and 24 h after pH stress, respectively (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). Serum AST activity in all groups also increased under pH stress (Fig. 2B). Before stress, the AST activity in fish fed diets with 10 and 20 mg/kg soybean isoflavones was significantly lower than that of the control, while the AST activity in fish fed a diet with 80 mg/kg soybean isoflavones was significantly higher than that of the control (P < 0.05). After stress, the AST activities in fish fed the 20 and 40 mg/kg soybean isoflavones diets were significantly higher than those of the control 3 h, 6 h, 12 h and 24 h after pH stress, respectively. AST activity in fish fed the 60 mg/kg soybean isoflavones diet was significantly higher than that of the control 6 h, 12 h and 24 h after pH stress (P < 0.05), respectively. AST activity in fish fed the 80 mg/kg soybean isoflavones diet was significantly higher than that of the control 3 h and 6 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). Serum AKP activity in all groups declined under pH stress

(Fig. 2C). Before stress, the AKP level in fish fed a diet with 60 mg/kg soybean isoflavones was significantly higher than that of the control (P < 0.05). After pH stress, the AKP activity in fish fed the 40 mg/ kg soybean isoflavones group was significantly higher than that of the control 6 h and 24 h after pH stress (P < 0.05), respectively. AKP activity in fish fed diet with 60 mg/kg soybean isoflavones was significantly higher than that of the control 3 h, 6 h, 12 h and 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). 3.3. The effect of soybean isoflavones on serum LYZ, C3 and C4 in juvenile T. ovatus Fig. 3A showed that serum LYZ activity in all groups decreased under pH stress. Before stress, the LYZ levels in fish fed diets with 40, 60 and 80 mg/kg soybean isoflavones were significantly higher than those of the control (P < 0.05). After pH stress, the LYZ activity in fish fed the 40 mg/kg soybean isoflavones group was significantly higher than that of the control 3 h, 6 h, 12 h and 24 h after pH stress (P < 0.05), respectively. LYZ activity in fish fed diet with 60 mg/kg soybean isoflavones was significantly higher than that of the control 3 h and 6 h after pH stress (P < 0.05). LYZ activity in fish fed diet with 80 mg/kg soybean isoflavones was significantly higher than that of the control 3 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). Fig. 3B indicated that serum C3 content in juvenile T. ovatus in all

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

1047

Fig. 2. Effect of various levels of isoflavones on serum ALT (A), AST (B) and AKP (C) of juvenile T. Ovatus under pH stress. Note: Legends are the same as in Fig. 1.

groups decreased under pH stress. Before pH stress, the C3 content in fish fed the diet with 40 mg/kg soybean isoflavones was significantly higher than that in other groups (P < 0.05). After stress, the C3 content in fish fed the 20, 40, 60 and 80 mg/kg soybean isoflavones diets were significantly higher than those of the control 3 h, 6 h, 12 h and 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). Serum C4 content in all groups also decreased under pH stress (Fig. 3C). Before stress, the differences among the C4 contents of all groups were not significant (P > 0.05). After stress, the C4 content in

fish fed the 40 mg/kg soybean isoflavones diet was significantly higher than that of the control 3 h, 6 h and 12 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). 3.4. The effect of soybean isoflavones on hepatic anti-oxidization enzyme activity in juvenile T. ovatus As shown in Fig. 4A, hepatic T-AOC levels in all groups decreased under pH stress. Before pH stress, the T-AOC level in fish fed a diet with 40 mg/kg of soybean isoflavones was significantly higher than

1048

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

Fig. 3. Effect of various levels of isoflavones on serum LYZ (A), C3 (B) and C4 (C) of juvenile T. Ovatus under pH stress. Note: Legends are the same as in Fig. 1.

that of the control (P < 0.05). After stress, the T-AOC level in fish fed the 20 mg/kg soybean isoflavones diet was significantly higher than that of the control 6 h and 24 h after pH stress. T-AOC level in fish fed the 40 mg/kg soybean isoflavones diet was significantly higher than that of the control 3 h, 6 h, 12 h and 24 h after pH stress. T-AOC level in fish fed the 60 mg/kg soybean isoflavones diet was significantly higher than that of the control 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). Fig. 4B indicated that hepatic SOD activity in all groups decreased under pH stress, similar to the change of T-AOC. Before

stress, SOD activities in fish fed the 40, 60 and 80 mg/kg soybean isoflavones diets were significantly higher than those of the control (P < 0.05). After stress, the SOD activity in fish fed the 40 mg/kg soybean isoflavones diet was significantly higher than that of the control 12 h and 24 h after pH stress. SOD activity in fish fed the 60 mg/kg soybean isoflavones diet was significantly higher than that of the control 3 h, 6 h, 12 h and 24 h after pH stress. SOD activity in fish fed the 80 mg/kg soybean isoflavones diet was significantly higher than that of the control 12 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05).

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

1049

Fig. 4. Effect of various levels of isoflavones on hepatic T-AOC (A), SOD (B), MDA (C) and CAT (D) of juvenile T. Ovatus under pH stress. Note: Legends are the same as in Fig. 1.

