Effects of prior cold stimulation on inflammatory and immune regulation in ileum of cold-stressed broilers

Effects of prior cold stimulation on inflammatory and immune regulation in ileum of cold-stressed broilers

∗

†

College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, P.R. China; College of Agriculture and Life Sciences, Iowa State University, Ames, Iowa 50011, USA; and ‡ College of Life Science, Northeast Agricultural University, Harbin 150030, P.R. China suffered inflammatory injuries, with levels of iNOS, COX-2, PTGEs, TNF-α, and IL-4 being higher than those of G1 (P < 0.05). At 43 d, compared with G1, S1 had severely damaged ileum, increased levels of iNOS, NF-κB, COX-2, PTGEs, TNF-α, and IL-4 (P < 0.05), but decreased level of IFN-γ (P < 0.05). The morphological structure of S2 was intact, and there were no differences between G2 and S2 in levels of NF-κB, PTGEs, TNF-α, IFN-γ , or IL-4 (P > 0.05). Compared with S1, S2 had decreased levels of iNOS, NF-κB, COX-2, PTGEs, TNF-α, and IL-4 (P < 0.05), but increased level of IFN-γ (P < 0.05). There were no differences between G1 and S2 in levels of NF-κB, PTGEs, TNF-α, IFN-γ , or IL-4 (P > 0.05). The results demonstrate that a 3◦ C-lower-than-normal temperature stimulation of the broilers from 8 to 42 d led to cold acclimation. This prior cold acclimation effectively alleviated elevation of pro-inflammatory cytokines and Th1/Th2 imbalance of the birds induced by subsequent cold stress.

ABSTRACT Acclimation can alleviate the negative impacts of adverse environmental factors on an organism. To investigate the effects of prior cold stimulation on inflammatory and immune regulation in ileum of cold-stressed broilers, 360 1-d-old chicks (Arbor Acres) were divided into 3 groups (G1, G2, G3) and raised at normal (thermal comfort) temperatures during 1 to 7 d. From 8 d, G1 (control) continued to be raised at normal temperatures, whereas G2 and G3 (treatments) were cold-stimulated at 3◦ C and 12◦ C, respectively, below the temperature of G1, but not below 17◦ C (reached at 32 d in G2 and 14 d in G3). At 42 d, all the groups were subjected to a 24-h acute cold stress of 7◦ C, designated as S1, S2, and S3. Ileum tissues and serum of the birds were collected at 42 d and 43 d to detect the levels of pro-inflammatory and immune-related factors as well as morphology changes. At 42 d, ileum of G1 and G2 had intact morphological structure and clear outline, with no differences in levels of iNOS, NF-κB, COX-2, PTGEs, TNF-α, IFN-γ , or IL-4 (P > 0.05). G3 ileum

Key words: broiler, cold stimulation, ileum, inflammation, immune regulation 2018 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pey308

INTRODUCTION

temperature environment for 21 d (Bukowiecki et al., 1986). Cold acclimation can enhance the immune function of the body. After 2 wk of cold acclimation in a 2◦ C environment, the cell-mediated immune function of mice was enhanced (Xu et al., 1992). Human built up cold adaptation after 6 wk of repeated cold water immersions at 14◦ C (1 h/time, 3 times/wk), and the immune system was activated to a certain extent (Jansk´ y et al., 1996). The T helper cells (Th) can assist humoral and cellular immunity. Th0 cells can differentiate into Th1 or Th2 cells upon antigen stimulation (Schmitt and Ueno, 2015). Th1 cells can evoke cell-mediated immune function, and Th2 cells can trigger strong humoral-mediated immune function by producing anti-inflammatory cytokines (Shinkai et al., 2002). IFN-γ and IL-4 are the major cytokines that perform functions of Th1 and Th2 cells, respectively (Rengarajan et al., 2000). The balance of Th1 and Th2

Acclimation can improve the tolerance of an organism to unfavorable conditions (Bernabucci et al., 2010). For instance, cold acclimation has been suggested to enhance cold tolerance (Rintam¨ aki, 2000), reduce cold injuries (Morabito et al., 2014), accelerate body temperature recovery in cold conditions, and improve perceptual responses of thermal sensation and comfort (M¨ akinen et al., 2006, 2008). Cold acclimation of livestock and poultry can be established by means of longterm exposure to slightly lower-than-normal rearing temperatures (Sinclair and Roberts, 2005). In general, cold acclimation is established by cold exposure in low  C 2018 Poultry Science Association Inc. Received May 24, 2018. Accepted June 21, 2018. 1 Corresponding authors: [email protected] edu.cn (JB)

(JL);

jbao@neau.

