Effects of live yeast supplementation on lipopolysaccharide-induced inflammatory responses in broilers

Effects of live yeast supplementation on lipopolysaccharide-induced inflammatory responses in broilers Weiwei Wang, Zhui Li, Wanli Ren, Yunshuang Yue, and Yuming Guo1 State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, P. R. China

Key words: broiler, lipopolysaccharide, live yeast, inflammation 2016 Poultry Science 0:1–8 http://dx.doi.org/10.3382/ps/pew191

INTRODUCTION

transmembrane signal transducer and detect pathogenassociated molecules (Dobrovolskaia and Vogel, 2002; Takeuchi and Akira, 2010). Among TLR family, TLR4 is the predominant one to recognize LPS and activate the intracellular pathways downstream of it (Dobrovolskaia and Vogel, 2002; Takeuchi and Akira, 2010), triggering the production of pro-inflammatory cytokines such as interleukin-1β (IL-1β ), which subsequently result in compromised health condition and growth performance in animals (Klasing, 1988; Takahashi et al., 2008). With the ban or restriction of antibiotics due to the increases in drug residues and drug-resistant bacteria, a variety of different approaches to modulate bacterial action and immune responses had been explored to attenuate bacteria-induced disorders in production. Live yeast (LY, Saccharomyces cerevisiae)-based probiotic had exhibited promise as a substitute for antibiotics, as it is capable of eliciting modulation of bacterial population (Heugten et al., 2003; Monroy-Salazar et al., 2012) concurrent with immune responses in animals (Badia et al., 2012; Jang et al., 2013; Trckova et al., 2014). Protective roles for animals were also found with LY (S. cerevisiae) addition, which resulted in the mitigatory bacteria-associated immunologic

Bacterial infection has been shown to induce systemic inflammatory responses in broilers (Coble et al., 2011), which could change the partitioning of nutrients away from body protein accretion to support the immune responses, thereby reducing the growth potential of broilers (Roura et al., 1992). Even in normal condition, birds are ineluctably confronted with the stress related to bacteria or its products like lipopolysaccharide (LPS) that could cause intensive systemic inflammatory responses (Roura et al., 1992; Takahashi et al., 2008) and induce the subsequent suppression of health status and growth performance in birds (Roura et al., 1992; Xie et al., 2000). LPS is an ingredient in cell wall of Gram-negative bacteria and had been utilized to imitate bacterial infection and induce inflammatory responses in broilers (Takahashi et al., 2008; Munyaka et al., 2013). LPS could be recognized by some members of toll-like receptors (TLR), which are the important

 C 2016 Poultry Science Association Inc. Received February 4, 2016. Accepted April 16, 2016. 1 Corresponding author: [email protected]

1

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

immunological status. LY addition tended to alleviate (P = 0.097) LPS-induced increase in serum α-acid glycoprotein content on d 27. LPS induced increased (P < 0.05) serum nitric oxide content and myeloperoxidase activity on d 21 and 27, however, there was a tendency towards reduced (P < 0.10) serum nitric oxide content and myeloperoxidase activity on d 21 in response to LY inclusion. Besides, LY-fed birds had lower (P < 0.05) serum nitric oxide content on d 27 relative to the control counterparts. LPS resulted in increased (P < 0.05) relative mRNA expression of splenic interleukin-1β on d 21 and 27, but which was lower (P < 0.05) in LY-treated birds compared with that in control. In conclusion, dietary supplementation of LY had potential to alleviate LPS-induced inflammation in broilers.

ABSTRACT The effects of supplemental live yeast (LY) on inflammatory responses in broilers challenged with lipopolysaccharide (LPS) were investigated. Oneday-old broilers were randomly divided into two treatment groups with two subgroups of each (8 replicate pens; 10 birds/pen) and were fed a basal diet without or with 0.5 g/kg of LY (Saccharomyces cerevisiae NCYC 47Hr+, 1.0 × 1010 CFU/g). Birds from each subgroup of the two treatment groups were intra-abdominally injected with LPS (1.5 mg/kg of BW) or saline at 21, 23, 25, and 27 d of age. Samples were obtained after 8 h of the first injection (d 21) and the last injection (d 27), respectively. Results showed that no treatment differences (P > 0.05) were detected in the relative spleen and bursa weights, as well as serum lysozyme activity and ceruloplasmin content regardless of the

2

WANG ET AL.

MATERIALS AND METHODS Experimental Design The experimental animal protocol for this study was approved by the Animal Care and Use Committee of China Agricultural University. A total of 320 one-dayold male broilers (Cobb 500) were obtained from a local commercial hatchery. Birds were weighed and randomly allocated into 2 treatment groups with 2 subgroups of each so that their initial body weights were similar across all the groups. Each subgroup involving 8 replicates with 10 birds per replicate. Birds in the 2 groups were received basal diet in mash form without or with 0.5 g/kg of LY (S. cerevisiae NCYC 47Hr+, 1.0 × 1010 CFU/g, Actisaf, Lesaffre Feed Additives, France). The composition of starter and grower diets that were respectively offered to the birds from 1 to 20 d of age and from 21 to 28 d of age are showed in Table 1. All birds were raised in wire floored cages in a three-level battery on their respective diets of an environmentally controlled house and were vaccinated using combined Newcastle disease virus and infectious bronchitis virus (HB1-H120) on d 1 through drinking water (carried out in the hatchery) and Newcastle disease virus (LaSota) on d 14 via intranasal and intraocular administration. Feed and fresh water were available ad libitum. Continuous lighting was provided in the house throughout the trial period and temperature was controlled with heaters and gradually reduced from 34◦ C on d 1 to 24◦ C on d 21 and then kept roughly constant. At 21, 23, 25, and 27 d of age, birds from each subgroup of the 2 treatments were intra-abdominally injected with Escherichia coli LPS (serotype O55:B5, Sigma Chemical Co., St. Louis, MO) at 1.5 mg/kg BW (LPS dissolved in saline at the dose of 1.5 mg/mL) or the same amount of saline (1 mL/kg BW), the dose of LPS administration referred to the study by Takahashi et al. (2008).

