Effects of different cryoprotectants on the viability and biological characteristics of porcine preadipocyte

Cryobiology 53 (2006) 240–247 www.elsevier.com/locate/ycryo

EVects of diVerent cryoprotectants on the viability and biological characteristics of porcine preadipocyte 夽 Y. Li, R.H. Lu, G.F. Luo, W.J. Pang, G.S. Yang ¤ Laboratory of Animal Fat Deposition and Muscle Development, College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, PR China Received 1 April 2006; accepted 19 June 2006 Available online 23 August 2006

Abstract EVective techniques for the cryopreservation of porcine preadipocytes could increase the usefulness of these cells as a model in obesity studies. The objective of this study was to test the eVects of the following cryoprotective agents (CPAs) on the cytotoxicity, post-thaw survival, proliferation and diVerentiation capacity of porcine preadipocytes: ethylene glycol (EG), dimethyl sulphoxide (Me2SO), polyvinylpyrrolidone (PVP), Me2SO+PVP, and no-CPA. In addition to the CPAs, the CPA medium contained 80% DMEM/F12 plus 10% FBS. Trypan blue exclusion tests showed that among the CPA treatments in this study, only EG was toxic to porcine preadipocytes. The highest survival rate (94.96%) and cell viability were obtained when preadipocytes were cryopreserved with 10% PVP. Morphologically, PVP cryopreserved preadipocytes resembled Wbroblasts and most underwent attachment, proliferation, and growth arrest with subsequent accumulation of intracellular lipid droplets before becoming mature adipocytes. There were no signiWcant diVerences in the GPDH activity between adipocytes in the PVP treatment and primary cells from days 3 to 10 of the culture. Analysis of RT-PCR conWrmed that there was no signiWcant diVerence of PPAR2 mRNA levels between the cells in the 10% PVP treatment and primary cells. In summary, porcine preadipocytes cryopreserved with DMEM/F12 medium containing 10% PVP and 10% FBS have high survival rate and proliferation potential. Furthermore, the cryopreserved cells synthesize a range of markers that are consistent with this cell type. We conclude that 10% PVP is a suitable CPA for porcine preadipocytes. © 2006 Elsevier Inc. All rights reserved. Keywords: Porcine; Preadipocyte; Cryoprotectant; Viability; DiVerentiation potential

The prevalence of obesity has increased dramatically in recent years and it is now considered to be a global epidemic by many researchers [10–12,21,27]. Because it is related to morbidity and mortality, 夽

Statement of funding: supporting by National Basic Research Program of China (2004CB117506). * Corresponding author. Fax: +86 29 87092430. E-mail address: [email protected] (G.S. Yang). 0011-2240/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.cryobiol.2006.06.007

there is increased concern about the impact of obesity on the current and future health of the world’s population. How this epidemic should be managed is not yet clear. A primary research goal in this Weld is to understand the mechanism of obesity development and regulation [3,9,12,13,20,21,27]. Rat preadipocytes and adipocyte line(s) are commonly used in obesity studies, but it has been suggested that porcine preadipocytes are a better model

Y. Li et al. / Cryobiology 53 (2006) 240–247

for the study of obesity and its related disorders, because they possess higher lipogenic capacity and similar lipogenic patterns with human adipocytes [13]. Short-term primary cultures have been performed in several studies using porcine preadipocytes [3,9,20], however there is a dramatic decrease in the ability of most passages cells to diVerentiate after a few subcultures [5,17], which aVects the reliability and continuity of the experiment. The limited availability, short life span, and diYculty in isolation and maintenance of procine preadipocytes have prevented their widespread adaptation in obesity research. Thus, it is important to identify eVective techniques for the cryopreservation of porcine preadipocytes. Cryoprotective agents (CPAs) protect cells from lethal damage that often occurs during the freezing and thawing processes of cryopreservation [1]. The nature of CPA protection depends on the speciWc cell culture model, since the responsiveness to CPAs may vary considerably according to cell origin (e.g. species and cell type). These factors can often cause conXicting results [2,6,25]. Therefore, the addition of CPAs must be optimized according to speciWc cell characteristics to ensure successful cryopreservation. No literature about cryopreservation of porcine preadipocyte has been reported. The objective of this study was to test the eVect of permeating and non-permeating CPAs on the toxicity and post-thaw survival rate, proliferation, and diVerentiation capacity of porcine preadipocytes in vitro. The identiWcation of the optimal CPA for porcine preadipocyte cryopreservation will make the cells a novel and valuable tool for obesity studies. Materials and methods Adipose tissue collection, porcine preadipocytes isolation, and primary culture Dorsal subcutaneous adipose tissue was obtained from 3-day-old male crossbred pigs (Duroc £ LongWhite £ Large-White, from the experimental farm of Northwest A & F University) following electrocution. Primary culture of porcine preadipocytes was conducted by methods described previously by Li et al. [18]. BrieXy, adipose tissue was removed under sterile conditions from the dorsal subcutaneous depot in the neck and rinsed with KRB (Krebs Ringer Bicarbonate, containing 3% BSA, 10 mM glucose, 50 U penicillin/ml and streptomycin) buVer. The tissue was cut with scissors into approximately 1 mm3 sections and then incubated in a digestion buVer comprised of