1

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Yingying Su,∗ Xin Zhang,∗ Hongwei Xin,† Shuang Li,‡ Jiafang Li,∗ Runxiang Zhang,∗ Xiang Li,∗ Jianhong Li,‡,1 and Jun Bao∗,1

2

SU ET AL.

the regulatory effect of the treatments on immunity and inflammation in ileum of cold-stressed broilers.

MATERIALS AND METHODS Animals and Experimental Design All procedures in this study were approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University (IACUCNEAU20150616). A total of 360 1-d old healthy Arbor Acres female broiler chicks were randomly divided into 3 equal groups: Group I (G1), Group II (G2), and Group III (G3) each with 120 birds, and were housed in 3 climatic chambers, respectively. Each group had 4 replicates of 30 birds that were housed in cages, yielding an average stocking density of 10 birds/m2 . The experimental thermal conditions are given in Table 1. As the control group, the birds in G1 were managed under normal room temperature scheme from 1 to 42 d, namely 34◦ C for 1 to 3 d, 33◦ C for 4 to 7 d, then reduced gradually by 1◦ C every 2 d till 20◦ C at 32 d and maintained at 20◦ C until 42 d (07:00 h). G2 and G3 were the cold stimulation groups in which air temperature was the same as in G1 for the first 7 d of age (1 to 7 d), and cold stimulation started at 07:00 h at 8 d. The cold stimulation condition in G2 and G3 was, respectively, 3◦ C and 12◦ C lower than that of G1. Therefore, the temperature in G2 and G3 was reduced to 17◦ C at 07:00 h at 32 d and 14 d, respectively, and maintained at 17◦ C until 07:00 h at 42 d. Commencing at 07:00 h on 42 d, chicks in all the groups were subjected to acute cold stress (CS) of 7◦ C for 24 h. The 3 groups after cold stress were designated as S1 (G1 + CS), S2 (G2 + CS), and S3 (G3 + CS). During the experiment, chicks were given ad-libitum access to water, complete starter diet (CP of 21% and ME of 12.1 MJ/kg for first 3 wk of age) and growing-finishing diet (CP of 19.0% and ME of 12.6 MJ/kg for 4 to 6 wk of age). Relative humidity of the chambers was 55 to 65%. Daily photoperiod was 23 h light:1 h dark (23L:1D) from 1 to 3 d at 25 lx and 16:8D from 4 d to the end of the experiment at 20 lx. Two birds in each replicate were randomly selected and euthanized to collect samples at 07:00 h on 42 d and 43 d. The middle ileum tissues were immediately collected and divided into 2 parts. The first part was Table 1. Air temperature regimens applied to the AA broilers used in this study. Bird age 1 to 3 d 4 to 7 d 8 to 13 d 14 to 31 d 32 to 42 d 43 d

Group I (G1) 34◦ C 33◦ C −1◦ C/2 d −1◦ C/2 d 20◦ C 7◦ C (S1)

Group II (G2)

Group III (G3)

Same as in G1 Same as in G1 G1-3◦ C G1-12◦ C ◦ G1-3 C 17◦ C 17◦ C 17◦ C 7◦ C (S2) 7◦ C (S3)

Note: Relative humidity varied from 55 to 65%. Daily photoperiod was 23 h light:1 h dark from 1 to 3 d and 16 h light:8 h dark from 4 d to the end of the experiment.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