Table 1. Composition and nutrient levels of diets (air-dry basis). Stage Ingredients (%) Corn Soybean meal (43%, crude protein) Soybean oil Limestone Dicalcium phosphate Sodium chloride Phytase (5000 FTU/kg) Multivitamin1 Multimineral2 Choline chloride (50%) Antioxidant DL-Methionine (98%) L-Lysine·HCl (99%) Live yeast3 Nutrient levels Metabolizable Energy (Mcal/kg) Crude Protein (%) Available Phosphorus (%) Calcium (%) Lysine (%) Methionine (%)

1 to 20 d

21 to 28 d

56.18 37.63 2.37 1.67 1.05 0.35 0.03 0.02 0.20 0.26 0.02 0.20 0.02 +/-

61.66 31.87 3.13 1.61 0.79 0.35 0.02 0.02 0.20 0.20 0.02 0.12 0.01 +/-

2.90 21.00 0.45 1.00 1.15 0.50

3.00 19.00 0.40 0.90 1.00 0.40

1 Supplied per kilogram of diet: Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; Se, 0.15 mg; I, 0.35 mg. 2 Supplied per kilogram of diet: Vitamin A (retinyl acetate), 9,500 IU; Vitamin D3 , 2,500 IU; Vitamin K3 , 2.65 mg; Vitamin B1 , 2 mg; Vitamin B2 , 6 mg; Vitamin B12 , 0.025 mg; Vitamin E (α -tocopherol acetate), 30 IU; Biotin, 0.0325 mg; Folic acid, 1.25 mg; Pantothenic acid, 12 mg; Niacin, 50 mg. 3 Live yeast (Saccharomyces cerevisiae) was substituted for the same amount (0.05%) of soybean meal in LY group.

Sample Collection and Procedure One bird per replicate was randomly selected and weighed after 8 h of the first (21 d of age) and the last (27 d of age) injection for samples collection. Individual blood were taken aseptically from the wing vein. After placement for a certain time, blood were centrifuged at 3,000 rpm for 10 min at 4◦ C for the separation of serum samples, which were then stored at −30◦ C until analyzed. After blood collection, these birds were slaughtered rapidly, a little patch of spleen from each bird was immediately removed into RNA fixer (BioTeke Corporation, Beijing, China) and stored at −80◦ C for further measurement. Besides, spleen and bursa from each bird were excised and weighed at 8 h following the last injection to determine the relative organs (spleen and bursa) weight, which were expressed as the ratio of organ weight to body weight.

Serum Parameters Measurement Immunoglobulin including IgG, IgA, and IgM levels in serum were determined by double-antibody sandwich ELISA using commercial kits (Bethyl Laboratories Inc., Montgomery, TX). The procedure was performed as described by Iseri and Klasing (2013). Lysozyme activity was measured by the reduction speed of its substrate (micrococcus lysodeikticus), which was reflected by the change in transmissivity at the wavelength of 530 nm following the manufacturer’s recommendation

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

derangement and improved health status in pigs (Trckova et al., 2014; Trevisi et al., 2015). Furthermore, studies in mice found the roles of LY (S.cerevisiae) treatment associated with the anti-inflammatory properties (Jawhara et al., 2012). In vitro, it was also showed that LY (S. cerevisiae) relieved pathogen-induced inflammatory responses in porcine intestinal epithelial cells as revealed by the increased production of antiinflammatory cytokines coupled with the suppression of pro-inflammatory cytokines (Zanello et al., 2011a,b). However, there is still a lack of information concerning the effects of LY (S. cerevisiae) on inflammatory responses in chickens. Therefore, this study was conducted to evaluate whether dietary supplementation with LY alleviated the inflammation in broilers challenged with LPS.

LIVE YEAST AND BROILER INFLAMMATORY RESPONSES

3

Table 2. Primers used in the real time PCR. Genes1

Primer sequence2 (5 -3 )

Accession no.

β -Actin

F: GAGAAATTGTGCGTGACATCA R: CCTGAACCTCTCATTGCCA F: ACTGGGCATCAAGGGCTA R: GGTAGAAGATGAAGCGGGTC F: GAGCGTTGACTTGGCTGTC R: AAGCAACAACCAGCTATGCAC F: CGCTGTCACCGCTTCTTCA R: TCCCGTTCTCATCCATCTTCTC F: ACTGCCATGATGTGCAAAGTACTGATCT R: ATTTTTGGCCAAGATATCTCACAAAGTTGGT

L08165

IL-1β TL1A IL-10 IL-2

NM 204524 NM 204267 AJ621614 AF017645

1

IL = interleukin; TL = tumor necrosis factor-like ligand. F = forward; R = reverse. Primers for β -Actin and TL1A were designed as described previously (Li et al., 2015). Primers for IL-10 and IL-2 were described by Zhao et al. (2013) and Sato et al. (2012), respectively. 2