Under pH stress, hepatic MDA content in all groups tended to increase at first and then decrease (Fig. 4C). Before stress, MDA contents in fish fed the 40, 60 and 80 mg/kg soybean isoflavones diets were significantly lower than those of the control (P < 0.05). After stress, the hepatic MDA content in fish fed the diet with 20 mg/kg of soybean isoflavones was significantly lower than that of the control 3 h after pH stress. MDA content in fish fed the diets with 40, 60 and 80 mg/kg of soybean isoflavones were significantly lower than those of the control 3 h, 6 h, 12 h and 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). It can be seen in Fig. 4D that hepatic CAT activity in all groups decreased under pH stress. Before stress, CAT activities in fish fed the 10, 20, 40 and 60 mg/kg soybean isoflavones diets were significantly higher than those of the control (P < 0.05). After stress, compared with the control group, the CAT activity in fish fed the diet with 40 mg/kg soybean isoflavones increased significantly 12 h and 24 h after pH stress. The CAT activity in fish fed the 10, 20, 60 and 80 mg/kg soybean isoflavones diets increased significantly 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05).

higher than that of the control 3 h, 6 h, 12 h and 24 h after pH stress. The expression levels of HSP70 mRNA in the fish fed the 80 mg/kg soybean isoflavones diet was significantly higher than that of the control 24 h after pH stress (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05). The expression levels of hepatic HSP90 mRNA in all groups also appeared to increase at first and then decrease under pH stress, similar to the change in HSP70 (Fig. 5B). Before stress, the HSP90 mRNA expression levels in the fish fed diets with 20, 40, 60 and 80 mg/kg soybean isoflavones was higher than those of the other groups (P < 0.05). After stress, the expression level of HSP90 mRNA in fish fed the 40 mg/kg soybean isoflavones diet was significantly higher than those of the control by hour 3, hour 6, hour 12 and hour 24. On the other hand, 3 h and 24 h after pH stress, the expression level of HSP90 mRNA in the fish fed the diet with 60 mg/kg soybean isoflavones was significantly higher than that of the control (P < 0.05), while the difference between the other treatments and the control group was not significant (P > 0.05).

3.5. The effect of soybean isoflavones on the relative level of hepatic HSP70 and HSP90 mRNA in juvenile T. ovatus

Stress is the sum of a series of non-specific responses produced by self-regulation of organisms (such as fish, shrimp, shellfish, etc.) against various stressors from exogenous or endogenous sources to reach a new dynamic balance [54]. In response to most stressors, fish will elicit a generalized physiological stress response, which involves the activation of the hypothalamic-pituitary-interrenal axis (HPI) [3]. As in other vertebrates, stressed fish exhibit a generalized stress response that is characterized by changes at the physiological, biochemical and organismal levels as well as an increase in stress hormones [1,55]. Since serum biochemical parameters are usually kept stable despite normal environmental variations, which are important in evaluating the health of many organisms [56,57]. Their disturbance is a good indicator of altered

Fig. 5A showed that under pH stress, the expression levels of hepatic HSP70 mRNA in all groups tended to increase at first and then decrease. Before stress, the HSP70 mRNA expression levels in the fish fed diets with 40, 60 and 80 mg/kg of soybean isoflavones were significantly higher than those of the control and 10 mg/kg of soybean isoflavones group (P < 0.05). After pH stress, the HSP70 mRNA expression level in the fish fed the 40 mg/kg soybean isoflavones diet was significantly higher than that of the control 3 h, 12 h and 24 h after pH stress. HSP70 mRNA expression level in the fish fed the 60 mg/kg soybean fisoflavones diet was significantly

4. Discussion

1050

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

Fig. 5. Effect of various levels of isoflavones on relative expression levels of hepatic HSP70 (A) and HSP90 (B) mRNA of juvenile T. Ovatus under pH stress. Note: Legends are the same as in Fig. 1.

physiological state of fish in aquaculture [58e60]. Serum proteins are the most important compounds, with albumin and globulin being the major serum proteins [61,62]. Serum TP is involved in maintaining normal osmotic pressure, constant pH, and the transport of lipid acids and bilirubin. Therefore, it is often used as an indicator of a fish's response to stress and health [63,64]. Respiratory burst ability, the release of reactive oxygen species (ROS) by phagocytes, is a crucial step in the innate immune and antioxidant responses and an important mechanism by which potential pathogens and parasites are eliminated following phagocytosis [65]. An important microbicidal response of phagocytes is the production of ROS [66]. In previous study on three Indian major carps, serum TP levels at pH 9.0 were significantly lower than those of the control (pH 7.4) [67]. In juvenile Wuchang bream (Megalobrama amblycephala) under ammonia stress, the levels of respiratory burst ability in the treated groups were higher than that of the control in different levels [68]. Similarly, in this study, the supplemented diet (especially for the 40 mg/kg soybean isoflavones diet) could effectively increase serum TP and RBA levels in fish under pH stress. This indicated that soybean isoflavones could enhance the immunity of fish under stress. ALT is one of ubiquitous aminotransferases in the mitochondrion of fish and an important parameter for diagnosis of hepatopancreas function and damage [54,69,70]. AKP is an important regulative enzyme which has been associated with different essential functions in all living organisms [54]. Therefore, they are often used as indicators of response to stress and health in fish [64]. Previous study indicated that ALT activity in Nile tilapia (Oreochromis niloticus L.) fingerlings increased significantly under high

density stress [71]. The AKP activity of Drosophila virilis has been shown to decrease upon heat stress [72]. Rao (2007) observed that AKP activity at high pH (pH ¼ 8.5) was significantly lower than that of the control in Anodonta woodiana [73]. Similarly, in this study, the supplemented diet (especially for the 40 and 60 mg/kg soybean isoflavones diets) could effectively decrease serum ALT levels and increase serum AKP levels in fish under pH stress. This suggested that soybean isoflavones could protect the hepatopancreas function and increase defensive potential under stress, which was similar to reports from previous studies [26,74]. The innate immune system of fish is considered to be the first line of defence against a broad spectrum of pathogens and is more important for fish as compared with mammals [28]. Lysozyme is an important component of the immune defense in fish species, which is wildly used as humoral immune indicators in fish [27,75,76]. Stress would cause the increase of haemolymph lysozyme [77,78] or the decrease of haemolymph lysozyme activity [33,79,80]. The red seabream (Pagrus major) fed with Chinese herbs [81] and common carp (Cyprinus carpio jian) fed with anthraquinone extract [82] showed the increase of blood lysozyme activities under the stress. The haemolymph lysozyme activities of Wuchang bream (M. amblycephala) significantly increased in the treated groups supplemented with 0.1% and 0.4% anthraquinone extract before stress and in the treated group supplemented with 0.4% anthraquinone extract at 12 h after high temperature stress compared to the control [54]. Similarly, in this study, the supplemented diet (especially for the 40e80 mg/kg soybean isoflavones diets) could effectively increase serum LYZ levels in fish under pH stress. This indicated that soybean isoflavones might enhance the immune