cell responses is essential for optimal health. Studies showed that stress could suppress immune response by altering Th1/Th2 balance (Assaf et al., 2017; Liu et al., 2017). The imbalance of Th1/Th2 plays a key role in the development of many inflammatory diseases (Li et al., 2014; Shieh et al., 2015). The release of Th1 or Th2 cytokines and activation of nuclear transcription factor (NF-κB) are closely related to the occurrence of inflammatory responses (Mazzarella et al., 2000; Tak and Firestein, 2001). NF-κB controls the expression of many genes such as iNOS, COX-2, TNF-α and so on, and it can be activated rapidly by some inflammatory stimuli. Intestine is the main place for nutrients absorption and plays an important role in maintaining immune function of the body (Lee et al., 2018). Intestine immune system involves innate and adaptive (cellmediated and humoral) defenses, and can protect the organism from infections with parasites and pathogens (Wu et al., 2015). Some diseases can cause intestinal dysfunction, which seriously affects the immune function of the body. The intestinal tract is particularly susceptible to stressors (Wu et al., 2018) and stress was associated with the pathogenesis of various intestinal diseases, such as inflammatory bowel disease (Collins, 2001). Fu et al. (2013b) found that cold stress of 12 ± 1◦ C increased NF-κB mRNA expression in quail intestine and caused inflammatory response. Zhao et al. (2013) found that cold stress of 12 ± 1◦ C caused severe injury in small intestine of broilers. Continuous cold stress at 6 to 8◦ C for 3 wk resulted in inflammation of small intestine in Wistar rats (Kaushik and Kaur, 2005). However, acclimation could alleviate the damage caused by multiple stressors. The gastric mucosal injury of rats that acclimatized to chronic mild restraint stress for 2 to 10 d was significantly lower than that of control group after being subjected to cold-restraint stress (Wallace et al., 1983). The results of our previous studies showed that intermittent cold stimulation of 3◦ C lower than the conventional rearing temperature, applied 6-h periods at 2-d intervals from 22 to 42 d of age, not only had no adverse effect on the performance of broilers (Wang et al., 2017), but also improved the antioxidant capacity of the birds (Li et al., 2017). Therefore, this study built on the previous results to further evaluate the impact of potential acclimation strategies for copying cold stress in broiler production. After having been raised at air temperatures of 3◦ C or 12◦ C (for establishing the cold stress model) below the normal level for 34 d, the broilers were exposed to acute cold stress at 7◦ C for a period of 24 h. The mRNA and protein levels of inflammatory (NF-κB, iNOS, COX-2, PTGEs, and TNF-α) and immune-related (IFN-γ , IL-4) genes, Th1/Th2, and morphological change of ileum were examined. The purpose was to further explore whether long-term, sustained mild cold stimulation (3◦ C lower than normal rearing temperature) could promote establishment of cold acclimation through examining

EFFECTS OF PRIOR COLD STIMULATION ON BROILERS

fixed in 4% poly formaldehyde solution for histopathologic examination. The second part was immediately frozen in liquid nitrogen and stored at −80◦ C for later quantitative real-time PCR and western blot analysis. The blood samples were centrifuged at 3,000 r/min for 10 min. The prepared serum was stored at −40◦ C for later ELISA analysis.

Tissue specimens of ileum were fixed in 4% poly formaldehyde solution and routinely processed in paraffin, stained with hematoxylin and eosin (H&E). Histological slides were examined under a light microscope (Nikon Eclipse E400, Japan).

Quantitative Real-time PCR (qPCR) Primer Synthesis. Primer sequences for β -actin, iNOS, NF-κB, COX-2, PTGEs, TNF-α, IFN-γ , and IL4 of chicken published in GenBank were designed and synthesized by the Sangon Biotech Co. Ltd. (Shanghai, China). The primer sequences are shown in Table 2. Total RNA Extraction and Reverse Transcription. Total RNA was extracted from frozen ileum samples using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer’s protocol. The RNA integrity and quality were assessed using 1% agarose gel electrophoresis. The RNA concentration and purity were determined with spectrophotometry at 260/280 nm (Gene Quant 1300/100, USA). Complementary DNA (cDNA) was synthesized using RR047 kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. Real-Time Quantitative PCR. Real-time quantitative PCR was performed using a LightCycler 96 (Roche, Switzerland) according to the manufacturer’s instructions. Reactions were performed in a 10-μL mixture including 1 μL of diluted cDNA, 5 μL of SYBR green master, 0.3 μL of forward primer, 0.3 μL of reverse primer, and 3.4 μL of PCR-grade water. The PCR program was 95◦ C for 10 min, repeated 40 cycles of 95◦ C

for 15 s, 60◦ C for 60 s, and 60◦ C for 20 s. The melting curve showed a single peak for each PCR product. The relative abundance of mRNA was calculated according to the methods of Pfaffl (2001) and Jin et al. (2017).