RNA Isolation and cDNA Synthesis Total RNA of the spleen sample was extracted using Trizol Reagent (Invitrogen biotechnology Inc., Carlsbad, CA) according to the manufacturer’s protocol. RNA pellet was dissolved in RNase-free water. Extracted RNA was quantified using a NanoDrop spectrophotometer (ND-2000 UV-Vis, Thermo Scientific Inc., MA) at an absorbance of 260 nm. Purity of RNA was confirmed by determining the absorbance ratio at 260 to 280 nm. RNA integrity was evaluated based on the spectral curve (Fleige and Pfaffl, 2006). cDNA samples were obtained by reverse transcription

of the RNA samples using a reagent kit PrimeScript RT Master Mix (Takara Biotechnology Inc., Osaka, Japan) in a 20 μL reaction volume containing 14 μL RNase-free dH2 O (5X), 4 μL PrimeScript RT Master Mix, and 2 μL RNA sample (500 ng/μL) following the manufacturer’s protocol. The reaction was carried out for 15 min at 37◦ C, 5 s at 85◦ C, and 2 min at 4◦ C and performed by a general PCR amplifier (EDC-810, Eastwin Life Science Inc., Beijing, China). The cDNA samples were stored at −20◦ C until analyzed.

Quantification of mRNA Expression by Real Time PCR Real time PCR for measuring the expression of inflammation-related genes in the spleen was carried out using SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara Biotechnology Inc., Osaka, Japan) in an ABI 7500 Real Time PCR Systems (Applied Biosystems, Foster City, CA). The expression of β -Actin was used as an internal control to normalize the amount of starting RNA used for real time PCR for each sample. Reaction volume of 20 μL mixture contained 10 μL SYBR Premix Ex Taq (Tli RNaseH Plus) (2X), 0.4 μL ROX Reference DyeII(50X), 0.4 μL of each forward and reverse primer (the sequences were showed in Table 2), 6.8 μL easy dilution, and 2 μL cDNA template. Optimized protocol for all the genes were 95◦ C for 30 s followed by forty cycles of 95◦ C for 5 s and 60◦ C 34 s. All measurements were carried out in triplicate and the average values were obtained. Real time PCR efficiency for each gene was figured out based on the slope of cDNA relative standard curve that was formulated using pooled samples, and the efficiency values were consistent between the housekeeping gene and target genes. The abundance of β -Actin mRNA was not impacted by dietary treatment or LPS injection. Specificity of the PCR products was evaluated by the analysis of the melting curve. Results of relative mRNA expression of inflammatory genes were calculated using 2−ΔΔCt method (Livak and Schmittgen, 2001).

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

(Jiancheng Biotechnology Institute, Nanjing, China). Nitric oxide (NO) content was determined by measuring the reaction product of it and Griess reagent, which was reflected by the optical density at the wavelength of 550 nm using a commercial test kit (Jiancheng Biotechnology Institute, Nanjing, China). Myeloperoxidase (MPO) was quantified by colorimetry according to the procedure of Wu et al. (2014), using a commercial test kit (Jiancheng Bioengineering Institute, Nanjing, China). α-acid glycoprotein (αAGP) was quantified by two-site ELISA. The assay used affinity purified anti-chicken α-AGP antibodies for solid phase immobilization and horseradish peroxidase conjugated anti-chicken AGP antibodies for detection. The methods of the assay were performed according to the manufacturer’s instructions (Genway Biotech Inc., San Diego, CA). Ceruloplasmin (Cer) was quantified by p-phenylenediamine colorimetry under the procedures of Takahashi et al. (2008). Commercial test kits (Jiancheng Biotechnology Institute, Nanjing, China) were used for the quantification of albumin and urea nitrogen (UN). Albumin content was assayed by measuring the reaction product of it and bromocresol green, which was reflected by the optical density at the wavelength of 628 nm. UN content was determined by its reduction speed using urease, which was reflected by the change in optical density at a wavelength of 640 nm.

4 Relative organs weight (g/kg BW)

WANG ET AL. Control

differ among serum levels of immunoglobulins including IgG, IgA, and IgM of birds on d 21 or 27 (Table 3). Dietary LY addition exerted no influence (P > 0.05) on the above parameters regardless of the immunological status in broilers.

LY

3.50 3.00 2.50

*

*

2.00 1.50

NO Content, Myeloperoxidase and Lysozyme Activities in Serum

1.00 0.50 0.00

saline

LPS

saline

Spleen

LPS

Bursa of Fabricius

Statistical Analysis Data were presented as mean ± standard error of the mean (SEM) and analyzed by two-way ANOVA to measure the main effects of LY and LPS and their interaction using general linear model procedure of SPSS 18.0 software. Differences between different treatment groups were analyzed by Duncan’s multiple comparisons. Significance was defined as P < 0.05 and 0.05 < P < 0.10 was considered as a tendency towards significance. If interaction was significant, one-way ANOVA would be adopted to analyze the results.

RESULTS

Serum Acute Phase Proteins and UN Contents As summarized in Table 5, exposure of broilers to LPS challenge resulted in increased (P < 0.05) serum Cer and UN contents on d 21, as well as serum α-AGP concentration (P < 0.05) on d 27. There tended to be an interaction for serum α-AGP concentration between dietary treatment and LPS injection, as evidenced by a tendency towards an alleviation (P = 0.097) of the elevated serum α-AGP concentration in LPS-challenged birds on d 27 by LY addition, which also simultaneously interacted with LPS challenge on serum UN content as revealed by the lower (P < 0.05) UN content in control birds rather than in LY-treated birds due to LPS challenge.

