Effects of 1,25-dihydroxyvitamin D3 on proliferation and differentiation of porcine preadipocyte in vitro

Available online at www.sciencedirect.com

Chemico-Biological Interactions 170 (2007) 114–123

Effects of 1,25-dihydroxyvitamin D3 on proliferation and differentiation of porcine preadipocyte in vitro Helin Zhuang, Yaqiu Lin, Gongshe Yang ∗ Laboratory of Animal Fat Deposition and Muscle Development, Northwest A & F University, Yangling, Shaanxi 712100, PR China Received 10 April 2007; received in revised form 10 July 2007; accepted 13 July 2007 Available online 31 July 2007

Abstract 1,25-Dihydroxyvitamin D3 , the physiologically active form of vitamin D3 , exerts its functions through a receptor-mediated mechanism and plays an important role in the cell differentiation. This study investigated the effects of 1,25-dihydroxyvitamin D3 on the proliferation and differentiation of porcine preadipocyte. Stromal-vascular cells containing preadipocytes were prepared from dorsal subcutaneous adipose tissue of approximately 3-day-old Chinese male crossbred pigs. After confluence, the differentiation was induced by transferrin, dexamethasone and insulin for 2 days, and then subsequently cultured for 6 days. The cells were treated with 1,25-dihydroxyvitamin D3 during the induction of differentiation (the early phase of differentiation) or throughout the differentiation period. The terminal differentiation markers, such as glycerol-3-phosphate dehydrogenase activity and lipid accumulation were measured during the process of cultures. The treatment with 1,25-dihydroxyvitamin D3 severely affected the induction of all differentiation markers throughout the differentiation period. 1,25-Dihydroxyvitamin D3 suppressed the expression of peroxisome proliferator-activated receptor gamma mRNA and interfered with the induction of retinoid X receptor alpha mRNA. The mRNAs of the adipogenesis-related genes, lipoprotein lipase, stearoyl-CoA desaturase, phosphoenolpyruvate carboxykinase, glycerol-3-phosphate dehydrogenase and glucose transporter 4 were reduced when 1,25-dihydroxyvitamin D3 was added into differentiation medium. Also, 1,25-dihydroxyvitamin D3 inhibited preadipocyte differentiation in dose-dependent manner. These results suggested that 1,25-dihydroxyvitamin D3 inhibited porcine preadiopocyte differentiation through suppressing PPAR␥ and RXR␣ mRNA expressions and then down regulating the expression of adipogenesis-related genes. © 2007 Elsevier Ireland Ltd. All rights reserved. Keywords: 1,25-Dihydroxyvitamin D3 ; Proliferation; Differentiation; Adipogenesis; Porcine preadipocyte; In vitro

1. Introduction Abbreviations: 1,25(OH)2 D3 , 1,25-dihydroxyvitamin D3 ; Glut4, glucose transporter 4; GPDH, glycerol-3-phosphate dehydrogenase; LPL, lipoprotein lipase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide; PEPCK, phosphoenolpyruvate carboxykinase; PPAR␥, peroxisome proliferator-activated receptor-␥; RXR␣, retinoic X receptor ␣; SCD, stearoyl-CoA desaturase; VDR, vitamin D receptor ∗ Corresponding author. Tel.: +86 29 87092430; fax: +86 29 87092430. E-mail address: [email protected] (G.S. Yang).

The adipose tissue plays a critical role in the energy balance. When energy expenditure is lower than energy intake, excess triacylglycerols are stored in adipose tissue, which results in enlarged adipose tissue or obesity. Augmentation of adipose tissue can be caused by an increase in adipocyte size (hypertrophy) or adipocyte numbers (hyperplasia) which are differentiated from precursors. In the last two decades, the cellular and molecular mechanisms of adipocyte differentiation have

0009-2797/$ – see front matter © 2007 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.cbi.2007.07.012