Western Blot Analysis We carried out Western blot to detect the protein expression levels. Briefly, after the total protein was extracted, equal amounts of total protein (40 μg/condition) were subjected to SDS-PAGE under reducing conditions on 12% gels. Separated proteins were transferred to nitrocellulose membranes using tank transfer for 2 h at 200 mA in Tris-glycine buffer containing 20% methanol. The membranes were blocked with 5% skim milk for 16 to 24 h. The membranes were incubated overnight at 4◦ C with primary antibodies which were diluted to their optimum concentrations. After 3 10-min washes in PBST, followed by a horseradish peroxidase conjugated secondary antibodies against rabbit IgG (1:1000, Santa Cruz, USA). Membrane was incubated with a monoclonal β -actin antibody (1:1000, Santa Cruz Biotechnology, USA) to verify equal sample loading, followed by incubation with an HRP conjugated goat anti-mouse IgG (1:1000). The signal was detected by the enhanced chemiluminescence system (Cheml Scope5300, Clinx Science Instruments, Shanghai, China). The relative abundance of the iNOS, NF-κB, COX-2, and PTGEs proteins was expressed as the ratios of optical density of each of these proteins to that of β -actin.

ELISA Levels of TNF-α, IFN-γ , and IL-4 in serum of different groups were measured using commercially available ELISA kits (Shanghai Xinle Biotechnology Co., Ltd, China) according to the manufacturer’s instructions. Absorbance at a wavelength of 450 nm was measured using an ELISA reader (TECAN GENios, Austria).

Table 2. The primers used in the present study. Gene

Serial number

Primer sequences (5 -3 )

β -actin

NM 205,518.1

iNOS

NM 204,961.1

NF-κ B

NM 205,134.1

COX-2

NM 0,011,67718.1

PTGEs

NM 0,011,94983.1

TNF-α

NM 204,267.1

IFN-γ

NM 205,149.1

F: CCGCTCTATGAAGGCTACGC R: CTCTCGGCTGTGGTGGTGAA F: CCTGGAGGTCCTGGAAGAGT R: CCTGGGTTTCAGAAGTGGC F: TCAACGCAGGACCTAAAGACAT R: GCAGATAGCCAAGTTCAGGATG F: TGTCCTTTCACTGCTTTCCAT R: TTCCATTGCTGTGTTTGAGGT F: GTTCCTGTCATTCGCCTTCTAC R: CGCATCCTCTGGGTTAGCA F: GCCCTTCCTGTAACCAGATG R: ACACGACAGCCAAGTCAACG F: GCTGACGGTGGACCTATTATTGTAGAG R: TTCTTCACGCCATCAGGAAGGTTG F: GAGAGCCAGCACTGCCACAAG R: GTAGGTCTGCTAGGAACTTCTCCATTG

IL-4

NM 0,010,07079.1

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Histopathologic Examination

3

4

SU ET AL.

Statistical Analysis IBM SPSS Statistics software (Version 21.0) was used for the statistical analysis. The Kolmogorov–Smirnov procedure was used to examine data normal distribution. All data showed homogeneity of variance. One-way ANOVA and Duncan’s multiple comparison tests were used to compare means. Data are shown as the mean ± standard error (mean ± SEM). Probability values less than 0.05 were considered significant.

RESULTS Ileum Histopathology Effect of the cold stress on ileum morphology of the broilers with or without cold stimulation is shown in Figure 1. The pathological changes were indicated by black arrows. At 42 d, G1 and G2 had intact morphological structure and clear outline, and their cells arranged neatly. The ileum villi of G3 were sparse, swollen and broken; and the intercellular space was enlarged. After the acute cold stress, the ileum tissue in S1 was severely damaged; and the ileum villi were adhesive, swollen and broken, accompanied with deficient cell and enlarged intercellular space. However, the structure of S2 ileum was intact, and its outline was clear, accompanied with neatly arranged cells. The ileum villi of S3 were broken and its intercellular space increased.

Changes in mRNA Expression Levels of Pro-Inflammatory Genes and Immune-Related Genes Effects of the cold stress on mRNA expression levels of iNOS (Figure 2A), NF-κB (Figure 2B), COX-2 (Figure 2C), PTGEs (Figure 2D), and TNF-α (Figure 2E) in ileum of the broilers with or without cold stimulation are shown in Figure 2. At 42 d of age, no difference was detected between G1 and G2 as well as between G2 and G3 in iNOS mRNA expression (P > 0.05), and the iNOS mRNA level of G3 was higher than that of G1 (P < 0.05). There were no differences in gene levels of NF-κB, COX-2, PTGEs, and TNF-α between G1 and G2 (P > 0.05), and these levels in both groups were lower than those of G3 (P < 0.05). After cold stress (43 d of age), the gene levels of iNOS, NF-κB, COX-2, PTGEs, and TNF-α in S1 were higher than those of G1 (P < 0.05). There were no differences in gene levels of iNOS, NF-κB, PTGEs, and TNF-α between S2 and G2 (P > 0.05). COX-2 levels in S2 were higher than that of G2 (P < 0.05). Compared with G3, the gene levels of iNOS, NF-κB, COX-2, PTGEs, and TNF-α in S3 increased (P < 0.05). Compared with S1, the gene levels of iNOS, PTGEs, and TNF-α in S3 decreased (P < 0.05), and the gene level of NF-κB increased (P < 0.05). There was no difference in COX-2 mRNA expression between S1 and S3 (P > 0.05). The gene levels of iNOS, NF-κB, COX-2, PTGEs, and TNFα in S2 were lower than those of S1 and S3 (P < 0.05).