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053

ability of T. ovatus to some degree. Complement plays an essential role in alerting the host immune system of the presence of potential pathogens as well as their clearance, which is initiated by one or a combination of three pathways, namely, the classical, lectin and alternative [83,84]. All three pathways merge at a common amplification step involving C3, and proceed through a terminal pathway that leads to the formation of a membrane attack complex, which can directly lyse pathogenic cells [83]. C4 is a key component of both classical and lectin pathways [83]. Since complement is down-regulated in many situations of stress, it has been proposed that complement activity could be a good indicator of fish immunocompetence in stressed animals [85]. In the gilthead seabream (Sparus aurata L.), reported that short-term crowding stress induced an immediate depressive effect on serum complement activity [86]. Similarly, other stressors could also significantly decrease complement activity in fish [87,88]. In this study, all groups under pH stress showed a similar trend for serum C3 and C4 level. The complement activity of fish serum has been reported to be significantly enhanced by oral administration of immunostimulants-supplemented diets [75,89e91]. In our study, serum C3 and C4 activity in the soybean isoflavones treated groups were significantly higher than that of the control in juvenile Trachinotus ovaus under pH stress. These findings suggested the stimulating effect on stress-resistance of soybean isoflavones in fish. The non-specific defense mechanisms of fish include neutrophil activation, production of peroxidase and oxidative free radicals, and initiation of other inflammatory factors [92]. The stress response might also impact antioxidants (such as T-AOC and levels of CAT, SOD, and MDA) [54,93], which constitute the first line of enzymatic defence mechanism against free radicals in organisms [94]. The serum T-AOC, SOD and CAT activity of Chinese mitten crab after pH stress (pH9.0e9.5) presented the trend of declining afterward [95]. In Fenneropenaeus chinensis, SOD activity was significantly decreased 3 days after pH stress (pH 9.0e9.2) [96]. Similarly, Li and Chen (2008) reported that SOD activity was significantly decreased 6e24 days after pH stress (pH 10.1) occurred in white shrimp (Litopenaeus vannamei) [12]. In this study, hepatic T-AOC, SOD and CAT levels tended to decrease after pH stress. However, there was increased hepatic MDA content in all groups under pH stress, which was similar to that in previous study [73]. All results showed that pH stress leads to oxidative damage. In our study, under pH stress, hepatic T-AOC, SOD and CAT activity in the treated groups were higher than that of the control in different levels, whereas MDA content was lower. This is similar to the report on the levels of SOD, CAT and MDA in mice under oxidative stress induced by CCl4 [26]. It indicates that soybean isoflavones has an antioxidant function, which may be due to the fact that it can protect cells against reactive oxygen species by scavenging free radicals and inhibiting lipid peroxidation [97e101]. Our results supported these facts, especially in the 40 and 60 mg/kg soybean isoflavones diets. Heat shock proteins are a family of highly conserved cellular proteins present in all organisms that have been examined [102e104], including fish [105]. Heat shock proteins (HSPs), also known as stress proteins and extrinsic chaperones, are a suite of highly conserved proteins of varying molecular weight (c. 16e100 kDa) produced in all cellular organisms when they are exposed to stress [106]. Hsp70 (68e73 kDa) is known to assist the folding of nascent polypeptide chains, act as a molecular chaperone, and mediate the repair and degradation of altered or denatured proteins [107]. Hsp90 (85e90 kDa) is active in supporting various components of the cytoske leton and steroid hormone receptors [108e110]. Martín et al. (1998) reported that HSP70 showed higher