241

Dulbecco’s modiWed Eagle’s medium/F12 (DMEM/ F12, a 50:50 mixture of DMEM/F12, Gibco), 100 mM Hepes, 20 g/L bovine serum albumin (BSA, Sigma), pH 7.4, containing 1 g/L collagenase (Type I, Gibco). A Wvefold excess of digestion buVer (room temperature, excluding collagenase) was added to the digestion Xask after incubating for 60 min at 37 °C in a shaking water bath. To remove undigested tissue and large cell aggregates, Xask contents were mixed and Wltered through 200 m nylon mesh Wlters. The Wltered cells were centrifuged at 800g for 5 min to separate the Xoating adipocytes from the pellet of stromal-vascular cells. The stromal-vascular cells were then incubated with erythrocyte lysis buVer (0.154 M NH4Cl, 10 mM KHCO3, 0.1 mM EDTA) at room temperature for 10 min, followed by centrifugation. The stromal-vascular cell pellet was washed twice with DMEM/F12 medium supplemented with 15 mM NaHCO3, 50 U penicillin/ml and streptomycin. After washing, the cells were resuspended in DMEM/F12 medium containing 10% fetal bovine serum (FBS vol/ vol, Sigma). Finally, aliquots were seeded in culture Xasks and plates at a density of 5.0 £ 104 cells/cm2 and maintained at 37 °C in a humidiWed 5% CO2 atmosphere. The medium was changed every other day. CPAs solution preparation Five CPA treatments were used in this study: EG (Merck, av. mol. wt 62.07, Germany), Me2SO (Sigma, av. mol. wt 78.14, USA), PVP (Sigma, av. mol. wt 40,000, USA), Me2SO+PVP, and no-CPA. CPA medium consisted of the following ratios: EG, 80:10:10 (DMEM/F12 medium:FBS:EG, vol/vol/ vol), Me2SO, 80:10:10 (DMEM/F12 medium: FBS:Me2SO, vol/vol/vol), PVP, 80:10:10 (DMEM/ F12 medium: FBS:PVP, vol/vol/wt), Me2SO+PVP, 80:10:5:5 (DMEM/F12 medium:FBS:Me2SO:PVP, vol/vol/vol/wt) and no-CPA, 90:10 (DMEM/F12 medium: FBS, vol/vol). Digestion Cells were maintained in the medium until conXuency (days 4–6 of culture) at which time they were washed three times with phosphate-buVered saline (PBS) to remove the rudimental medium, digested with 0.25% trypsase, and then centrifuged and resuspended in DMEM/F12 medium containing 10% FBS. The suspension was divided into several aliquots; each aliquot contained 1 £ 106 cells. One aliquot was immediately used to analyze the cytotoxicity of the