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

been extensively studied using preadipocyte culture system. Much of our current understanding of the molecular regulation of adipogenesis comes from in vitro studies of preadipocyte cell lines, such as 3T3-L1, 3T3-F442A, and Ob1771 [1–3]. Adipocyte differentiation follows a well-defined program, involving several sequential stages over a period of 4–7 days [4,5]. Under the induction of prodifferentiative agents, including insulin, glucocorticoids, and phosphodiesterase inhibitor, the growth-arrested cells undergo one or two cell divisions known as mitotic clonal expansion, which is accompanied by the induction of C/EBP␤ and C/EBP␦. The adipocyte differentiating earliest molecular events are followed by increased expression of C/EBP␣ and PPAR␥, the central transcriptional regulators of adipogenesis, which drive adipocyte-specific genes expression. Subsequently, the cells are terminally differentiated into mature adipocytes. These differentiated cells now express marker genes of adipocyte phenotype, such as fatty acid synthase (FAS), lipoprotein lipase (LPL), acetyl-CoA carboxylase (ACC), glucose transporter 4 (Glut4) and fatty acid-binding protein aP2, along with massive accumulation of triglyceride inside the cells. In domestic animals, the mechanisms of adipocyte differentiation have been studied using primary culture systems [6,7]. The PPAR␥ and C/EBP␣ have been revealed to be important for porcine adipocyte differentiation [8–10]. Many researches focus on the effect of hormone on the differentiation of porcine adipocyte. All-trans retinoic acid (ATRA), an active metabolite of vitamin A, belongs to the steroid/thyroid hormone family, and potently inhibits the differentiation of clonal preadipocyte cell lines [11–13]. ATRA also effectively inhibited the differentiation of porcine preadipocytes in primary culture, suggesting that retinoid acid may regulate fat cell differentiation in growing animals [14–17]. Another steroid hormone, 1,25-dihydroxyvitamin D3 [1,25(OH)2 D3 ], the most active metabolite of vitamin D, plays a well-known role in mineral (calcium and phosphorus) homeostasis. This hormone is also involved in a host of cell processes, including immune function, cell growth and differentiation, and secretion of hormones. Several studies have explored the role of 1,25(OH)2 D3 in cell growth and differentiation in normal and tumoral mammary gland [18,19]. The antiproliferative effects of 1,25(OH)2 D3 in breast have been linked to suppression of growth-stimulatory signals and potentiation of growth-inhibitory signals, leading to changes in cell-cycle regulators as well as to induction of apoptosis [20]. 1,25(OH)2 D3 has previously been shown to regulate adipocyte differentiation in a conflicting

115

way. In early reports, vitamin D receptor (VDR)like molecule was detected in 3T3-L1 cells [21], and 1,25(OH)2 D3 was shown to have an inhibitory effect on 3T3-L1 differentiation on the basis of its inhibition of glycerophosphate dehydrogenase activity and triglyceride content [21,22] or its ability to counter the stimulatory effect of peroxisome proliferator-activated receptor-␥ (PPAR␥) ligand on 3T3-L1 differentiation [23]. 1,25(OH)2 D3 was also able to inhibit adipocyte differentiation in mouse bone marrow stromal cells [24]. On the other hand, 1,25(OH)2 D3 was shown to promote adipocyte differentiation in primary rat calvaria cells [25], rat bone marrow stromal cells [26] and to stimulate LPL expression in 3T3-L1 cells [27,28]. Up to now there are no studies on effects of 1,25(OH)2 D3 on differentiation and proliferation of porcine adipocytes in vitro. We presumed that the mechanism underline the effects of 1,25(OH)2 D3 on the proliferation and differentiation of porcine preadipocyte through morphological changes, adipocyte numbers and volume and modulating the expression of adipogenic genes. In this study, we would like to know the effects of 1,25(OH)2 D3 on porcine preadipocyte during proliferation and differentiation. 2. Materials and methods 2.1. Chemicals and reagents 1,25(OH)2 D3 , bovine serum albumin, dimethyl sulfoxide (DMSO, cell culture grade), 3-(4,5dimethylthiazol-yl)-2,5-diphenyformazan bromide (MTT), transferrin, hydrocortisone and insulin were purchased from Sigma Chemical Co. (St. Louis, MO). Dulbecco’s modified Eagle’s medium (DMEM)/F12, Collagenase, TRIZOL Reagent, First Strand cDNA Synthesis Kit and Taq DNA polymerase were purchased from Invitrogen (CA, USA). Penicillin/streptomycin, phosphate-buffered saline (PBS), trypsin-EDTA and Fetal bovine serum (FBS) (heat inactivated) were purchased from Gibco-Invitrogen. Electrophoresis reagents were from Bio-Rad Laboratories (Richmond, CA). Unless otherwise specified, other reagents were purchased from Sigma Chemical Co. (St. Louis, MO). 2.2. Experimental animals Three 3-day-old male crossbred piglets (Duroc × Landrace × Large-White) were purchased from the experimental farm of Northwest A & F University (Yangling, Shaanxi, China) and killed with electrocution.