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Figure 1. Ileum morphologies of 42-d-old AA broilers before and after a 24-h acute cold stress at 7◦ C (S1, S2, S3). The broilers had been raised either under normal (thermal conform) temperatures (G1) or under cold stimulation of 3◦ C or 12◦ C below normal levels (G2, G3) from 8 to 42 d of age. Images in the first and third columns were magnified 4×, and images in the second and fourth columns were magnified 10×.

EFFECTS OF PRIOR COLD STIMULATION ON BROILERS

5

The gene levels of iNOS, PTGEs, and TNF-α in S2 did not differ from those of G1 (P > 0.05). Effects of the cold stress on mRNA expression levels of IFN-γ (Figure 3A) and IL-4 (Figure 3B) in ileum of the broilers with or without cold stimulation are shown in Figure 3. At 42 d of age, there were no differences in IFN-γ and IL-4 gene levels between G1 and G2 (P > 0.05), and the levels in both groups were lower than those of G3 (P < 0.05). After the cold stress (43 d of age), compared with G1, the gene level of IFN-γ in S1 decreased (P < 0.05), and IL-4 gene level in S1 increased (P < 0.05). The gene levels of IFN-γ and IL-4 in S2 did not differ from those of G1 or G2 (P > 0.05). Compared with G3, the gene level of IFN-γ in S3 decreased (P < 0.05), and IL-4 mRNA expression level in S3 increased (P < 0.05).

Changes in Protein Expression Levels of Pro-Inflammatory Genes Effects of the cold stress on protein expression levels of iNOS (Figure 4A), NF-κB (Figure 4B), COX-2 (Figure 4C), and PTGEs (Figure 4D) in ileum of broilers with or without cold stimulation are shown in Figure 4. At 42 d of age, there were no differences in protein levels of iNOS, NF-κB, COX-2, and PTGEs between G1 and G2 (P > 0.05). The protein levels of iNOS, COX2, and PTGEs in G3 were higher than those of G1 and G2 (P < 0.05). The protein level of NF-κB between G1 and G3 was not different (P > 0.05), and protein level of NF-κB in G2 was lower than that of G3 (P < 0.05). After cold stress (43 d of age), the protein levels

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Figure 2. mRNA expression levels of pro-inflammatory genes in ileum of broilers before and after a 24-h acute cold stress at 7◦ C (S1, S2, S3). The broilers had been raised either under normal (thermal conform) temperatures (G1) or under cold stimulation of 3◦ C or 12◦ C below normal levels (G2, G3) from 8 to 42 d of age. “∗ ” represents that differences between G1 and S1, between G2 and S2 as well as between G3 and S3 were significant (P < 0.05). “#” represents that differences between G1 and G2 or G3, and between S1 and S2 or S3 were significant (P < 0.05). “$” represents that differences between G2 and G3 as well as between S2 and S3 were significant (P < 0.05). The data are presented as means ± SEM.

6

SU ET AL.

of iNOS, NF-κB, COX-2, and PTGEs in S1 were higher than those of G1 (P < 0.05). There were no differences in protein levels of NF-κB and PTGEs between S2 and G2 (P > 0.05). Compared with G3, the protein levels of NF-κB, COX-2, and PTGEs in S3 increased (P < 0.05). The protein levels of iNOS, NF-κB, COX-2, and PTGEs in S2 were lower than those of S1 and S3 (P < 0.05).

Changes in Levels of TNF-α, IFN-γ , and IL-4 in Serum Effects of the cold stress on levels of TNF-α (Figure 5A), IFN-γ (Figure 5B), and IL-4 (Figure 5C) in serum of broilers with or without cold stimulation are shown in Figure 5. At 42 d of age, there were no differences in levels of TNF-α and IL-4 between G1 and G2 (P > 0.05), and the levels of both groups were lower than those of G3 (P < 0.05). There was no difference in IFN-γ level among G1, G2, and G3 (P > 0.05). After the cold stress (43 d of age), the TNF-α and IL-4 levels in S1 and S3 were higher than those of G1 and G3 (P < 0.05), respectively. The level of IFN-γ in S1 and S3 was lower than that of G1 and G3 (P < 0.05), respectively. However, the levels of TNF-α, IFN-γ , and IL-4 in S2 did not differ from those of G2 (P > 0.05).