Relative Organs Weight and Serum Immunoglobulins Levels

Relative mRNA Expression of Splenic Inflammatory Genes

LPS resulted in an increased (P < 0.05) relative spleen weight and reduced (P < 0.05) relative bursa weight in broilers (Figure 1), but did not (P > 0.05)

Relative mRNA expression of cytokines in the spleen are presented in Table 6. LPS challenge up-regulated (P < 0.05) relative mRNA expression of splenic IL-1β ,

Table 3. Effects of live yeast (LY)1 on serum immunoglobulins levels in broilers challenged with lipopolysaccharide (LPS)2 (n = 8). d 21 Diet Control LY SEM P-value Diet LPS Interaction 1

d 27

LPS

IgG mg/mL

IgM mg/mL

IgA mg/mL

IgG mg/mL

IgM mg/mL

IgA mg/mL

− + − +

3.59 3.99 3.83 3.86 0.090

0.39 0.41 0.51 0.43 0.038

0.31 0.32 0.26 0.29 0.020

1.93 2.41 2.05 2.37 0.146

0.38 0.41 0.49 0.35 0.038

0.37 0.42 0.46 0.40 0.025

0.762 0.240 0.303

0.364 0.690 0.594

0.314 0.690 0.764

0.894 0.185 0.781

0.746 0.451 0.256

0.518 0.938 0.318

LY (Saccharomyces cerevisiae) was supplemented at 0.5 g/kg of diet. Birds were intra-abdominally injected with LPS (1.5 mg/kg of BW) or the same amount of saline at 21, 23, 25 and 27 d of age. 2

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

Figure 1. Effects of live yeast (LY)1 on the relative organs weight in broilers post the last (27 d of age) lipopolysaccharide (LPS) injection2 (n = 8). 1 LY (Saccharomyces cerevisiae) was supplemented at 0.5 g/kg of diet. 2 Birds were intra-abdominally injected with LPS (1.5 mg/kg of BW) or the same amount of saline at 21, 23, 25, and 27 d of age. Relative organ weight was calculated as the organs weight per body weight. Error bars represent the standard deviation. Asterisk suggested significant main effect (P < 0.05) of LPS injection.

As indicated in Table 4, LPS challenge elevated (P < 0.05) NO content, lysozyme, and myeloperoxidase activities in serum on d 21 and 27. However, serum NO content (P = 0.083) and myeloperoxidase activity (P = 0.093) were tended to be less in LY-fed birds than in controls on d 21. Additionally, there was a lower (P < 0.05) NO content of broilers on d 27 induced by LY addition. No differences (P > 0.05) in serum lysozyme activity on d 21 or 27 as well as serum MPO activity on d 27 were found between LY-treated and control birds.

5

LIVE YEAST AND BROILER INFLAMMATORY RESPONSES Table 4. Effects of live yeast (LY)1 on serum nitric oxide content, lysozyme, and myeloperoxidase activities in broilers challenged with lipopolysaccharide (LPS)2 (n = 8). Diet

LPS

Control LY

d 21

− + − +

SEM P-value Diet LPS Interaction

d 27

NO3 μ mol/L

Lysozyme U/mL

MPO3 U/L

NO μ mol/L

Lysozyme U/mL

MPO U/L

3.84 5.01 3.23 4.30 0.184

73.75 244.69 97.23 259.81 8.127

23.26 28.65 22.18 27.05 0.385

3.88 4.73 3.09 3.91 0.193

77.20 154.25 67.25 131.08 6.299

23.43 26.15 22.63 26.04 0.579

0.083 0.005 0.896

0.245 < 0.001 0.799

0.093 < 0.001 0.737

0.046 0.039 0.966

0.201 < 0.001 0.604

0.698 0.013 0.771

1

LY (Saccharomyces cerevisiae) was supplemented at 0.5 g/kg of diet. Birds were intra-abdominally injected with LPS (1.5 mg/kg of BW) or the same amount of saline at 21, 23, 25, and 27 d of age. 3 NO = nitric oxide; MPO = myeloperoxidase. 2

d 21 Diet Control LY

d 27

LPS

α -AGP3

Cer3

Alb3

− + − +

133.59 166.70 139.15 161.56 10.282

13.86 29.70 20.30 28.79 1.856

0.992 0.190 0.797

0.463 0.003 0.331

SEM P-value Diet LPS Interaction

UN3

α -AGP

Cer

Alb

UN

15.04 14.72 14.80 15.37 0.423

1.04 1.37 1.14 1.54 0.043

107.01 191.19 110.71 145.67 7.156

29.64 31.40 25.12 30.83 2.224

14.59 15.43 16.39 16.36 0.410

1.16a 0.96b 0.91b 1.05a,b 0.033

0.812 0.886 0.601

0.143 < 0.001 0.692

0.156 < 0.001 0.097

0.573 0.410 0.660

0.110 0.625 0.601

0.228 0.644 0.015

Different letters indicate significant differences (P < 0.05) among the groups. LY (Saccharomyces cerevisiae) was supplemented at 0.5 g/kg of diet. α -AGP = α -acidoglycoprotein (μ g/mL); Cer = ceruloplasmin (μ g/mL); Alb = albumin (mg/mL); UN = urea nitrogen (mmol/L). 3 Birds were intra-abdominally injected with LPS (1.5 mg/kg of BW) or the same amount of saline at 21, 23, 25, and 27 d of age. a,b 1 2