116

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

2.3. Adipose tissue collection, porcine preadipocytes isolation and primary culture Adipose tissue was removed from dorsal subcutaneous adipocyte tissue. Primary culture of porcine preadipocytes was carried out using previously described methods [29]. The adipose tissue was cut into pieces (approximately 1 mm3 ) and rinsed with PBS, and then digested in Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 (a 1:1 mixture of DMEM and Ham’s F12) containing 1 mg/ml collagenase, 100 mM HEPES and 2% bovine serum albumin, at 37 ◦ C for 1 h in a shaking water bath. To remove undigested tissue fragments and large cell aggregates, digested tissue suspension was filtered through 200 ␮m nylon mesh and centrifuged at 800 × g for 5 min to separate the mature adipocytes and stromal-vascular fraction (S V fraction). The S V fraction was then incubated with erythrocyte lysis buffer (0.154 M NH4 Cl, 10 mM KHCO3 , 0.1 mM EDTA) at room temperature for 10 min, The pellets collected by centrifugation were used as preadipocytes. The preadipocytes were washed twice with DMEM/Ham’s F12 medium supplemented with 50 U/ml penicillin and 50 U/ml streptomycin. Then the cells were resuspended in DMEM/Ham’s F12 medium containing 10% fetal bovine serum (FBS), 50 U/ml penicillin and 50 U/ml streptomycin. Preadipocytes were cultured in a growth medium containing DMEM/F12, HEPAS, NaHCO3 , 10% FBS at 37 ◦ C in humidified incubator with 5% CO2 until 50% confluency. Two days later (referred to as day-1), the cells were switched to differentiation media (DM), consisting of DMEM supplemented with 10% FBS, 100 mM insulin, 10 ␮g/ml of transferrin, and 50 ng/ml hydrocortisone and cultured for 2 days. Depending on the purpose of the experiment, 1,25(OH)2 D3 was added in the DM at the indicated doses and at different times (Fig. 1). Culture medium was changed every 2 days until day 7. Each experiment was performed with a single batch of porcine preadipocytes isolated from the subcutaneous adipose tissue of an individual pig. 2.4. 1,25(OH)2 D3 design experiments In order to investigate the effects of 1,25(OH)2 D3 on proliferation and differentiation of porcine preadipocyte, we treated cells with 1,25(OH)2 D3 in culture medium, For proliferation assay 1,25(OH)2 D3 was added at day-1 and cells were harvested at days 1, 3, 5 and 7. Duration of the treatment corresponding to the time frame was 2, 4, 6 and 8 days. For GPDH activity and oil red O staining, cells were treated from day-1 to 7 for a period of 8 days.

Fig. 1. Schematic time line of 1,25(OH)2 D3 treatment. Porcine preadipocytes were seeded at a concentration of 5 × 104 cells/cm2 in growth medium, and incubated at 37 ◦ C for 2 days, then change into the differentiation medium (designed day-1). To investigate the expressions of adipose tissue related genes, 1 ␮M of 1,25(OH)2 D3 was added into the medium (↓) at days-1 and 3 and removed (↑) at days 1 and 5. Gray boxes indicate treatment with 1,25(OH)2 D3 and open boxes represent recuperation after the treatment. The lines with arrow show the duration of treatment for proliferation and differentiation studies.

In order to study effects of presence and following by absence of 1,25(OH)2 D3 on gene expression, the treatment was performed as following: 1,25(OH)2 D3 was added in culture medium at day-1 and removed at day 1, the same procedure was repeated once at days 3 and 5 (Fig. 1). Therefore, the cells, harvested at different days, received different treatments as following: at day 1, 2 days treatment; at day 3, 2 days treatment following 2 days recuperation; at day 5, two periods of 2 days treatment interrupted by 2 days recuperation and at day 7, twice the treatment as at day 3. 2.5. Preadipocyte proliferation assay Preadipocyte proliferation was evaluated by 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay according to Pieters et al’s methods [30]. Cells were cultured in DMEM/F12 supplemented with 10% FBS in 96-well plates. 1,25(OH)2 D3 was added in each well at day-1. Proliferation was assessed at days 1, 3, 5, and 7. At each time frame, cells were washed twice in PBS and harvested. The assay was initiated by incubation with 225 ␮l fresh growth medium and 25 ␮l of MTT stock solution of 5 mg/ml in PBS (final concentration 0.5 mg/ml) for 4 h at 37 ◦ C. The MTT media was aspirated and the accumulated purple formazan was dissolved in 150 ␮l DMSO on a shaker (160 rpm at room temperature) for 10 min. The absorbance at 490 nm was measured and background absorbance was corrected by the absorbance of an empty well.

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

28 28 27 27 27 28 27 27 60.1 56 54.3 63.4 54.7 54.7 62.9 55–56

Differentiation was determined by incorporation of oil red O (ORO) in porcine preadipocytes after 1,25(OH)2 D3 treatment. Porcine preadipocytes were washed with phosphate-buffered saline three times, fixed in 10% formaldehyde for 30 min and then stained in 10% ORO for 10 min. In order to remove free ORO, cells were treated with 60% isopropanol for 30 s with gentle agitation. Finally, after the cells were rinsed with PBS, morphology was examined and photographed using a microscope. 2.7. Glycerol-3-phosphate dehydrogenase activity assay

367 595 183 280 262 150 293 399

Multiplex PCR cycle

2.6. Cell differentiation

Ta (◦ C)