DISCUSSION Cold stress can cause inflammation in the intestine of poultry, which reduces the immune function of the animals (Zhao et al., 2013; Fu et al., 2013b; Broom and Kogut, 2017). Cold acclimation can alleviate the damage caused by cold stress (Morabito et al., 2014), and improve the immune function of body to some extent. For example, after 2 wk of cold acclimation in a 2◦ C environment, the cell-mediated immune function of mice was enhanced (Xu et al., 1992). The results

of the current study showed that appropriate cold stimulation could reduce the damage of ileum caused by cold stress and improve the immune function of body to a certain extent. This alleviation is mainly due to the lower levels of pro-inflammatory factors in the NF-κB inflammatory pathway, as well as avoidance of Th1/Th2 imbalance in S2 after the cold stress. Cold stress can cause intestinal tissue damage. Zhao et al. (2013) found that the height of jejunum villus in cold stress group decreased significantly, and the villi were sparse, swollen as well as broken. Consistent with the previous results, at 42 d, the ileum villi of G3 birds in this study were sparse, swollen and broken. It was morphologically proven that an extended period of cold stimulation at 12◦ C lower than the normal temperature led to inflammatory injuries in ileum of broilers, presumably attributable to cold stress. The villi of G2 birds had intact structure and clear outline. This outcome indicated that cold stimulation at 3◦ C lower than normal was relatively mild for the broilers, in the range of cold temperature the birds could adapt to, therefore no morphological injury of ileum. The meaning of “cross-adaptation” is that adaptation to one kind of stressor can alleviate potential damages caused by multiple stressors (Manukhina et al., 2006). Wallace et al. (1983) pointed out that compared with control rats, the gastric mucosal injury of rats that had been adapted to chronic mild restraint stress for 2 to 10 d was significantly reduced when they were subjected to cold-restraint stress at the same time. Glavin et al. (1987) suggested that compared with control rats treated with water for 7 d, the gastric ulcer of rats that had been adapted to the concentration of 20% alcohol for 7 d was significantly reduced when they were subjected to cold-restraint stress at the same time. In the current study, after cold stress, ileum in S1 was severely damaged but ileum in S2 had no obvious injury, which is similar to the results reported by Glavin

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Figure 3. mRNA expression levels of immune-related genes in ileum of broilers before and after a 24-h acute cold stress at 7◦ C (S1, S2, S3). The broilers had been raised either under normal (thermal conform) temperatures (G1) or under cold stimulation of 3◦ C or 12◦ C below normal levels (G2, G3) from 8 to 42 d of age. “∗ ” represents that differences between G1 and S1, between G2 and S2 as well as between G3 and S3 were significant (P < 0.05). “#” represents that differences between G1 and G2 or G3, and between S1 and S2 or S3 were significant (P < 0.05). “$” represents that differences between G2 and G3 as well as between S2 and S3 were significant (P < 0.05). The data are presented as means ± SEM.

EFFECTS OF PRIOR COLD STIMULATION ON BROILERS

7

and Wallace. This outcome suggests that appropriate cold stimulation can produce cold acclimation and alleviate morphological injury caused by cold stress. The NF-κB transcription factor is a master regulator of inflammation and immune homeostasis, which can be rapidly activated by environmental stress (Wang et al., 2018). Activation of NF-κB increases the expression levels of pro-inflammatory cytokines such as iNOS, COX-2, PTGEs, and TNF-α (Benneriah, 2002; Barnes, 2008; Ko et al., 2017). In turn, expression of these induced cytokines further activates the NF-κB pathway (Kips et al., 1993). iNOS, COX-2, and PTGEs are expressed in small amounts in most tissues and organs of normal organisms, and they are only activated in large quantities under pathological conditions. TNF-α is the main pro-inflammatory cytokine in the early stage of inflammation, and its secretion can reduce the damage caused by cold stress to the body. Cold stress increases the levels of NF-κB as well as pro-inflammatory factors such as iNOS, COX-2, and