242

Y. Li et al. / Cryobiology 53 (2006) 240–247

CPAs. Additional aliquots were taken randomly and submitted to freezing/thawing (n D 6). Toxicity test To evaluate the toxicity of the CPAs to porcine preadipocytes, aliquot of containing cells was exposed to medium containing Me2SO, EG, PVP, Me2SO+PVP, or no-CPA at 20 °C for 20 min. After equilibration, the CPA was removed by washing cells three times in FBS-free DMEM/F12 medium. After washing, the cells were suspended in 10% FBS medium and membrane integrity was assessed by trypan blue exclusion. Survival rates were calculated according to the following formula: Survival rate D (number of surviving cells/total number of cells counted) £ 100% Freezing and thawing Before freezing, aliquots containing pig preadipocytes were treated with one of the Wve CPA solutions described above (1 ml), and equilibrated at 4 °C for 30 min. Afterwards, the polypropylene cryotubes containing the aliquots were transferred to a ¡80 °C freezer. The approximate cooling rate was 4.1 °C/ min from 37 °C to 4 °C, 1 °C/min from 4 °C to ¡80 °C. After 24 h, the cryotubes were plunged directly into liquid nitrogen and stored for 30 days. Thawing was performed by placing vials in a water bath at 37 °C and shaking for 1 min. The cells were then washed twice in 10% FBS medium at room temperature to remove the CPA. Freshly isolated (control) and cryopreserved porcine preadipocytes were seeded in the plates at a density of 5.0 £ 104 cells/cm2 and incubated at 37 °C in a humidiWed 5% CO2 atmosphere. The medium was changed every other day. Cell survival rate After thawing, post-thaw porcine preadipocytes were suspended in FBS-free medium and cell membrane integrity was reassessed by trypan blue exclusion. The survival rates of each group of cells were calculated according to the formula described above. Cell proliferation At 72 h, cell proliferation was evaluated by MTT assay according to the methods of Pieters et al. [23]. BrieXy, an MTT stock solution (Sigma, 5 mg of

MTT/ml of phosphate-buVered saline, PBS) was sterilized and kept for no more than 2 weeks at 4 °C. To start the coloring reaction, stock solution was added to growing cultures (Wnal concentration, 0.5 mg/ml). The mixture was incubated for 4 h at 37 °C. Blue crystals developed over the mitochondria in living cells. After 4 h, formazan crystals were dissolved with 100 l of 0.04 M HCl–isopropyl alcohol (acid isopropanol) on a shaker (160 rpm at 20 °C) for 10 min. The optical density (OD) of the wells was measured at a wavelength of 340 nm with a microplate reader. The OD value of each well containing medium but no cells was subtracted from the OD value of wells containing cells and medium. All assays were replicated six times. Cell diVerentiation Adipocyte diVerentiation was identiWed by Oil Red O staining after 10 days of culture according to the methods of Ramirez-Zacarias et al. with a minor modiWcation [24]. The Oil Red O working solution was prepared by dissolving 4.2 g of Oil Red O (Sigma) in 1200 ml of absolute isopropanol. The solution was allowed to sit overnight at room temperature without stirring. On the second day, the solution was Wltered through qualitative Wlter paper, mixed with 900 ml of deionized water, and allowed to sit overnight at 4 °C without stirring. The Wnal working solution was Wltered twice and stored at room temperature until use. Cell culture plates for staining were taken out, the medium was removed and cells were washed three times with PBS, Wxed for a minimum of 30 min with 10% neutral buVered formalin and drained. After washing with PBS, the cells were covered with the Oil Red O working solution for 60 min. The Oil Red O was removed and the cells were subsequently destained with 60% propylene glycol using gentle agitation for 30 s. Finally, the cells were rinsed throughly with PBS and then cell morphology was examined and photographed with a microscope. GPDH activity (glycerol-3-phosphate dehydrogenase) analysis GPDH activity was determined according to the methods of Hauner et al. [14]. At days 3, 5, and 10 of the culture period, the medium was removed from the 24-well plates. The cells were rinsed three times with PBS, digested with 0.25% trypsase, centrifuged, resuspended in PBS, and sonicated. The samples

Y. Li et al. / Cryobiology 53 (2006) 240–247

were centrifuged at 7000g for 15 min at 4 °C, then the infranate was assayed for GPDH activity in 100 mM triethanolamine/HCl, pH 7.5, 2.5 mM EDTA, 0.12 mM NADH, 0.2 mM dihydroxyacetone phosphate, and 0.1 mM mercaptoethanol. All the reagents were obtained from Sigma. The change in absorbance at 340 nm with time was used to calculate the rate. One unit of activity was expressed as the amount causing the oxidation of 1 nmol of NADH per minute. The protein content of the extracts was measured with a modiWcation of the method of Lowry et al. [22]. Extraction total RNA and RT-PCR analysis At days 3, 5, and 10 of the culture period, total cellular RNA was extracted from primary cultured and cryopreserved porcine preadipocytes by using TRIZOL Reagent (Fermentas Life Science) following the manufacturer’s protocol. After DNase treatment, RNA quality and quantiWcation were measured by electrophoresis and spectrophotometry at 260 and 280 nm, respectively [22]. Reverse transcription was performed to synthesize cDNA with a Wrst strand cDNA Synthesis Kit (Fermentas Life Science). The synthesized cDNA were then ampliWed by PCR using paired sense and antisense primers of both -actin (as the internal control) and PPAR2 (Table 1) in the same sample according to the methods of Maria et al. [19]. The PCR conditions included an initial denaturation at 95 °C for 10 min, followed by 30 cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min, and a Wnal extension step at 72 °C for 10 min. The ampliWed fragments were separated with electrophoresis by using 1% agarose gel. Images of the RT-PCR ethidium bromidestained agarose gels were acquired with a CCD camera and quantiWcation of the bands was performed using Dolphin-1D software (Wealtec International Ltd.). Band intensity was expressed as relative absorbance units. The ratio of band intensity