1051

expression 24 h after 33  C hyperthermic stress and 4 h after acidic stress in four different teleostean fish species (gourami, carp, goldfish and trout) [111]. Dong et al. (2008) reported that HSP70 levels increased and reached peak levels 6 h after thermal stress occurred in sea cucumber (Apostichopus japonicus Selenka) [112]. Lif and Zhangm (2009) reported that HSP90 mRNA levels, in both hemocytes and gill, were induced at 2 h and depressed at 8 h during hypoxia stress in Chinese shrimp (Fenneropenaeus chinensis) [113]. Similarly, in this experiment, the expression levels of hepatic HSP70 and HSP90 mRNA in all groups tended to rapidly increase 3 h after pH stress, and then decrease. Increased levels in HSPs induce tolerance of cells, tissues and whole fish to following stressors, which indicates that it may be possible to develop strategies to enhance tolerance to stressors by inducing the cellular stress response [55]. However, when the stress lasts too long or the stress intensity is too high, it may cause mutation in cell membrane structure and hepatic protein composition, which stops the transcription of HSPs [114]. In this study, before and after stress, the expression levels of HSP70 and HSP90 mRNA in treated groups, especially the higher addition level of soybean isoflavones groups (40, 60 and 80 mg/kg soybean isoflavones diets), were higher than those of the control group. Similarly, previous studies showed that compared to those of the control, the expression levels of HSP70 and HSP90 mRNA increased in the immunostimulant group after stress [1,115]. But Zhou (1998) reported that genistein could reduce the expression of HSPs in Chinese hamster. These differences might be due to tissue specificity of different species. Further studies are needed to explore the specific mechanism [98]. 5. Conclusions In conclusion, a basal diet supplemented with soybean isoflavones (40 mg/kge60 mg/kg diet) could increase non-specific immune responses, antioxidant ability and two HSPs mRNA expression level in juvenile T. ovatus, and enhance resistance to high pH stress in fish. Acknowledgments This work was supported by Special Scientific Research Funds for Central Non-profit Institutes, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (2014YD01), Science and Technology Planning Project of Guangdong Province, China (2014B030301064), Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences (2014A08XK04), and the Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences (2014ZD02). References [1] J. Wan, X. Ge, B. Liu, J. Xie, S. Cui, M. Zhou, et al., Effect of dietary vitamin c on non-specific immunity and mRNA expression of three heat shock proteins (HSPs) in juvenile megalobrama amblycephala under ph stress, Aquaculture 434 (2014) 325e333. [2] B.A. Barton, Stress in fishes: a diversity of responses with particular reference to changes in circulating corticosteroids, Integr. Comp. Biol. 42 (2002) 517e525. [3] G.K. Iwama, L.O. Afonso, A. Todgham, P. Ackerman, K. Nakano, Are hsps suitable for indicating stressed states in fish? J. Exp. Biol. 207 (2004) 15e19. [4] B. Thilagavathi, B. Das, A. Saravanakumar, K. Raja, Benthic meiofaunal composition and community structure in the sethukuda mangrove area and adjacent open sea, East coast of India, Ocean Sci. J. 46 (2011) 63e72. [5] B. Yang, C.X. Zhang, Q.P. Zhong, D.L. Lu, S.P. Li, Temporal and spatial variations of temperature, salinity and pH of surface seawater in the Qinzhou Bay, Guangxi, China, J. Qinzhou Univ. 27 (2012) 1e5. [6] C.L. Wang, The water pH value in mariculture pond, J. Aquac. 6 (2001) 29. [7] W.H. Liu, D.W.T. Au, D.M. Anderson, Effects of nutrients, salinity, pH and

1052

[8]

[9]

[10] [11]

[12]

[13]

[14]

[15]

[16]

[17] [18]

[19]

[20]

[21]

[22]

[23]

[24] [25] [26]

[27]

[28]

[29] [30]

[31]

[32] [33]

[34]