Table 6. Effects of live yeast (LY)1 on relative expression of splenic inflammatory genes2 in broilers challenged with lipopolysaccharide (LPS)3 (n = 8). d 21 Diet Control LY SEM P-value Diet LPS Interaction

d 27

LPS

IL-1β

TL1A

IL-2

− + − +

1.04 1.58 0.72 1.00 0.080

0.91 0.97 0.80 0.84 0.050

1.03 3.59 0.72 3.35 0.187

0.009 0.017 0.423

0.226 0.647 0.892

0.472 < 0.001 0.913

IL-1β

TL1A

IL-2

IL-10

1.15 2.75 1.05 2.22 0.141

1.09 1.84 0.36 1.33 0.144

1.03 1.30 1.31 1.34 0.059

0.52 0.53 0.52 0.71 0.095

1.08 0.73 0.95 1.18 0.158

0.274 < 0.001 0.455

0.041 0.006 0.714

0.190 0.216 0.339

0.649 0.621 0.631

0.619 0.847 0.375

IL-10

1

LY (Saccharomyces cerevisiae) was supplemented at 0.5 g/kg of diet. IL = interleukin; TL1A = tumor necrosis factor-like ligand 1A. 3 Birds were intra-abdominally injected with LPS (1.5 mg/kg of BW) or the same amount of saline at 21, 23, 25 and 27 d of age. 2

IL-2, and IL-10 in broilers on d 21 as well as enhanced (P < 0.05) relative expression of splenic IL-1β on d 27. Strikingly, there was an reduction (P < 0.05) in IL1β mRNA abundance on d 21 and 27 of broilers from

LY-treated group than those from control. Nevertheless, dietary treatment effect (P > 0.05) was not noted in the mRNA abundance of splenic IL-10 or IL-2 of broilers.

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

Table 5. Effects of live yeast (LY)1 on serum acute phase proteins and urea nitrogen2 contents in broilers challenged with lipopolysaccharide (LPS)3 (n = 8).

6

WANG ET AL.

DISCUSSION

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

Immunological stress induced inflammation was viewed as a critical problem in production as it threaten the health status and waste the nutrients for confronting the challenge, resulting in compromised performance of birds (Roura et al., 1992; Xie et al., 2000). In this context, a variety of countermeasures were explored to moderate the above problem. Exposing the broilers to probiotics-supplemented diet is a method that had shown some promise in alleviating LPS-induced inflammation (Li et al., 2015a,b). However, little information is available describing the roles of LY (S. cerevisiae) addition on inflammation in broilers. Therefore, the present study examined the effects of LY (S. cerevisiae) on LPS-induced inflammation in broilers. In this study, an increase in relative spleen weight and a reduction of relative bursa weight were observed after LPS injection, which were similar to the results described previously (Roura et al., 1992; Xie et al., 2000). The elevated relative weight of spleen in challenged birds might be due to that LPS-induced systemic inflammation recruited inflammatory cells to the spleen and thus resulted in compensatory hyperplasia of it (Lin et al., 2007). While the reduced relative bursa weight in LPS-challenged birds might be associated with the increased production of corticosteroids, which could result in atrophy of bursa (Xie et al., 2000). Few studies have involved the effects of LY on the relative weight of immune organs. In this study, we did not observed a modification of relative spleen and bursa weights by LY addition irrespective of the immunological status, implying that dietary LY could not attenuate LPSinduced injury of homeostatic mechanisms within these immune organs in broilers. As an antigen that exist in the cell wall of Gramnegative bacteria, LPS could induce the production of immunoglobulins (Kariyawasam et al., 2002), which were indicated to be involved in the regulation of inflammation (Jordan et al., 2009). However, in this study, there was no challenge effect on serum immunoglobulins levels on d 21 or 27. This might be implicated with the influence of sampling time after LPS injection (Munyaka et al., 2013). The unchanged immunoglobulins levels in LY-fed birds implied little impact on humoral immunity was exerted by dietary LY. The result herein did not agree with the previous studies in which LY (S. cerevisiae) promoted the production of immunoglobulins in animals (Jang et al., 2013; Trckova et al., 2014). The products properties and experimental animals might be responsible for the differences that were documented between this and other studies. LPS can bind to LPS-binding protein, the complex formed by which could be recognized by the receptor (CD14 molecule) exist in the surface of phagocytes such as monocytes/macrophages and neutrophils (Takeshita et al., 1998), which are mainly responsible for the pro-