PTGEs. The iNOS expression level in duodenum of broiler chicks subjected to chronic cold exposure at 12 ± 1◦ C for 5 to 20 d was increased, which caused inflammatory injury in duodenum (Zhang et al., 2011). Cold stress (12 ± 1◦ C) increased the mRNA expression levels of NF-κB, COX-2, and PTGEs in intestinal tract of quail, and led to intestinal inflammatory response (Fu et al., 2013a,b). However, adaptation reduces the level of pro-inflammatory cytokines. Rad´ ak et al. (2004) found that regular exercise induced the establishment of adaptive response in rats, thereby weakening the activation of NF-κB. Polat et al. (2010) reported that COX-2 level in the gastric tissue of rats significantly decreased when they received a higher dose (25 mg/kg) of indomethacin after they had adapted to 14 d of indomethacin treatment at a dose of 5 mg/kg/d. Liu et al. (2009) indicated that the TNF-α expression level in rat carotid body recovered to normal level from the initial more than 2 folds of normal level after the rats had adapted to chronic hypoxic environment for 28 d. The

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Figure 4. Protein expression levels of pro-inflammatory genes in ileum of broilers before and after a 24-h acute cold stress at 7◦ C (S1, S2, S3). The broilers had been raised either under normal (thermal conform) temperatures (G1) or under cold stimulation of 3◦ C or 12◦ C below normal levels (G2, G3) from 8 to 42 d of age. “∗ ” represents that differences between G1 and S1, between G2 and S2 as well as between G3 and S3 were significant (P < 0.05). “#” represents that differences between G1 and G2 or G3, and between S1 and S2 or S3 were significant (P < 0.05). “$” represents that differences between G2 and G3 as well as between S2 and S3 were significant (P < 0.05). The data are presented as means ± SEM.

8

SU ET AL.

results of this study were similar to those of studies by Rad´ ak, Polat and Liu. There were no significant differences in gene and protein expression levels of iNOS, NF-κB, COX-2, and PTGEs as well as TNF-α level in serum between G1 and G2. This indicated that cold stimulation environment of 3◦ C lower than normal was relatively mild for the broiler chicks, in the range of cold temperature the chicken could adapt to; thus the levels of pro-inflammatory cytokines in G2 had no increase. The birds in G2 might have established cold acclimation after 34 d of cold stimulation. Therefore, the levels of iNOS, NF-κB, COX-2, PTGEs, and TNF-α in S2 were significantly lower than those of S1 after cold stress. These results indicated that cold acclimation could effectively alleviate the increase of NF-κB, iNOS, COX-2, PTGEs, and TNF-α levels caused by cold stress. This was one of the reasons that the structure of ileum tissue between G2 and S2 was basically intact. Nuclear transcription factor (NF-κB) plays a key role in the control of Th1 and Th2 immune responses (Mccracken et al., 2004). The characteristic cytokines of Th1 and Th2 cells are IFN-γ and IL-4, respectively (Sofi et al., 2009). The balance of Th1/Th2 plays an important role in immune regulation process. Stress suppresses immune response by changing the balance of Th1/Th2 (Assaf et al., 2017; Liu et al., 2017). For example, cold stress inhibited Th1 response by reducing the level of IFN-γ , and promoted Th2 responses

by increasing the level of IL-4, thus led to the imbalance of Th1/Th2 and the reduction of immune function. The IFN-γ expression levels in duodenum and ileum exhibited a marked decrease, whereas the IL-4 expression levels significantly increased after broilers were exposed to cold stress of 12 ± 1◦ C for 20 d (Zhao et al., 2013). Cold stress of 10◦ C significantly increased the expression of IL-4 mRNA in peripheral blood lymphocytes of chicken (Hangalapura et al., 2006). Acute cold stress of 4◦ C upregulated IL-4 levels in serum of Wistar rats (Guo et al., 2012). However, acclimation can effectively relieve the imbalance of Th1/Th2 induced by cold stress. During the first 1 to 2 d in the microgravity environment, the release of IFN-γ in rats increased, but the release of IFN-γ decreased on the 12th day, indicating that the rats had adapted to the new environment (Thiel et al., 2017). Similar to previous studies, after 34 d of cold stimulation, there were no significant differences between G1 and G2 in levels of IFN-γ and IL-4 in ileum and serum, indicating that cold acclimation had been established at that time. After cold stress, the IFN-γ level of S1 decreased remarkably, and the level of IL-4 increased significantly. However, the levels of IFN-γ and IL-4 in S2 did not differ from those of G1 or G2. This suggested that cold acclimation could effectively alleviate Th1/Th2 imbalance accompanied with the increase of IFN-γ and the decrease of IL-4 caused by cold stress. It might be a mechanism for