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053 light: dark cycle on the production of reactive oxygen species in the alga Chattonella marina, J. Exp. Mar. Biol. Ecol. 346 (2007) 76e86. L.Q. Pan, L.J. Zhang, H.Y. Liu, Effects of salinity and pH on ion-transport enzyme activities, survival and growth of Litopenaeus vannamei postlarvae, Aquaculture 273 (2007) 711e720. M.P. Wilkie, C.M. Wood, Nitrogenous waste excretion, acid-base regulation, and ionoregulation in rainbow trout (Oncorhynhus mykiss) exposed to extremely alkaline water, Physiol. Zool. 64 (1991) 1069e1086. M.P. Wilkie, C.M. Wood, The effects of extremely alkaline water (pH 9.5) on rainbow trout gill function and morphology, J. Fish. Biol. 45 (1994) 87e98. W.N. Wang, A.L. Wang, L. Chen, Effects of pH on survival, phosphorus concentration, adenylate energy charge and Naþ-KþATPase activities of Penaeus chinensis Osbeck juveniles, Aquat. Toxicol. 60 (2002) 75e83. C.C. Li, J.C. Chen, The immune response of white shrimp Litopenaeus vannamei and its susceptibility to Vibrio alginolyticus under low and high pH stress, Fish. Shellfish Immunol. 25 (2008) 701e709. S. Barnes, J. Prasain, T. D'Alessandro, A. Arabshahi, N. Botting, M.A. Lila, et al., The metabolism and analysis of isoflavones and other dietary polyphenols in foods and biological systems, Food Funct. 2 (2011) 235e244. Y. Ng, S. Hanson, J.A. Malison, B. Wentworth, T.P. Barry, Genistein and other isoflavones found in soybeans inhibit estrogen metabolism in salmonid fish, Aquaculture 254 (2006) 658e665. A. Cassidy, S. Bingham, K.D.R. Setchell, Biological effects of isoflavones in young women: importance of the chemical composition of soyabean products, Br. J. Nutr. 74 (1995) 587e601. Z.Y. Jiang, S.Q. Jiang, Y.C. Lin, P.B. Xi, D.Q. Yu, T.X. Wu, Effects of soybean isoflavone on growth performance, meat quality, and antioxidation in male broilers, Poult. Sci. 86 (2007) 1356e1362. M. Verdrengh, I.M. Jonsson, R. Holmdahl, A. Tarkowski, Genistein as an antiinflammatory agent, Inflamm. Res. 52 (2003) 341e346. €ma €la €inen, R. Nieminen, P. Vuorela, M. Heinonen, E. Moilanen, AntiM. Ha inflammatory effects of flavonoids: genistein, kaempferol, quercetin, and daidzein inhibit STAT-1 and NF-kB activations, whereas flavone, isorhamnetin, naringenin, and pelargonidin inhibit only NF-kB activation along with their inhibitory effect on iNOS expression and NO production in activated macrophages, Mediat. Inflamm. 2007 (2007) 45673. N. Dijsselbloem, W. Vanden Berghe, A. De Naeyer, G. Haegeman, Soy isoflavone phyto-pharmaceuticals in interleukin-6 affections: multipurpose nutraceuticals at the crossroad of hormone replacement, anti-cancer and anti-inflammatory therapy, Biochem. Pharmacol. 68 (2004) 1171e1185. M.S. Anthony, T.B. Clarkson, C.L.J. Hughes, T.M. Morgan, G.L. Burke, Soybean isoflavones improve cardiovascular risk factors without affecting the reproductive system of peripubertal rhesus monkeys, J. Nutr. 126 (1996) 43e50. Y. Yamashita, S. Kawada, H. Nakano, Induction of mammalian topoisomerase II dependent DNA cleavage by nonintercalativeflavonoids, genistein and orobol, Biochem. Pharmacol. 39 (1990) 737e744. M. Naim, B. Gestetner, S. Zilkah, Y. Birk, A. Bondi, Soybean isoflavones, characterization, determination an antifungal activity, J. Agric. Food Chem. 22 (1974) 806e812. X.R. Chen, B.P. Tan, K.S. Mai, W.B. Zhang, X.J. Wang, Q.H. Ai, et al., Dietary administration of soybean isoflavones enhances the immunity of white shrimp litopenaeus vannamei and its resistance against vibrio alginolyticus, Aquac. Nutr. 17 (2011) 24e32. G.J. Huang, D.H. Yu, L.H. Guo, X.Y. Wang, Studies on immune effects of soybean isoflavones on fish, South China Fish. Sci. 1 (2005) 35e40. G.J. Huang, D.H. Yu, L.H. Guo, X.Y. Wang, Studies on immune effects of soybean isoflavones on fish, South China Fish. Sci. 1 (2005) 35e40. X.Z. Yin, W.X. Zhao, A.H. Jin, J.S. Quan, Intervention effect of soy isoflavones on hepatic oxidative stress and DNA damage induced by carbon tetrachloride in mice, Food Sci. 35 (2014) 214e218. C.P. Zhou, X.P. Ge, H.Z. Lin, J. Niu, Effect of dietary carbohydrate on nonspecific immune response, hepatic antioxidative abilities and disease resistance of juvenile golden pompano (Trachinotus ovatus), Fish Shellfish Immunol. 41 (2014) 183e190. C.P. Zhou, H.Z. Lin, X.P. Ge, J. Niu, J. Wang, Y. Wang, et al., The effects of dietary soybean isoflavones on growth, innate immune responses, hepatic antioxidant abilities and disease resistance of juvenile golden pompano Trachinotus ovatus, Fish Shellfish Immunol. 43 (2015) 158e166. H. Boshra, J. Li, J.O. Sunyer, Recent advances on the complement system of teleost fish, Fish Shellfish Immunol. 20 (2006) 239e362. A.K. Siwicki, D.P. Anderson, O.W. Dixon, In vitro immunositumulation of rainbow trout (O. mykiss) spleen cells with levamisole, Dev. Comp. Immunol. 14 (1990) 231e237. A.K. Siwicki, D.P. Anderson, G.L. Rumsey, Dietary intake of immunostimulants by rainbow trout affects non-specific immunity and protection against furunculosis, Vet. Immunol. Immunopathol. 41 (1994) 139e159. G. Jeney, D.P. Anderson, An in vitro technique for surveying immunostimulants in fish, Aquaculture 112 (1993) 283e287. G. Jeney, M. Galeotti, D. Volpatti, Z. Jeney, D.P. Anderson, Prevention of stress in rainbow trout (Oncorhynchus mykiss) fed diets containing different doses of glucan, Aquaculture l54 (1997) le5. J. Jorgensen, B. Robertsen, Yeast b-glucan stimulates respiratory burst activity of Atlantic salmon (Salmo salar L.) macrophages, Dev. Comp. Immunol. 19 (1995) 43e57.