243

between the mRNA of interest and -actin was calculated to normalize for initial variations in sample concentration. Statistical analysis A single batch of porcine preadipocytes from an individual pig was used for each replicate. The experiments on toxicity, survival rate, and cell proliferation were repeated Wve times. Each treatment within an experiment was replicated six times. For the adipocyte identiWcation experiments, GPDH activity assay and diVerentiation marker detection were performed with six replicates. The control treatment represents primary preadipocytes. Treatments were compared by ANOVA (SPSS 13.0). DiVerences were considered statistically signiWcant at P < 0.05. Data were presented as means (SD) calculated from six replicates. Results Toxicity test Toxicity test results showed that the survival rate of porcine preadipocytes treated with CPAs generally ranged from 96.40 to 98.06% (Table 2). The exception was the EG treatment which had a survival rate of 42.72%. No statistical diVerences were Table 2 EVect of cryoprotectants on porcine preadipocyte survival rate Treatment

Survival rate (%)

Primary cells No-CPA Me2SO EG PVP Me2SO+PVP

98.06 (1.05)a 98.06 (1.05)a 96.40 (1.26)a 42.72 (2.77)b 97.57 (1.01)a 96.61 (1.49)a

Note: Data were compared using one way analysis of variance (ANOVA). Values in the tables are means (SD), n D 6. Means followed by diVerent letters are signiWcantly diVerent at P < 0.001.

Table 1 Parameters of primer pairs Genes

Accession number

Primer sequence

Source of primers

Size, bp

PPAR2

AB097930

porcine

290

-Actin

NM031144

S: 5⬘TTGACCCAGAAAGCGAT3⬘ A: 5⬘TATGGCACTTTGGTAGTCCTG3⬘ S: 5⬘ACTGCCGCATCCTCTTCCTC 3⬘ A:5⬘CTCCTGCTTGCTGATCCACATC3⬘

rat

399

Note: S, sense primer; A, antisense primer.

244

Y. Li et al. / Cryobiology 53 (2006) 240–247

observed in the number of intact viable cells between the control and treated with Me2SO (P D 0.430), PVP (P D 0.986) or Me2SO+PVP (P D 0.526) CPAs. In contrast, there was a signiWcant (P < 0.001) decline in the survival rate of cells after cryopreservation with EG when compared with the control. Cell survival rate and proliferation evaluation The eVects of cryoprotectants on the survival rate and proliferation capacity of porcine preadipocytes are summarized in Table 3. Results are presented as the mean (SD) as determined by one way analysis of variance (ANOVA). The control treatment represents primary preadipocytes. No signiWcant diVerence was found in the survival rate (P D 0.058) and proliferation capacity of cells (P D 0.454) between the control and PVP treatments. In contrast, there was a very signiWcant (P < 0.001) decline in the survival rate and proliferation capacity of cells after cryopreservation Table 3 EVects of CPAs on post-thaw survival rate and proliferation capacity of porcine preadipocytes Treatment

Survival rates (%)

OD value

Primary cells No-CPA Me2SO EG PVP Me2SO+PVP

98.09 (1.20)c 4.60 (1.04)a 11.48 (0.93)b 9.29 (0.92)b 94.96 (2.84)c 90.13 (2.73)d

0.4285 (0.0217)c 0.0113 (0.0015)a 0.0518 (0.0049)b 0.0273 (0.0029)b 0.4148 (0.0141)c 0.3745 (0.0168)d

Note: Data were compared using one way analysis of variance (ANOVA). Values in the tables are means (SD), n D 6. Within a column ac,ab,bc,cdP < 0.001.