duction of NO, lysozyme, and MPO (Panousis et al., 1994; Osman et al., 2010). Increased NO, lysozyme, and MPO could be considered a response to LPS stimulation and are the important indicators of inflammatory responses (Jang et al., 2003; Takahashi et al., 2008; Li et al., 2015a). Thereby, increased NO content along with lysozyme and MPO activities in serum suggested that LPS injection activated monocytes and neutrophils in blood. However, the decreasing trend of serum NO and MPO levels on d 21 and reduced NO level on d 27 in LY-fed birds revealed that dietary LY exerted a role in mitigating LPS-induced stimulation to some phagocytes, and subsequently, might be beneficial for the health status of broilers. This was supported by the simultaneously reduced monocyte/macrophage cytokine (IL-1β ) expression in response to LY addition. Similarly, a study in pigs by Collier et al. (2011) found the percentage of blood neutrophils producing an oxidative burst in response to LPS was delayed by the addition of LY (S. boulardii), implying the LPS-induced stimulation to neutrophils was inhibited by it to a degree. Another similar research in pigs conducted by Weedman et al. (2011) also revealed a less phagocytes stimulation after transport stress was resulted from LY (S. cerevisiae) addition. Differently, it was also showed to elevate serum lysozyme activity in broilers infected with coccidia (Gao et al., 2009). Possible difference in challenge model might underlie some of these disparities. Production of acute-phase proteins that involved in inflammatory responses could be induced by proinflammatory cytokines such as IL-1β and IL-6 (Dinarello, 2000). In support of this view, we observed that LPS injection increased IL-1β gene expression on d 21 and 27 as well as serum contents of Cer on d 21 and α-AGP on d 27, which were well known as the acutephase proteins (Takahashi et al., 1997; Buyse et al., 2007). It was reported that probiotic (Bacillus) addition reduced serum α-AGP level in chickens (Lee et al., 2010). On the other hand, LY (S. cerevisiae) addition was showed to relieve E.coli-induced elevated content of serum C-reactive protein (an acute phase protein) in pigs (Badia et al., 2012), and enhance serum Cer level in lambs (Milewski et al., 2013). In this study, LY addition tended to alleviate the increase in serum α-AGP content of challenged birds on d 27. We speculated that this effect was secondary to the reduction of inflammatory signals as evidenced by the lessened mRNA abundance of splenic IL-1β in LY-fed birds. LPS could result in activated TLR4 of LPSresponsive cells such as monocytes and macrophages (Takeshita et al., 1998; Dinarello, 2000), triggering the increased synthesis and release of pro-inflammatory cytokines including IL-1β and IL-2 (Takahashi et al., 2008; Takeuchi and Akira, 2010), which are the important regulators of inflammatory responses (Klasing, 1988; Dinarello, 2000). As predicted, we observed an increased expression of splenic IL-1β and IL-2 of broilers when subjected to LPS. This was in accordance

LIVE YEAST AND BROILER INFLAMMATORY RESPONSES

ACKNOWLEDGEMENTS This work was financially supported by Lesaffre Feed Additive (Marquette-Lez-Lille, France) and China Agricultural Research System program (CARS-42). The authors thank Xiaonan Yin, Xianying Bao and Yongran Chen (China Agricultural University, Beijing, China) for their assistance in the process of animals feeding and samples collection. The authors declare that they have no conflict of interests.

REFERENCES Alexandra, C., M. Weaver, T. See, and S. W. Kim. 2014. Protective effect of two yeast based feed additives on pigs chronically exposed to deoxynivalenol and zaralenone. Toxins. 6:3336–3353. Badia, R., R. Lizardo, P. Martinez, I. Badiola, and J. Brufau. 2012. The influence of dietary locust bean gum and live yeast on some digestive immunological parameters of piglets experimentally challenged with Escherichia coli. J. Anim. Sci. 90:260–262. Buyse, J., Q. Swennen, T. A. Niewold, K. C. Klasing, G. P. J. Janssens, M. Baumgartner, and B. M. Goddeeris. 2007. Dietary L-carnitine supplementation enhances the lipopolysaccharide-

induced acute phase protein response in broiler chickens. Vet. Immunol. Immunop. 118:154–159. Coble, D. J., S. B. Redmond, B. Hale, and S. J. Lamont. 2011. Distinct lines of chickens express different splenic cytokine profiles in response to Salmonella Enteritidis challenge. Poult. Sci. 90:1659– 1663. Collier, C. T., J. A. Carroll, M. A. Ballou, J. D. Starkey, and J. C. Sparks. 2011. Oral administration of Saccharomyces cerevisiae boulardii reduces mortality associated with immune and cortisol responses to Escherichia coli endotoxin in pigs. J. Anim. Sci. 89:52–58. Dinarello, C. A. 2000. Proinflammatory cytokines. Chest. 118:503– 508. Dobrovolskaia, M. A., and S. N. Vogel. 2002. Toll receptors, CD14, and macrophage activation and deactivation by LPS. Microbes Infect. 4:903–914. Fleige, S., and M. W. Pfaffl. 2006. RNA integrity and the effect on the real-time qRT-PCR performance. Mol. Aspects Med. 27:126–139. Gao, J., H. J. Zhang, S. G. Wu, S. H. Yu, I. Yoon, D. Moore, Y. P. Gao, H. J. Yan, and G. H. Qi. 2009. Effect of Saccharomyces cerevisiae fermentation product on immune functions of broilers challenged with Eimeria tenella. Poult. Sci. 88:2141–2151. Groux, H., and F. Powrie. 1999. Regulatory T cells and inflammatory bowel disease. Immunol. Today. 20:442–446. Heugten, E. V., D. W. Funderburke, and K. L. Dorton. 2003. Growth performance, nutrient digestibility, and fecal microflora in weanling pigs fed live yeast. J. Anim. Sci. 81:1004–1012. Iseri, V. J., and K. C. Klasing. 2013. Dynamics of the systemic components of the chicken (Gallus gallus domesticus) immune system following activation by Escherichia coli; implications for the costs of immunity. Dev. Comp. Immunol. 40:248–257. Jang, Y. Y., J. H. Song, Y. K. Shin, E. S. Han, and C. S. Lee. 2003. Depressant effects of ambroxol and erdosteine on cytokine synthesis, granule enzyme release, and free radical production in rat alveolar macrophages activated by lipopolysaccharide. Pharmacol. Toxicol. 2:173–179. Jang, Y. D., K. W. Kang, L. G. Piao, T. S. Jeong, E. Auclair, S. Jonvel, R. D’Inca, and Y. Y. Kim. 2013. Effects of live yeast supplementation to gestation and lactation diets on reproductive performance, immunological parameters and milk composition in sows. Livest. Sci. 152:167–173. Jawhara, S., K. Habib, F. Maggiotto, G. Pignede, P. Vandekerckove, E. Maes, L. Dubuquoy, T. Fontaine, Y. Guerardel, and D. Poulain. 2012. Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti inflammatory role of glucan fractions. PLoS One. 7:e40648. Jordan, S. C., M. Toyoda, and A. A. Vo. 2009. Intravenous immunoglobulin a natural regulator of immunity and inflammation. Transplantation. 88:1–6. Kawahara, T., D. Nakayama, K. Toda, S. Inagaki, K. Tanaka, and H. Yasui. 2013. Suppressive effect of wild Saccharomyces cerevisiae and Saccharomyces paradoxus strains on IgE production by mouse spleen cells. Food Sci. Technol. Res. 19:1019–1027. Kariyawasam, S., B. N. Wilkie, D. B. Hunter, and C. L. Gyles. 2002. Systemic and mucosal antibody responses to selected cell surface antigens of avian pathogenic Escherichia coli in experimentally infected chickens. Avian Dis. 46:668–678. Klasing, K. C. 1988. Nutritional aspects of leukocytic cytokines. J. Nutr. 118:1436–1446. Lee, K. W., S. H. Lee, H. S. Lillehoj, G. X. Li, S. I. Jang, U. S. Babu, M. S. Park, D. K. Kim, E. P. Lillehoj, A. P. Neumann, T. G. Rehberger, and G. R. Siragusa. 2010. Effects of direct-fed microbials on growth performance, gut morphometry, and immune characteristics in broiler chickens. Poult. Sci. 89:203–216. Li, C. W., S. S. Guo, J. Gao, Y. M. Guo, E. C. Du, Z. P. Lv, and B. B. Zhang. 2015. Maternal high-zinc diet attenuates intestinal inflammation by reducing DNA methylation and elevating H3K9 acetylation in the A20 promoter of offspring chicks. J. Nutr. Biochem. 26:173–183. Li, Y., H. Zhang, Y. P. Chen, M. X. Yang, L. L. Zhang, Z. X. Lu, Y. M. Zhou, and T. Wang. 2015a. Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