Sus scrofa Sus scrofa Sus scrofa Sus scrofa Sus scrofa Human Sus scrofa Mouse

GPDH activity (glycerol-3-phosphate dehydrogenase) was determined according to Hauner et al.’s methods [31]. After 8 days of treatment with 1,25(OH)2 D3 , the medium was removed from the 24well plates. The cells were rinsed three times with PBS, digested with 0.25% trypsase, centrifuged, resuspended in PBS, and sonicated. The samples were centrifuged at 7000 g for 15 min at 4 ◦ C, and the infranatant was used for GPDH activity assay in a solution containing 100 mM triethanolamine/HCl, pH 7.5, 2.5 mM EDTA, 0.12 mM NADH, 0.2 mM dihydroxyacetone phosphate, and 0.1 mM mercaptoethanol. All reagents were obtained from Sigma. The change in absorbance at 340 nm was used to calculate the rate. Activities were measured as mUnits GPDH per mg of protein (1 mU being equal to the oxidation of 1 nmol of NADH/min) and data are shown as % control. The protein content of the extracts was measured with a modification of Lowry et al.’methods [32]. Note: Indicate forward and reverse primers, respectively.

DQ279926 DQ437884 NM 214286 AY487829 AY509878 NM 000408 AB005285 NM 007393 RXR␣ PPAR␥ LPL SCD PEPCK GPDH Glut4 ␤-Actin

F:5 CATGCCGGTGGAGAAGATC 3;

R:5 CGTCAGCACCCTGTCAAAGAT 3

F:5 TGACCCAGAAAGCGATGC 3; R:5 CCTGATGGCGTCGTTATGAGACA 3 F:5 GCAGGAAGTCTGACCAATAAG 3; R:5 GGTTTCTGGATGCCAATAC 3 F:5 TCTGGGCGTTTGCCTACTATCT 3; R:5 TCTTTGACGGCTGGGTGTTT 3 F:5 ATGTGGTGGCTAGTATGCG 3; R:5 AGAGGCGATGCGAAGG 3 F:5 TGCCATTGCTCTGACTGC 3; R:5 TCAAATTCCTGCCCTGTG 3 F:5 TTGTCCTCGCCGTCTTCTCC 3; R:5 CAGCACTGCCAGGGTGTTATT 3 F:5 CTGCCGCATCCTCTTCCTC 3; R:5 CTCCTGCTTGCTGA CCACATC 3

Product size (bp) Species Access number Oligonucleotides (5 →3 ) Gene

Table 1 Oligonucleotide polymerase chain reaction primers

117

2.8. RNA isolation and semi-quantitative RT-PCR for mRNA expression of RXRα, PPARγ, LPL, SCD, PEPCK, GPDH and Glut4 At days 1, 3, 5 and 7 of culture, cells were harvested and total cellular RNA was extracted from primary cultured by using TRIZOL Reagent following the manufacturer’s protocol. After DNase treatment, RNA was quantified by spectrophotometer at 260 and 280 nm. Quality of the RNA was evaluated by electrophoresis. 5 ␮g of total RNA was reverse-transcribed at 42 ◦ C with First Strand cDNA Synthesis Kit. The transcribed cDNA was amplified with Taq DNA polymerase by PCR for 27–28 cycles. The PCR conditions were as following: denaturing at 94 ◦ C for 50 s (5 min in the first

118

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

Fig. 2. Time- and concentration-dependent effect of 1,25(OH)2 D3 on porcine preadipocyte. Porcine preadipocytes were treated with 1 × 10−10 mol/l, 1 × 10−8 mol/l and 1 × 10−6 mol/l 1,25(OH)2 D3 for 2, 4, 6, and 8 days, respectively. Cells were incubated with MTT, and then detected the absorbance at 490 nm. Data are means ± S.D. from three experiments (P-value relative to control group, P < 0.05).

cycle), annealing for 30 s, and extension at 72 ◦ C for 2 min (10 min in the last cycle). The annealing temperatures varied for different genes: RXR, 60.1 ◦ C; PPAR␥, 56 ◦ C; LPL, 54.3 ◦ C; SCD, 63.4 ◦ C; PEPCK, 54.7 ◦ C; GPDH, 54.7 ◦ C; Glut4, 62.9 ◦ C; ␤-actin, 55.7 ◦ C. The PCR products were separated by electrophoresis using 1% agarose gels and then photographed. Oligonucleotide primers and annealing temperature are listed in Table 1. All primers were chosen according to sequences in GeneBank. ␤-Actin was used as an internal control. 2.9. Statistical analyses Results were expressed as the means ± S.D. One-way ANOVA followed by multiple comparisons of means of Fisher’s LSD was performed using SPSS 13.0 (Chicago, Illinois, USA). Statistical significance level was set at P < 0.05. 3. Results 3.1. Effects of 1,25(OH)2 D3 on proliferation of porcine preadipocyte The cellular growth characteristics of preadipocyte were studied by cell viability assay (MTT) after 2, 4, 6 and 8 days treatment with different concentrations of 1,25(OH)2 D3 . Fig. 2 shows the comparison of the proliferation rate among alterable concentrations of 1,25(OH)2 D3 . Differences in growth rates were observed after 2 days treatment with high concentrations of 1,25(OH)2 D3 . The result revealed that the effect of 1,25(OH)2 D3 inhibited porcine proliferation in a dose- and time-dependent manner.