[35] V. Verlhac, J. Gabaudan, A. Obach, W. Schuep, R. Hole, Influence of dietary glucan and vitamin C on non-specific and specific immune responses of rainbow trout (Oncorhynchus mykiss), Aquaculture 143 (1996) 123e133. [36] S.T. Solem, J.B. Jørgensen, B. Robertsen, Stimulation of respiratory burst and phagocytic activity in Atlantic salmon (Salmo salar L.) macrophages by lipopolysaccharide, Fish. Shellfish Immunol. 5 (1995) 475e491. [37] M. Sakai, M. Kobayashi, H. Kawauchi, Enhancement of chemiluminescent responses of phagocyctic cells from rainbow trout, O. mykiss, by injection of growth hormone, Fish. Shellfish Immunol. 5 (1995) 375e379. [38] M. Sakai, M. Kobayashi, H. Kawauchi, In vitro activation of fish phagocytic cells by GH, prolactin and somatolactin, J. Endocrinol. 151 (1996) 113e118. [39] M. Sakai, K. Taniguchi, K. Mamoto, H. Ogawa, M. Tabata, Immunostimulant effects of nucleotide isolated from yeast RNA on carp, Cyprinus carpio L, J. Fish. Dis. 24 (2001) 433e438. enci, The investigation of the anabolic [40] O. Keles¸, A. Candan, T. Bakirel, S.K. Düg efficiancy and effect on the nonspecific immune system of zeranol in rainbow trout (Oncorhynchus mykiss, Walbaum), Turk. J. Vet. Anim. Sci. 26 (2002) 925e931. [41] M.Z. Jiang, Y. Tang, H.H. Wang, Determination of soybean isoflavone in healthcare food by HPLC, Zhejiang Prev. Med. 22 (2010) 91e92. [42] GB/T 23788-2009. Determination of soybean isoflavone in health-care foodhigh-performance liquid chromatography. [43] D.P. Anderson, A.K. Siwicki, Basic haematology and serology for fish health programs, in: M. Shariff (Ed.), Diseases in Asian Aquaculture IIFish Health Section, Asian Fisheries Soc, Manila: Philippines, 1995, p. 185. [44] J. Kumari, P.K. Sahoo, Effects of cyclophosphamide on the immune system and disease resistance of Asian catfish Clasrias batrachus, Fish. Shellfish Immunol. 19 (2005) 307e316. [45] H.U. Bergmeyer, P. Scheibe, A.W. Wahlefeld, Optimization of methods for aspartate aminotransferase and alanine aminotransferase, Clin. Chem. 24 (January 1978) 58e73. [46] O.A. Bessey, O.H. Lowry, M.J. Brock, A method for the rapid determination of alkaline phosphates with five cubic millimeters of serum, J. Biol. Chem. 164 (1946) 321e329. [47] M. Muona, A. Soivio, Changes in plasma lysozyme and blood leucocyte levels of hatchery-reared Atlantic salmon (Salmo salar L.) and sea trout (Salmo trutta L.) during parr-smolt transformation, Aquaculture 106 (1992) 75e87. [48] I.F.F. Benzie, J. Strain, The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay, Anal. Biochem. 239 (1996) 70e76. [49] S. Marklund, G. Marklund, Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase, Eur. J. Biochem. 47 (1974) 469e474. [50] H.H. Drape, E.J. Squires, H. Mahmoodi, J. Wu, S. Agarwal, M. Hadley, A comparative evaluation of thiobarbituric acid methods for the determination of malondialdehyde in biological materials, Free Radic. Biol. Med. 15 (1993) 353e363. [51] W.D. Jiang, L. Feng, Y. Liu, J. Jiang, X.Q. Zhou, Myo-inositol prevents oxidative damage, inhibits oxygen radical generation, and increases antioxidant enzyme activities of juvenile Jian carp (Cyprinus carpio var. Jian), Aquac. Res. 40 (2009) 1770e1776. [52] O.H. Lowry, N.J. Rosebrough, A.L. Farr, Protein measurement with the Folinphenol reagent, J. Biol. Chem. 193 (1951) 265e275. [53] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDct method, Methods 25 (2001) 402e408. [54] B. Liu, J. Xie, X. Ge, P. Xu, A. Wang, Y. He, et al., Effects of anthraquinone extract from rheum officinale Bail on the growth performance and physiological responses of macrobrachium rosenbergii under high temperature stress, Fish Shellfish Immunol. 29 (2010) 49e57. [55] G.K. Iwama, P.A. Ackerman, Heat shock proteins and physiological stress in fish, Am. Zoologist 39 (1999) 901e909.  pez-Patin ~ o, R. Martínez-Alvarez, [56] N. Pedro, A.I. Guijarro, M.A. Lo M.J. Delgado, Daily and seasonal variations in haematological and blood biochemical parameters in the tench, Tinca tinca Linnaeus, 1758, Aquac. Res. 36 (2005) 1185e1196. [57] M. Abdel-Tawwab, M.H. Ahmad, Y.A.E. Khattab, A.M.E. Shalaby, Effect of dietary protein level, initial body weight, and their interaction on the growth, feed utilization and physiological alterations of Nile tilapia, Oreochromis niloticus (L.), Aquaculture 298 (2010) 267e274.  [58] J. Rehulka, B. Minarík, Blood parameters in brook trout Salvelinus fontinalis (Mitchill, 1815), affected by columnaris disease, Aquac. Res. 38 (2007) 1182e1197. [59] K.B. Davis, Temperature affects physiological stress responses to acute confinement in sunshine bass (Morone chrysops
Morone saxatilis), Comp. Biochem. Physiol. A Mol. Integr. Physiol. 139 (2004) 433e440. [60] J.M. Groff, J.G. Zinkl, Hematology and clinical chemistry of cyprinid fish. Common carp and goldfish, Vet. Clin. North Am. Exot. Anim. Pract. 2 (1999) 741e776. [61] S. Kumar, N.P. Sahu, A.K. Pal, D. Choudhury, S. Yengkokpam, S.C. Mukherjee, Effect of dietary carbohydrate on haematology, respiratory burst activity and histological changes in L. rohita juveniles, Fish. Shellfish Immunol. 19 (2005) 331e344. [62] A.K. Jha, A.K. Pal, N.P. Sahu, S. Kumar, S.C. Mukherjee, Haemato-immunological responses to dietary yeast RNA, u-3fatty acid and a-carotene in Catla