with previous studies (Munyaka et al., 2013; Li et al., 2015b). Studies in pigs found that LY (S. cerevisiae) addition decreased serum IFN-γ level after weaning (Shen et al., 2009), and restored mycotoxins-induced increase in serum TNF-α level (Alexandra et al., 2014). It was also reported that LY (S. boulardii) reduced serum IL-1β level post LPS injection in pigs (Collier et al., 2011). Moreover, a study in mice found a mitigation of LY (S. cerevisiae) on pathogen-induced expression of pro-inflammatory cytokines (Martins et al., 2011; Jawhara et al., 2012). Similar results were also reported in vitro (Zanello et al., 2011a,b). In this trial, we found a reduction of IL-1β expression in broilers fed with LY, confirming a lower inflammatory status in LY-treated birds in response to LPS. This coincided with the concurrently reduced serum level of NO in LYfed birds as NO production can be induced by IL-1β (Dinarello, 2000). IL-10 is a pivotal anti-inflammatory cytokine to suppress pro-inflammatory cytokines production, playing key roles in anti-inflammation (Groux and Powrie, 1999). Consistent with the study by Munyaka et al. (2013), we observed increased splenic IL10 expression after the first LPS injection. However, though there were several studies showed that increased IL-10 expression was induced by some strains of LY (S. cerevisiae) in vivo (Jawhara et al., 2012) or in vitro (Kawahara et al., 2013), no alteration in IL-10 gene expression was found between LY-treated and control birds in this study, demonstrating that the alleviation of LY on LPS-induced inflammation did not result from the up-regulation of IL-10 expression in broilers. In conclusion, the results obtained from this study indicated that supplemental LY (S. cerevisiae) at 0.5 g/kg of diet in broilers could be useful in mitigating LPSinduced inflammation to a degree, the definite mechanism(s) for which would have to be elucidated further.