Fig. 3. Dose-dependent effects of 1,25(OH)2 D3 on glycerol-3phosphate dehydrogenase (GPDH) activity in porcine preadipocytes after 8 days treatment. Data are means ± S.D. from six experiments.

3.2. Effects of 1,25(OH)2 D3 on GPDH activity and differentiation of porcine preadipocytes We evaluated the inhibition of 1,25(OH)2 D3 on differentiation of porcine preadipocytes by glycerol-3phosphate dehydrogenase (GPDH) activity assay and ORO staining. GPDH activity was often used as a marker of differentiation since GPDH gene is expressed in mature adipocyte cells, but not in undifferentiated porcine preadipocytes. Porcine preadipocytes which were treated with different concentration of 1,25dihydroxyvitamin D3 (from 1 × 10−10 to 1 × 10−6 M) had significantly lower GPDH activity at day 7 in a dose-dependent manner (P < 0.05; Fig. 3). Inhibition of the differentiation was also showed by oil red O staining., As shown in Fig. 4, the inhibition on the formation of adipocytes with 1,25(OH)2 D3 was also dose-dependent. Reduction of lipid droplets was observed at 1,25(OH)2 D3 treatment (Fig. 4). 3.3. Expression of RXRα, PPARγ, LPL, SCD, PEPCK, GPDH and Glut4 mRNA in preadipocytes Total mRNA was extracted from cells following either different 2 or 4 days treatment by 1,25(OH)2 D3 . The 1,25(OH)2 D3 significantly decreased (P < 0.05) the mRNA abundance of the RXR␣ gene in comparison to control at day 1 (Fig. 5D). The decreases were greater at day 5 (P < 0.05). However, this effect was reversed in absence of 1,25(OH)2 D3 at day 3 and 7 (P < 0.05). Similarly, 1,25(OH)2 D3 significantly decreased (P < 0.05)

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

119

Fig. 4. Oil red O staining of differentiated porcine preadipocytes. 1,25(OH)2 D3 blocks porcine preadipcytes differentiation into mature adipocytes in a dose-dependent manner. Porcine preadipocytes were cultured in differentiation medium (DM) with different doses of 1,25(OH)2 D3 as following: 1 × 10−10 mol/l (A); 1 × 10−9 mol/l (B); 1 × 10−8 mol/l (C); 1 × 10−7 mol/l (D); 1 × 10−6 mol/l (E).

the mRNA abundance for the PPAR␥ gene at day 1, 3 and 5 (Fig. 5C), and this effect was reversed in absence of 1,25(OH)2 D3 at day 7. The preadipocyte differentiation mark gene LPL was decreased in presence of 1,25(OH)2 D3 at day 1 and 5 (P < 0.05), but the effect was completely reversible without treatment of 1,25(OH)2 D3 at day 3 and 5 (P < 0.05) (Fig. 5E). Likewise, 1,25(OH)2 D3 significantly decreased (P < 0.05) the mRNA abundance for adipogenic genes, PEPCK, SCD, GPDH and Glut4 at both day 1 and 5, and the effect was reversed at day 3 and 7 without 1,25(OH)2 D3 treatment (Fig. 5F–I) (P < 0.05). 4. Discussion Obesity is characterized by increase in both adipocyte size and number. Adipose tissue is thus linked to the adipocyte dynamic role. However, adipose tissue loss during weight reduction due to antiproliferation and apoptosis is a relatively new concept. Our results showed that 1,25(OH)2 D3 inhibited the porcine preadipocyte proliferation in dose-dependent manner. The inhibition may be caused by induction of apoptosis by 1,25(OH)2 D3 treatment. The early reports pointed out that low doses of 1,25(OH)2 D3 inhibited apoptosis in differentiated 3T3-L1 cells in a dose-dependent manner, whereas high doses can stimulate the adipocyte apoptosis [39].

Experiments on porcine preadipocyte indicated that different vitamins can promote porcine preadipocyte into apoptosis. Our previous data have demonstrated that high doses of vitamin C induced rat adipocyte apoptosis. Recently, we also have found that 9-cis retinoic acid, the most active form of vitamin A, promoted porcine adipocyte apoptosis [data unpublished]. These results were consistent with the previous report that retinoid induced the apoptosis of MCF-7 [33]. However, the regulation mechanism of porcine preadipocyte apoptosis needs the further study. 1,25(OH)2 D3 has been reported to inhibit adipocyte differentiation in 3T3-L1 cells for more than a decade, but the molecular mechanism underlying this inhibition remains unclear, especially in porcine. Our objective was to identify the molecular changes caused by 1,25(OH)2 D3 treatment during adipogenesis of porcine preadipocytes. Our study on porcine preadipocyte demonstrated that 1,25(OH)2 D3 inhibits adipogenesis presumably by suppressing PPAR␥ and RXR␣ expressions (Fig. 5C and D). When 1,25(OH)2 D3 was added into culture medium, PPAR␥ and RXR␣ functions were antagonized, and their down-stream genes expression were blocked. Consequently, adipocyte marker genes, LPL and GPDH expressions were reduced. When 1,25(OH)2 D3 was removed from culture medium, the expression of LPL