C. Zhou et al. / Fish & Shellfish Immunology 47 (2015) 1043e1053 catla juveniles, Fish. Shellfish Immunol. 23 (2007) 917e927. [63] H. De Smet, R. Blust, Stress responses and changes in protein metabolism in carp Cyprinus carpio during cadmium exposure, Ecotoxicol. Environ. Saf. 3 (2001) 255e262. [64] S.L. Guo, R.Z. Guan, J.J. Feng, C.Q. Chen, Influences of blood and biochemical parameters on American eels (Anguilla rostrata) challenged by Aeromonas hydrophila, J. Jimei Univ. Nat. Sci. 15 (2010) 93e97 (In Chinese). [65] B. Halliwell, J.M.C. Gutteridge, Free Radicals in Biology and Medicine, third ed., Oxford University Press, Oxford, 2000. [66] J. Eo, K.J. Lee, Effect of dietary ascorbic acid on growth and non-specific immune responses of tiger puffer, Takifugu rubripes, Fish. Shellfish Immunol. 25 (2008) 611e616. [67] P.C. Das, S. Ayyappan, J.K. Jena, Haematological changes in the three Indian major carps, Catla catla (Hamilton), Labeo rohita (Hamilton) and Cirrhinus mrigala (Hamilton) exposed to acidic and alkaline water pH, Aquaculture 256 (2006) 80e87. [68] H.H. Cui, B. Liu, X.P. Ge, Y.J. Liao, J. Xie, M.C. Ren, et al., Effects of dietary inositol on immune function of juvenile Wuchang bream under ammonia stress, J. Fish. China 38 (2014) 228e236 (In Chinese). [69] C.P. Zhou, B. Liu, X.P. Ge, J. Xie, P. Xu, Effect of dietary carbohydrate on immune response, hepatic antioxidant abilities and heat shock protein 70 expression of Wuchang bream, Megalobrama amblycephala, J. Appl. Ichthyol. 29 (2013) 1348e1356. [70] Y.J. Cho, Y.Y. Kim, N.G. Lee, Y.J. Choi, Basic studies on developing equipment for waterless transportation of livefish, Bull. Kor Fish. Soc. 27 (1994) 501e508. [71] M.A.M. Hegazi, Z.I. Attia, M.M. Hegazi, Salinity lessens the impact of high stocking densities and metabolic cost in white muscle and liver of Nile tilapia fingerlings, Aquac. Res. 45 (2014) 566e570. [72] M.Z. Sukhanova, L.G. Grenback, N.E. Gruntenko, T.M. Khlebodarova, I.Y. Rauschenbach, Alkaline phosphatase in Drosophila under heat stress, J. Insect Physiol. 2 (1996) 161e165. [73] Y.C. Rao, Effects of External Stimulus and Environmental Stress on Immune Factors of Anodonta Woodiana (Master's thesis), Nanchang University, Nanchang, 2007 (In Chinese). [74] T. Nakano, T. Kanmuri, M. Sato, M. Takeuchi, Effect of astaxanthinrich red yeast (Phaffia rhodozyma) on oxidative stress in rainbow trout, Biochim. Biophys. Acta 1426 (1999) 119e125. [75] D. Montero, L. Tort, L. Izquierdo, J.M. Vergara, Depletion of serum alternative complement pathway activity in gilthead seabream caused by a-tocopherol and n-3 HUFA dietary deficiencies, Fish Physiol. Biochem. 18 (1998) 399e407. ~ o, M.A. Esteban, J. Meseguer, High dietary intake of a-tocopherol [76] J. Ortun acetate enhances the non-specific immune response of gilthead seabream (Sparus aurata L.), Fish Shellfish Immunol. 10 (2000) 293e307. [77] N.E. Demers, C.J. Bayne, The immediate effects of stress on hormones and plasma lysozyme in rainbow trout, Dev. Comp. Immunol. 21 (1997) 363e373. [78] S.E. Fevolden, K.H. Roed, Cortisol and immune characteristics in rainbow trout (Oncorhynchus mykiss) selected for high or low tolerance to stress, Fish. Biol. 43 (1993) 919e930. [79] Z. Yin, T.J. Lam, Y.M. Sin, The effects of crowding stress on the non-specific immune response in fancy carp (Cyprinus carpio L), Fish. Shellfish Immunol. 5 (1995) 519e529. [80] S.E. Fevolden, K.H. Roed, K.T. Fjalestad, Post stress levels of lysozyme and cortisol in adult rainbow trout: heritabilities and genetic correlations, Fish. Biol. 54 (1999) 900e910. [81] S.C. Ji, O. Takaoka, S.W. Lee, J.H. Hwang, Y.S. Kim, K. Ishimaru, et al., Effect of dietary medicinal herbs on lipid metabolism and stress recovery in red sea bream Pagrus major, Fish. Sci. 75 (2009) 665e672. [82] J. Xie, B. Liu, Q.L. Zhou, Y.T. Su, Y.J. He, L.K. Pan, et al., Effects of anthraquinones extract from rhubarb R. officinale Bail on the crowding stress response and growth of common carp (Cyprinus carpio var. Jian), Aquaculture 281 (2008) 5e11. [83] H. Boshra, J. Li, J.O. Sunyer, Recent advances on the complement system of teleost fish, Fish Shellfish Immunol. 20 (2006) 239e362. [84] M.C.H. Holland, J.D. Lambris, The complement system in teleosts, Fish. Shellfish Immunol. 12 (2002) 399e420. [85] L. Tort, E. Gomez, D. Montero, J.O. Sunyer, Serum haemolytic and agglutinating activity as indicators of fish immunocompetence. Their suitability in stress and dietary studies, Aquac. Int. 4 (1996) 31e41. ~ o, M.A. Esteban, J. Meseguer, Effects of short-term crowding stress on [86] J. Ortun the gilthead seabream (Sparus aurata L.) innate immune response, Fish. Shell Fish. Immunol. 11 (2001) 187e197. ~ o, M.A. Esteban, J. Meseguer, Lack of effect of combining different [87] J. Ortun stressors on immune responses of seabream (Sparus aurata L.), Vet. Immunol. Immunopathol. 84 (2002) 17e27. [88] J.O. Sunyer, E. Gomez, V. Navarro, J. Quesada, L. Tort, Physiological responses and depression of humoral components of the immune system in gilthead seabream (Sparus aurata) following daily acute stress, Can. J. Fish. Aquat. Sci.