7

8

WANG ET AL. Takahashi, K., N. Ohta, and Y. Akiba. 1997. Influences of dietary methionine and cysteine on metabolic responses to immunological stress by Escherichia coli lipopolysaccharide injection, and mitogenic response in broiler chickens. Brit. J. Nutr. 78:815–821. Takahashi, K., A. Aoki, T. Takimoto, and Y. Akiba. 2008. Dietary supplementation of glycine modulates inflammatory response indicators in broiler chickens. Brit. J. Nutr. 100:1019–1028. Takeshita, S., K. Nakatani, Y. Takata, H. Kawase, I. Sekine, and S. Yoshioka. 1998. Interferon-gamma (IFN-γ ) and tumor necrosis factor-alpha (TNF-α) enhance lipopolysaccharide binding to neutrophils via CD14. Inflamm. Res. 47:101–103. Takeuchi, O., and S. Akira. 2010. Pattern recognition receptors and inflammation. Cell. 140:805–820. Trckova, M., M. Faldyna, P. Alexa, Z. S. Zajacova, E. Gopfert, D. Kumprechtova, E. Auclair, and R. D’Inca. 2014. The effects of live yeast Saccharomyces cerevisiae on postweaning diarrhea, immune response, and growth performance in weaned piglets. J. Anim. Sci. 92:767–774. Trevisi, P., M. Colombo, D. Priori, L. Fontanesi, G. Galimberti, G. Cal`o, V. Motta, R. Latorre, F. Fanelli, M. Mezzullo, U. Pagotto, Y. Gherpelli, R. D’Inca, and P. Bosi. 2015. Comparison of three patterns of feed supplementation with live yeast on postweaning diarrhea, health status, and blood metabolic profile of susceptible weaning pigs orally challenged with F4ac. J. Anim. Sci. 93:2225– 2233. Weedman, S. M., M. H. Rostagno, J. A. Patterson, I. Yoon, G. Fitzner, and S. D. Eicher. 2011. Yeast culture supplement during nursing and transport affects immunity and intestinal microbial ecology of weanling pigs. J. Anim. Sci. 89:1908–1921. Wu, D. W., X. Chen, X. Yang, Z. X. Leng, P. S. Yan, and Y. M. Zhou. 2014. Effects of heat treatment of soy protein isolate on the growth performance and immune function of broiler chickens. Poult. Sci. 93:326–334. Xie, H., N. C. Rath, G. R. Huff, W. E. Huff, and J. M. Balog. 2000. Effects of Salmonella typhimurium lipopolysaccharide on broiler chickens. Poult. Sci. 79:33–40. Zanello, G., M. Berri, J. Dupont, P. Y. Sizaret, R. D’Inca, H. Salmon, and F. Meurens. 2011a. Saccharomyces cerevisiae modulates immune gene expressions and inhibits ETEC-mediated ERK1/2 and p38 signaling pathways in intestinal epithelial cells. PLoS One 6:e18573. Zanello, G., F. Meurens, M. Berri, C. Chevaleyre, S. Melo, E. Auclair, and H. Salmon. 2011b. Saccharomyces cerevisiae decreases inflammatory responses induced by F4(+) enterotoxigenic Escherichia coli in porcine intestinal epithelial cells. Vet. Immunol. Immunop. 141:133–138. Zhao, F. Q., Z. W. Zhang, H. D. Yao, L. L. Wang, T. Liu, X. Y. Yu, S. Li, and S. W. Xu. 2013. Effects of cold stress on mRNA expression of immunoglobulin and cytokine in the small intestine of broilers. Res. Vet. Sci. 95:146–155.

Downloaded from http://ps.oxfordjournals.org/ at California State University, Fresno on June 13, 2016

in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. 208:119–131. Li, Y., H. Zhang, Y. P. Chen, M. X. Yang, L. L. Zhang, Z. X. Lu, Y. M. Zhou, and T. Wang. 2015b. Bacillus amyloliquefaciens supplementation alleviates immunological stress in lipopolysaccharidechallenged broilers at early age. Poult. Sci. 94:1504–1511. Lin, J. Y., Y. S. Lai, C. J. Liu, and A. R. Wu. 2007. Effects of lotus plumule supplementation before and following systemic administration of lipopolysaccharide on the splenocyte responses of BALB/c mice. Food Chem. Toxicol. 45:486–493. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔ Ct method. Methods. 25:402–408. Martins, F. S., S. D. A. Elian, A. T. Vieira, F. C. P. Tiago, A. K. S. Martins, F. C. P. Silva, E. L. S. Souza, L. P. Sousa, H. R. C. Araujo, and P. F. Pimenta. 2011. Oral treatment with Saccharomyces cerevisiae strain UFMG 905 modulates immune responses and interferes with signal pathways involved in the activation of inflammation in a murine model of typhoid fever. Int. J. Med. Microbiol. 301:359–364. Milewski, S., R. Wojcik, B. Zaleska, J. Malaczewska, Z. Tanski, and A. K. Siwicki. 2013. Effect of Saccharomyces cerevisiae dried yeast on the meat performance traits and selected indicators of humoral immunity in lambs. Acta Vet. Brno. 82:147–151. Monroy-Salazar, H G., L. Perez-Sotelo, Y. Gonzalez-Hernandez, G. Vaughan, S. Lagunas-Bernabe, J. Cuaron-Ibarguengoytia, J. A. Montano-Hirose, M. U. Alonso-Fresan, P. Pradal-Roa, and J. C. Vazquez-Chagoyan. 2012. Effects of a live yeast dietary supplemental on fecal coliform counts and on peripheral blood CD4+ and CD8+ lymphocytes subpopulation in nursery pigs. J. Swine Health Prod. 20:276–282. Munyaka, P. M., G. Tactacan, M. Jing, O. Karmin, J. D. House, M. S. Paul, S. Sharif, and J. C. Rodriguez-Lecompte. 2013. Response of older laying hens to an Escherichia coli lipopolysaccharide challenge when fed diets with or without supplemental folic acid. Poult. Sci. 92:105–113. Osman, K. M., M. I. EI-Enbaawy, N. A. Ezzeldin, and H. M. G. Hussein. 2010. Nitric oxide and lysozyme production as an impact to Clostridium perfringens mastitis. Comp. Immun. Microbiol. Infect. Dis. 33:505–511. Panousis, C., A. J. Kettle, and D. R. Phillips. 1994. Oxidative metabolism of mitoxantrone by the human neutrophil enzyme myeloperoxidase. Biochem. Pharmacol. 48:2223–2230. Roura, E., J. Homedes, and K. C. Klasing. 1992. Prevention of immunological stress contributes to the growth-permitting ability of dietary antibiotics in chicks. J. Nutr. 122:2383–2390. Sato, K., K. Matsushita, K. Takahashi, M. Aoki, J. Fuziwara, S. Miyanari, and T. Kamada. 2012. Dietary supplementation with 5-aminolevulinic acid modulates growth performance and inflammatory responses in broiler chickens. Poult. Sci. 91:1582–1589. Shen, Y. B., X. S. Piao, S. W. Kim, L. Wang, P. Liu, I. Yoon, and Y. G. Zhen. 2009. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J. Anim. Sci. 87:2614–2624.