120

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

and GPDH were increased (Fig. 5E and H). Together with the recent finding that 1,25(OH)2 D3 inhibited the 3T3-L1 cells differentiation on multi-levels, for instant, morphologic, enzymatic and protein expression, we speculated that 1,25(OH)2 D3 inhibits porcine adipocyte differentiation by acting on multiple molecular targets. Our second objective was to investigate the effects of 1,25(OH)2 D3 on the expression of adipogenic genes: SCD, Glut4 and PEPCK. Previous studies have shown that different substances can modulate the expression of SCD in differentiation of 3T3-L1 cells and in primary adipocytes. Insulin and TNF-␣ [34] specifically reduced the mRNA level of SCD but vitamin C had an increas-

ing effect [35]. In the present study, we showed that 1,25(OH)2 D3 reduced SCD gene expression (Fig. 5G). Glut4 is one of the glucose transporters, and expressed in high levels in white, brown adipoctyes, cardiac and skeletal myocytes. Previous data showed that mRNA and protein levels of Glu4 were up-regulated by transcriptional factors during differentiation of adipocytes [36]. Our results also proved that 1,25(OH)2 D3 decreased the expression of Glut4 in differentiation of porcine preadipocytes at days 1 and 5 (Fig. 5I). This process could be a potential target for inhibition of adipogenesis in porcine. PEPCK, a key enzyme in glyceroneogenesis, is an important metabolic pathway to restrain the

Fig. 5. The effect of 1,25(OH)2 D3 on the expression of transcript factors and adipogenic genes. Porcine preadipocytes were isolated from porcine dorsal subcutaneous adipose tissue, seeded at a concentration of 5 × 104 cells/cm2 , incubated for 48 h at 37 ◦ C and then cultured in the absence or presence of 10−6 M of 1,25(OH)2 D3 as indicated in Fig. 1. Cells were harvested and total cellular RNAs were extracted at day 1, 3, 5, or 7. Semi-quantitative reverse-transcription PCR analysis was performed in absence (A) and presence (B) of 1,25(OH)2 D3 . Intensities of PCR products were measured for PPAR␥ (C), RXR␣ (D), LPL (E), PEPCK (F), SCD (G), GPDH (H), Glut4 (I) and ␤-actin. Data are means ± S.D. from three experiments. Different letters on top of the columns show a significant difference (P < 0.05) to other treatments.

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

Fig. 5. (Continued ).

121

122

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123

release of non-esterified fatty acids from adipocytes. C/EBP family members can transactivate PEPCK gene in hepatocytes via promoter proximal C/EBP response elements [37]. Our experiments indicated that during porcine preadipocyte differentiation, PEPCK mRNA was significantly decreased with 1,25(OH)2 D3 treatment and significantly increased in absence of 1,25(OH)2 D3 (Fig. 5F). Thus, the regulation of PEPCK mRNA transcript was an important part during porcine preadipocyte differentiation. We could not detect the 1,25(OH)2 D3 specific receptor VDR mRNA during the later differentiation stage. The other researches reported that in 3T3-L1 cells VDR expression was drastically increased within 4–8 h of the differentiation and gradually declined with the progression of differentiation before 16 h [38]. GPDH activity, LPL mRNA level and accumulation of lipid were reduced by 1,25(OH)2 D3 treatment throughout the differentiation period (Fig. 5E). In contrast, the effects of the treatment in the early phase of differentiation were modest. These results suggested that 1,25(OH)2 D3 can continuously suppress porcine preadipocyte differentiation throughout the differentiation period. In this study, 1,25(OH)2 D3 was shown not only to inhibit the cell proliferation, but block the differentiation of porcine preadipocyte. Our results indicated that 1,25(OH)2 D3 plays a pivotal role in the inhibition of porcine adipocyte differentiation due to suppressions of transcription factors PPAR␥ and RXR␣, which further down regulating the adipogenesis-related genes LPL, SCD, PEPCK, GPDH and Glut4 expressions. Acknowledgements The authors thank Dr. Shupei Wang (Montreal, Canada) and Dr. Bin Wu (Arizona, USA) for their suggestions and English correction of the manuscript. This work was supported by National Natural Sciences Foundation of China (No. 30471239). References [1] H. Green, M. Meuth, An established preadipose cell line and its differentiation in culture, Cell 3 (1974) 127–133. [2] H. Green, O. Kehinde, Spontaneous heritable changes leading to increased adipose conversion in 3T3 cells, Cell 7 (1976) 105–113. [3] R. Negrel, P. Grimaldi, G. Ailhaud, Establishment of preadipocyte clonal line from epididymal fat pad of ob/ob mouse that responds to insulin and to lipolytic hormones, Proc. Natl. Acad. Sci. U.S.A. 75 (1978) 6054–6058. [4] S.M. Rangwala, M.A. Lazar, Transcriptional control of adipogenesis, Annu. Rev. Nutr. 20 (2000) 535–539. [5] E.D. Rosen, B.M. Spiegelman, Moelcular regulation of adipogenesis, Annu. Rev. Cell Dev. Biol. 16 (2000) 145–171.