with Me2SO, EG, and Me2SO+PVP when compared with the control. The protection eYciency of the CPAs declined in the order: PVP > Me2SO+PVP > Me2SO > EG > no-CPA. Morphology Morphological changes from preadipocytes to mature adipocytes of primary (A1–D1) and postthaw cells (A2–D2) are shown in Fig. 1. The majority of porcine preadipocytes attached to the plates on day 1 after thawing. Cells from the 10% PVP treatment grew exponentially and resembled Wbroblasts (Fig. 1, A2). There was a large increase in the number of cells between days 2 and 3 and the cells gradually arrived at conXuence by day 3 (Fig. 1, B2). From days 4 to 8, many small intracellular lipid droplets began to accumulate around the nucleolus (Fig. 1, C2). At day 10, larger lipid droplets appeared and the cells tended to be rounder, suggesting that the cells had fully diVerentiated. Oil Red O staining indicated that numerous large cytoplasmic lipids had formed in the cells, which conWrming that the porcine preadipocytes had fully diVerentiated by day 10 (Fig. 1, D2). In summary, no signiWcant morphological diVerence was observed between the control and 10% PVP cells (Fig. 1, A1–D1 and A2–D2). GPDH activity We assayed GPDH activity, a late marker for adipocyte diVerentiation, at days 3, 5, and 10 of the culture. The GPDH activities of cells cryopreserved with PVP were very similar to those of

Fig. 1. Morphological changes from preadipocyte to mature adipocyte of primary (A1–D1) and 10% PVP cryopreserved cells (A2–D2). A1 and A2 cells were at day 1, B1 and B2 cells were at day 3; C1 and C2 cells were at day 8; D1 and D2 were at day 10 and stained with Oil Red O. The magniWcation was 200£.

Y. Li et al. / Cryobiology 53 (2006) 240–247

unfrozen cells and increased during the diVerentiation of preadipocytes to adipocytes (Fig. 2). No signiWcant diVerence in GPDH activity was observed between the control and 10% PVP treatments at days 3 (P D 0.815), 5 (P D 0.497), and 10 (P D 0.579).

245

PPAR2 mRNA expression The PPAR2 expression patterns were consistent with our observations regarding cell morphology and GDPH activity (Fig. 3). PPAR2 is the master regulator of adipocyte gene transcription. Adipo-

Fig. 2. GPDH activity in primary and 10% PVP cryopreserved cells at days 3, 5, and 10. Columns and error bars indicate mean (SD) (n D 6).

Fig. 3. PPAR2 mRNA levels in primary and 10% PVP cryopreserved cells at days 3, 5, and 10. Columns and error bars indicate mean (SD) (n D 6).

246

Y. Li et al. / Cryobiology 53 (2006) 240–247

cytes clearly demonstrate adipose-speciWc characteristics with the expression of PPAR2. In our study, there were no signiWcant diVerences in the transcription concentration of PPAR2 between the control and the 10% PVP group at days 3 (P D 0.713), 5 (P D 0.806), and 10 (P D 0.961). The expression levels of PPAR2 increased during the diVerentiation of preadipocytes to adipocytes. Discussion We compared the eVects of no-CPA, permeating (Me2SO and EG) CPAs, non-permeating (PVP) CPA and permeating combined with non-permeating CPA (Me2SO+PVP) on the toxicity, post-thaw survival rate, growth kinetics, and diVerentiation capacity of porcine preadipocytes in vitro. The survival rate of preadipocytes cryopreserved in the presence of CPAs ranged 9.29–94.96% compared to a 4.60% survival rate in the no-CPA treatment, likewise, the proliferation capacity of CPA treated cells was also signiWcantly (P < 0.001) higher compared with cells in the no-CPA treatment. These results showed that all of the CPAs in this study oVered some degree of protection to preadipocytes during cryopreservation. Therefore, CPAs are essential for the cryopreservation of porcine preadipocytes. Among the CPAs used in this study, the highest cell survival rate (94.96%) and viability were obtained with 10% PVP, a non-permeating CPA. There were no signiWcant diVerences in the cell survival rate (P D 0.058) and viability (P D 0.454) between adipocytes in the PVP treatment and primary cells. In contrast, cell survival rates and viability were much lower when cells were cryopreserved with the permeating CPAs EG or Me2SO. It is worth noting that Me2SO is the most widely used CPA for large numbers of cells and tissue cryopreservation [4,7,8,25,26], and it usually produces good results. Toxicity tests in our study showed a high survival rate (96.40%) for cells treated with Me2SO, thus the low survival rate must not be due to the toxicity of Me2SO, but rather to other processes that occurred during freezing and thawing. Survival rates increased to 90.13% when Me2SO and PVP were used in combination, but this was still less than the survival rate in the 10% PVP treatment (94.96%). In this study, the poorest results were obtained when EG was used as the CPA. When porcine preadipocytes were exposed to EG for 20 min, the survival rate of cells was reduced from 98.06% to 42.72%.