1053

52 (1995) 23e39. [89] M. Bagni, L. Archetti, M. Amadori, G. Marino, Effect of long-term oral administration of an immunostimulant diet on innate immunity in sea bass (Dicentrarchus labrax), J. Vet. Med. B Infect. Dis. Vet. Public Health 47 (2000) 745. [90] E.C. Amar, V. Kiron, S. Satoh, T. Watanabe, Enhancement of innate immunity in rainbow trout (Oncorhynchus mykiss Walbaum) associated with dietary intake of carotenoids from natural products, Fish. Shellfish Immunol. 16 (2004) 527. [91] S. Nikoskelainen, A.C. Ouwehand, G. Bylund, S. Salminen, E.M. Lilius, Immune enhancement in rainbow trout (Oncorhynchus mykiss) by potential probiotic bacteria (Lactobacillus rhamnosus), Fish. Shellfish Immunol. 15 (2003) 443. [92] A.J. Ainsworth, C. Dexiang, P.R. Waterstrat, Changes in peripheral blood leukocyte percentages and function of neutrophils in stressed channel catfish, J. Aquat. Anim. Health 3 (1991) 41e47. [93] T. Itou, T. Lida, H. Kawatsu, Kinetics of oxygen metabolism during respiratoryburst in Japanese eel neutrophils, Dev. Comp. Immunol. 20 (1996) 323e330. [94] N. Sheikhzadeh, H. Tayefi-Nasrabadi, A.K. Oushani, M.H.N. Enferadi, Effects of Haematococcus pluvialis supplementation on antioxidant system and metabolism in rainbow trout (Oncorhynchus mykiss), Fish. Physiol. Biochem. 38 (2012) 413e419. [95] Z. Gong, C.F. Cai, J.M. Zhu, S.P. Yi, Y.T. Ye, J.M. Shen, et al., Effects of high pH on antioxidant capacity and astaxanthin content in Eriocheir sinensis, Freshw. Fish. 45 (2015) 20e24. [96] C.X. Ha, P. Liu, Y.Y. He, J. Li, X. Li, Effects of high pH on immune enzymes of “Huanghai No.1” population of shrimp Fenneropenaeus chinensis, J. Fish. Sci. China 16 (2009) 303e306 (In Chinese). [97] M.B. Ruiz-Larrea, A.R. Mohan, G. Paganga, N.J. Miller, G.P. Bolwell, C.A. RiceEvans, Antioxidant activity of phytoestrogenic isoflavones, Free Radic. Res. 26 (1997) 63e70. [98] Y. Zhou, A.S. Lee, Mechanism for the suppression of the mammalian stress response by genistein, an anticancer phytoestrogen from soy, J. Natl. Cancer Inst. 90 (1998) 381e388. [99] L.A. Santiago, M. Hiramatsu, M. Mori, Japanese soybean paste miso scavenges free radicals and inhibits lipid peroxidation, J. Nutr. Sci. Vitaminol. Tokyo 38 (1992) 297e304. [100] M. Sonee, T. Sum, C.Y. Wang, S.K. Mukherjee, The soy isoflavone, genistein, protects human cortical neuronal cells from oxidative stress, Neurotoxicology 25 (2004) 885e891. [101] F.H. Sarkar, Y. Li, Mechanisms of cancer chemoprevention by soy isoflavone genistein, Cancer Metastasis Rev. 21 (2002) 265e280. [102] R.I. Morimoto, A. Tissieres, C. Georgopoulos, Stress Proteins in Biology and Medicine, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1990. [103] W.J. Welch, How cells respond to stress, Sci. Am. 269 (1993) 56e64. [104] M.E. Feder, G.E. Hofmann, Heat-shock proteins, molecular chaper ones, and the stress response: evolutionary and ecological physiology, Annu. Rev. Physiol. 61 (1999) 243e282. [105] G.K. Iwama, P.T. Thomas, R.B. Forsyth, M.M. Vijayan, Heat shock protein expression in fish, Rev. Fish Biol. Fish. 8 (1998) 35e56. [106] R.J. Roberts, C. Agius, C. Saliba, P. Bossier, Y.Y. Sung, Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review, J. Fish. Dis. 33 (2010) 789e801. [107] J.G. Kiang, G.C. Tsokos, Heat shock proteins 70kDa: Molecular biology, biochemistry, and physiology, Pharmacol. Ther. 80 (1998) 183e201. [108] P. Csermely, T. Schnaider, C. Soti, Z. Prohaszka, G. Nardai, The 90-kDa molecular chaperone family: Structure, function, and clinical applications. A comprehensive review, Pharmacol. Ther. 79 (1998) 129e168. [109] L.H. Pearl, C. Prodromou, Structure and in vivo function of hsp90, Curr. Opin. Struct. Biol. 10 (2000) 46e51. [110] J.C. Young, I. Moarefi, F.U. Hartl, Hsp90: A specialized but essential proteinfolding tool, J. Cell Biol. 154 (2001) 267e273. ndez, G. Bodega, Heat-shock proteins express ion in fish [111] M. Martín, C. Herna central nervous system and its possible relation with water acidosis resistance, Neurosci. Res. 31 (1998) 97e106. [112] Y.W. Dong, S.L. Dong, X.L. Meng, Effects of thermal and osmotic stress on growth, osmoregulation and HSP70 in sea cucumber (Apostichopus japonicas Selenka), Aquaculture 276 (2008) 179e186. [113] L.W. Lif, C. Zhangm, Cloning of cytoplasmic heat shock protein 90 (FcHSP90) from Fenneropenaeus chinensis and its expression response to heat shock and hypoxia, Cell Stress Chaperones 14 (2009) 161e172. [114] J. Qiang, H. Yang, H. Wang, P. Xu, Z.L. Qi, J. He, Studies on blood biochemical indices and expression of hepatic HSP70 mRNA of different tilapia strains artificially challenged with Streptococcus iniae, J. Fish. China 36 (2012) 958e968. [115] J.H. Ming, J. Xie, P. Xu, X.P. Ge, W.B. Liu, J.Y. Ye, Effects of emodin and vitamin C on growth performance, biochemical parameters and two HSP70s mRNA expression of Wuchang bream (Megalobrama amblycephalaYih) under high temperature stress, Fish. Shellfish Immunol. 32 (2012) 651e661.