[6] G.J. Hausman, J.T. Wright, R. Dean, R.L. Richardson, Cellular and molecular aspects of the regulation of adipogenesis, J. Anim. Sci. 71 (Suppl. 2) (1993) 33–55. [7] R.L. McNeel, S.T. Ding, E.O. Smith, H.J. Mersmann, Expression of porcine adipocyte transcripts during differentiation in vitro and in vivo, Comp. Biochem. Physiol. B126 (2000) 291–302. [8] G.J. Hausman, The influence of dexamethasone and insulin on expression of CCAAT/enhancer binding protein isoforms during preadipocyte differentiation in porcine stromal-vascular cell cultures: evidence for very early expression of C/EBPalpha, J. Anim. Sci. 78 (2000) 1227–1235. [9] G.J. Hausman, Dexamethasone induced preadipocyte recruitment and expression of CCAAT/enhancing binding protein alpha and peroxisome proliferator activated receptor-gamma proteins in porcine stromal-vascular (S-V) cell cultures obtained before and after the onset of fetal adipogenesis, Gen. Comp. Endocrinol. 133 (2003) 61–70. [10] Z.K. Yu, G.J. Hausman, Expression of CCAAT/enhancer binding proteins during porcine preadipocyte differentiation, Exp. Cell Res. 245 (1998) 343–349. [11] A. Chawla, M.A. Lazar, Peroxisome proliferator and retinoid signaling pathways co-regulate preadipocyte phenotype and survival, Proc. Natl. Acad. Sci. U.S.A. 91 (1994) 1786–1790. [12] J.C. Xue, E.J. Schwarz, A. Chawla, M.A. Lazar, Distinct stages in adipogenesis revealed by retinoid inhibition of differentiation after induction of PPARgamma, Mol. Cell. Biol. 16 (1996) 1567–1575. [13] T. Kawada, Y. Kamei, A. Fujita, Y. Hida, N. Takahashi, E. Sugimoto, T. Fushiki, Carotenoids and retinoids as suppressors on adipocyte differentiation via nuclear receptors, Biofactors 13 (2000) 103–109. [14] H.S. Kim, G.J. Hausman, D.B. Hausman, R.J. Martin, R.G. Dean, The expression of peroxisome proliferator-activated receptor gamma in pig fetal tissue and primary stromal vascular cultures, Obes. Res. 8 (2000) 83–88. [15] H.S. Kim, G.J. Hausman, D.B. Hausman, R.J. Martin, R.G. Dean, The expression of cyclin D1 during adipogenesis in pig primary stromal–vascular cultures, Obes. Res. 9 (2001) 572–578. [16] A. Suryawan, C.Y. Hu, Effect of retinoic acid on differentiation of cultured pig preadipocytes, J. Anim. Sci. 75 (1) (2005) 112– 117. [17] T.D. Brandebourg, C.Y. Hu, Regulation of differentiating pig preadipocytes by retinoic acid, J. Anim. Sci. 83 (2005) 98–107. [18] K. Colston, C.M. Hansen, Mechanisms implicated in the growth regulatory effects if vitamin D in breast cancer, Endor. Relat. Cancer 9 (2001) 45–49. [19] J. Welsh, J.A. Wietzke, G.M. Zinser, B. Byrne, K. Smith, C.J. Narvaez, Vitamin D3 receptor as a target for breast cancer prevention, J. Nutr. 133 (2003) 2425S–2433S. [20] J. Welsh, J.A. Wietzke, G.M. Zinser, S. Smyczek, S. Romu, E. Tribble, J.C. Welsh, B. Byrne, C.J. Narvaez, Impact of the vitamin D3 receptor on growth-regulatory pathways in mammary gland and breast cancer, J. Steroid Biochem. Mol. Biol. 83 (2003) 85–92. [21] M. Sato, A. Hiragun, Demonstration of 1 alpha,25dihydroxyvitamin D3 receptor-like molecule in ST 13 and 3T3 L1 preadipocytes and its inhibitory effects on preadipocyte differentiation, J. Cell. Physiol. 135 (1988) 545–550. [22] T. Kawada, Y. Kamei, E. Sugimoto, The possibility of active form of vitamins A and D as suppressors on adipocyte development via ligand dependent transcriptional regulators, Int. J. Obes. Relat. Metab. Disord. 20 (Suppl. 3) (1996) S52–S57.