Likewise, cell survival rates and viability were much lower when cells were cryopreserved with EG. Due to its relatively low molecular weight, EG has high permeability and is therefore classiWed as a penetrating CPA [15]. The osmotic stress due to the presence of CPA within a cell may provoke cell injury [8,16,26]. This was probably the reason why EG was the most toxic cryoprotectant in the present study. Cryopreservation of fat cells in EG resulted in rates of normal cells (9.29%), it was consonant with the result of toxicity test. It appears that the damage to the cells observed using EG was caused by the toxic eVect and the cryopreservation process. EVective CPAs maintain not only the viability but also the function of frozen cells. Microscopic examination of post-thaw cell cultures showed that the preadipocytes cryopreserved with PVP morphologically resembled Wbroblasts. After thawing, the majority of cells underwent attachment, proliferation, and growth arrest with subsequent accumulation of intracellular lipid droplets, before Wnally developing into mature adipocytes. These changes are consistent with normal patterns of adipocyte diVerentiation [3,20]. Furthermore, adipocytes clearly demonstrated adipose-speciWc characteristics. GPDH activity, which is a late marker for adipocyte diVerentiation [14], was low in undiVerentiated porcine preadipocytes and increased as diVerentiation progressed and the cells accumulated lipid droplets. There was no signiWcant diVerence in the GPDH activity between cells in the PVP treatment and primary cells from days 3 to 10 of the culture period. PPAR2 is the master regulator of adipocyte gene transcription [3,9,14]. Analysis of RT-PCR conWrmed that there was no signiWcant diVerence of PPAR2 mRNA between the primary cells and cells in the 10% PVP treatment, indicating that the transcript concentration of preadipocytes was not impaired by freezing and thawing. Based on these results, we conclude that porcine preadipocytes in the 10% PVP treatment retained all their distinctive features after thawing. In summary, the data described here represent, to the best of our knowledge, the Wrst attempt to develop an understanding of the fundamental cryobiology of porcine preadipocytes. The results demonstrated that cryopreservation with 10% PVP provides a convenient and improved alternative for porcine preadipocyte culture, which will be of great value for the study of obesity and its associated disorders. Additional research needs to be conducted to explore the cryoprotective mechanism of PVP.

Y. Li et al. / Cryobiology 53 (2006) 240–247

Acknowledgments This research was sponsored by National Basic Research Program of China (2004CB117506). We thank Dr. H. Ji for his suggestions and English correction of the manuscript. References [1] M.J. Ashwood-Smith, Low temperature preservation of cells, tissues and organs, in: Low Temperature Preservation in Medicine and Biology, Turnbridge Wells, 1980, pp. 19–44. [2] U. Baccarani, A. Sanna, A. Cariani, Cryopreserved human hepatocytes from cell bank: in vitro function and clinical application, Transplant. P. 37 (2005) 256–259. [3] T.D. Brandebourg, C.Y. Hu, Regulation of diVerentiating pig preadipocytes by retinoic acid, J. Anim. Sci. 83 (1) (2005) 98– 108. [4] C.O. Bwanga, H. Ekwall, H. Rodriguez-Martinez, Cryopreservation of boar semen. III: Ultrastructure of boar spermatozoa frozen ultra-rapidly at various stages of conventional freezing and thawing, Acta Vet. Scand. 32 (1991) 463–471. [5] P.J. Chedrese, M.R. Rodway, C.L. Swan, C. Gillio-Meina, Establishment of a stable steroidogenic porcine granulosa cell line, J. Mol. Endocrinol. 20 (1998) 287–292. [6] M.J. Cocero, A. Lopez-Sebastian, M.L. Barragan, R.A. Picazo, DiVerences on post-thawing survival between ovine morulae and blastocysts cryopreserved with ethylene glycol or glycerol, Cryobiology 33 (1996) 502–507. [7] M.J. Cocero, S. Moreno Díaz de la Espina, B. Aguilar, Ultrastructural characteristics of fresh and frozen-thawed ovine embryos using two cryoprotectants, Biol. Reprod. 66 (2002) 1244–1258. [8] J.K. Critser, A.R. Huse-Benda, D.V. Aaker, Cryopreservation of human spermatozoa. III. The eVect of cryoprotectants on motility, Fertil. Steril. 50 (1988) 314–320. [9] S.T. Ding, H.J. Mersmann, Fatty acids modulate porcine adipocyte diVerentiation and transcripts for transcription factors and adipocyte-characteristic proteins, J. Nutr. Biochem. 12 (2001) 101–108. [10] C.B. Ebbeling, D.B. Pawlak, D.S. Ludwig, Childhood obesity: public-health crisis, common sense cure, Lancet 360 (2002) 473–482. [11] K.M. Flegal, M.D. Carroll, C.L. Ogden, C.L. Johnson, Prevalence and trends in obesity among US adults, 1999–2000, JAMA 288 (2002) 1723–1727. [12] E.S. Ford, A.H. Mokdad, W.H. Giles, D.A. Galuska, M.K. Serdula, Geographic variation in the prevalence of obesity, diabetes, and obesity-related behaviors, Obes. Res. 13 (2005) 118–122.

247

[13] F. Gondret, ADD-1/SREBP-1 is a major determinant of tissue diVerential lipogenic capacity in mammalian and avian species, J. Lipid. Res. 42 (2001) 106–113. [14] H. Hauner, G. Entenmann, M. Wabitsch, D. Gaillard, G. Ailhaud, R. Negrel, E.F. PfeiVer, Promoting eVect of glucocorticoids on the diVerentiation of human adipocyte precursor cells cultured in a chemically deWned medium, J. Clin. Invest. 84 (1989) 1663–1670. [15] W.V. Holt, Fundamental aspects of sperm cryobiology: the importance of species and individual diVerences, Theriogenology 53 (2000) 47–58. [16] S.P. Leibo, Cryobiology: preservation of mammalian embryos, Basic Life Sci. 37 (1986) 251–272. [17] A.A. Lerner, D.F. Salamone, M.E. Chiappe, J.L. Baranao, Comparative studies between freshly isolated and spontaneously immortalized bovine granulosa cells: protein secretion, steroid metabolism, and responsiveness to growth factors, J. Cell. Physiol. 164 (1995) 395–403. [18] Y. Li, G.S. Yang, R.H. Lu, Optimal culture method of the porcine preadipocyte, Chn. J. Cell Biol. 27 (2005) 697–700. [19] M. Maria, M. Simona, D.R. Daniela, P. Luca, S. Giovanni, Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample, Biol. Proced. Online 3 (1) (2001) 9–25. [20] S. Mills, Beta-adrenergic receptor subtypes mediating lipolysis in porcine adipocytes. Studies with BRL-37344, a putative3-adrenergic agonist, Comp. Biochem. Phys. C 126 (2000) 11–20. [21] A.H. Mokdad, E.S. Ford, B.A. Bowman, Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001, JAMA 289 (2003) 76–79. [22] G.L. Peterson, A simpliWcation of the protein assay of Lowry et al. which is more generally applicable, Anal. Biochem. 83 (1977) 346–356. [23] R. Pieters, A.H. Loonen, D.R. Huismans, G.J. Broekema, M.W.J. Dirven, M.W. Heyenbrok, K. Hahlen, A.J.P. Veerman, In vitro drug sensitivity of cells from children with leukemia using the MTT assay with improved culture conditions, Blood 76 (1990) 2327–2336. [24] J.L. Ramirez-Zacarias, F. Castro-Munozledo, W. Kuri-Harcuch, Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with oil red o, Histochemistry 97 (1992) 493–497. [25] K. Schellander, J. Peli, F. Schmoll, G. Brem, EVects of diVerent cryoprotectants and carbohydrates on freezing of matured and unmatured bovine oocytes, Theriogenology 42 (1994) 909–915. [26] U. Schneider, P. Mazur, Osmotic consequences of cryoprotectant permeability and its relation to the survival of frozen–thawed embryos, Theriogenology 21 (1984) 68–79. [27] R. Sturm, Increases in clinically severe obesity in the United States, 1986–2000, Arch. Intern. Med. 163 (2003) 2146–2148.