H. Zhuang et al. / Chemico-Biological Interactions 170 (2007) 114–123 [23] Y. Hida, T. Kawada, S. Kayahashi, T. Ishihara, T. Fushiki, Counteraction of retinoic acid and 1,25-dihydroxyvitamin D3 on up-regulation of adipocyte differentiation with PPARgamma ligand, an antidiabetic thiazolidinedione in 3T3-L1 cells, Life Sci. 62 (1998) 205–211. [24] K.A. Kelly, J.M. Gimble, 1,25-Dihydroxy vitamin D3 inhibits adipocyte differentiation and gene expression in murine bone marrow stromal cell clones and primary cultures, Endocrinology 139 (1998) 2622–2628. [25] C.G. Bellows, Y.H. Wang, J.N. Heersche, J.E. Aubin, 1,25dihydroxyvitamin D3 stimulates adipocyte differentiation in cultures of fetal rat calvaria cells: comparison with the effects of dexamethasone, Endocrinology 134 (1994) 2221–2229. [26] H. Atmani, D. Chappard, M.F. Basle, Proliferation and differentiation of osteoblasts and adipocytes in rat bone marrow stromal cell cultures: effects of dexamethasone and calcitriol, J. Cell. Biochem. 89 (2003) 364–372. [27] U. Querfeld, M.M. Hoffmann, G. Klaus, F. Eifinger, M. Ackerschott, D. Michalk, P.A. Kern, Antagonistic effects of vitamin D and parathyroid hormone on lipoprotein lipase in cultured adipocytes, J. Am. Soc. Nephrol. 10 (1999) 2158–2164. [28] D. Vu, J.M. Ong, T.L. Clemens, P.A. Kern, 1,25-Dihydroxyvitamin D induces lipoprotein lipase expression in 3T3-L1 cells in association with adipocyte differentiation, Endocrinology 137 (1996) 1540–1544. [29] Y. Li, G.S. Yang, R.H. Lu, Optimal culture method of the porcine preadipocyte, Chin. J. Cell Biol. 27 (2005) 697–700. [30] R. Pieters, A.H. Loonen, D.R. Huismans, G.J. Broekema, M.W.J. Dirven, M.W. Heyenbrok, K. Hahlen, A.J.P. Veerman, In vitro drug sensitivity of cells from children with leukemia using the MTT assay with improved culture conditions, Blood 76 (1990) 2327–2336.

123

[31] H. Hauner, G. Entenmann, M. Wabitsch, D. Gaillard, G. Ailhaud, R. Negrel, E.F. Pfeiffer, Promoting effect of glucocorticoids on the differentiation of human adipocyte precursor cells cultured in a chemically defined medium, J. Clin. Invest. 84 (1989) 1663– 1670. [32] G.L. Peterson, A simplification of the protein assay method of Lowry et al. which is more generally applicable, Anal. Biochem. 83 (1977) 346–356. [33] M.I. Dawson, W.R. Chao, P.D. Hobbs, X.K. Zhang, Effects of trans-retinoic acid, 9-cis-retinoic acid, 1␣, 25-(dihydroxy)vitamin D3 and a novel apoptosis-inducing retinoid on breast cancer and endothelial cell growth, Cancer Lett. 133 (1) (1998) 1–8. [34] F.F. Chen, G.S. Yang, J.X. Lu, Transcription expression of six genes following differentiation of rat preadipocyte to adipocyte in primary culture, Chin. Biotechnol. Bull. 6 (2005) 73–76. [35] H.L. Zhung, Y.Q. Lin, G.S. Yang, Vitamin C promotes proliferation and differentiation of porcine preadipocytes by modulating transcription of adipogenesis-related genes, Chin. J. Biochem. Mol. Biol. 23 (6) (2007) 499–507. [36] W.B. Shang, Y. Yang, B.R. Jiang, H. Jin, L.B. Zhou, S.Q. Liu, M.D. Chen, Ginsenoside Rb1 promotes adipogenesis in 3T3-L1 cells by enhancing PPAR␥2 and C/EBP␣ gene expression, Life Sci. 80 (7) (2007) 618–625. [37] W.E. Darrell, C.W. Simon, G.B. Elmus, C/EBP␤ Interacts with the penolpyruvate carboxykinase adipocyte-specific enhancer, Biochem. Biophys. Res. Commun. 285 (3) (2001) 811–819. [38] J. Kong, Y.C. Li, Molecular mechanism of 1,25-dihydroxyvitamin D3 inhibition of adipogenesis in 3T3-L1 cells, Am. J. Physiol. Endocrinol. Metab. 290 (2006) 916–924. [39] X.C. Sun, M.B. Zemel, Role of uncoupling protein 2(UCP2) expression and 1,25-dihydroxyvitamin D3 in modulating adipocyte apoptosis, FASEB J. 18 (2004) 1430–1432.