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Figure 5. Levels of TNF-α , IFN-γ , and IL-4 in serum of broilers before and after a 24-h acute cold stress at 7◦ C (S1, S2, S3). The broilers had been raised either under normal (thermal conform) temperatures (G1) or under cold stimulation of 3◦ C or 12◦ C below normal levels (G2, G3) from 8 to 42 d of age. “∗ ” represents that differences between G1 and S1, between G2 and S2 as well as between G3 and S3 were significant (P < 0.05). “#” represents that differences between G1 and G2 or G3, and between S1 and S2 or S3 were significant (P < 0.05). “$” represents that differences between G2 and G3 as well as between S2 and S3 were significant (P < 0.05). The data are presented as means ± SEM.

EFFECTS OF PRIOR COLD STIMULATION ON BROILERS

cold acclimation to improve the immune function of the body.

CONCLUSION

ACKNOWLEDGMENTS This work was supported by the Natural Science Foundation of China (Grant No. 31772647). The authors thank members of the Animal Behavior and Welfare Laboratory in the College of Animal Science and Technology as well as members of the Veterinary Internal Medicine Laboratory in the College of Veterinary Medicine at Northeast Agricultural University.

REFERENCES Assaf, A. M., R. Alabbassi, and M. Albinni. 2017. Academic stressinduced changes in Th1- and Th2-cytokine response. Saudi Pharm. J. 25:1237–1247. Barnes, P. J. 2008. The cytokine network in asthma and chronic obstructive pulmonary disease. J. Clin. Invest. 118:3546–3556. Benneriah, Y. 2002. Regulatory functions of ubiquitination in the immune system. Nat. Immunol. 3:20–26. Bernabucci, U., N. Lacetera, L. H. Baumgard, R. P. Rhoads, B. Ronchi, and A. Nardone. 2010. Metabolic and hormonal acclimation to heat stress in domesticated ruminants. Animal. 4:1167– 1183. Broom, L. J., and M. H. Kogut. 2017. Inflammation: friend or foe for animal production? Poult. Sci. 97:510–514. Bukowiecki, L. J., A. G´elo¨en, and A. J. Collet. 1986. Proliferation and differentiation of brown adipocytes from interstitial cells during cold acclimation. Am. J. Physiol. 250:C880–C887. Collins, S. M. 2001. Modulation of intestinal inflammation by stress: basic mechanisms and clinical relevance. Am. J. Physiol-Gastr. L. 280:G315–G318. Fu, J., C. P. Liu, Z. W. Zhang, W. Liao, and S. W. Xu. 2013a. Effects of acute and chronic cold stress on expression of cyclooxygenase-2 and prostaglandin E synthase mRNA in quail intestine. Pak. Vet. J. 33:358–363. Fu, J., C. P. Liu, Z. W. Zhang, M. W. Xing, and S. W. Xu. 2013b. Influence of inflammatory pathway markers on oxidative stress induced by cold stress in intestine of quails. Res. Vet. Sci. 95:495– 501. Glavin, G. B., L. K. Lockhart, G. E. Rockman, A. M. Hall, and K. M. Kiernan. 1987. Evidence of “cross-stressor”-induced adaptive gastric cytoprotection. Life Sci. 41:2223–2227.

Guo, J. R., S. Z. Li, H. G. Fang, X. Zhang, J. F. Wang, S. Guo, J. I. Hong, L. Zang, L. Guo, L. Zhen, and H. M. Yang. 2012. Different duration of cold stress enhances pro-inflammatory cytokines profile and alterations of Th1 and Th2 type cytokines secretion in serum of wistar rats. J. Anim. Vet. Adv. 11:1538–1545. Hangalapura, B. N., M. G. Kaiser, J. J. Poel, H. K. Parmentier, and S. J. Lamont. 2006. Cold stress equally enhances in vivo pro-inflammatory cytokine gene expression in chicken lines divergently selected for antibody responses. Dev. Comp. Immunol. 30:503–511. ˇ amek, V. Jansk´ y, L., D. Posp´ıˇsilov´a, S. Honzov´ a, B. Uliˇcn´ y, P. Sr´ Zeman, and J. Kam´ınkov´ a. 1996. Immune system of cold-exposed and cold-adapted humans. Eur. J. Appl. Physiol. 72:445–450. Jin, X., Z. Xu, X. Zhao, M. H. Chen, and S. W. Xu. 2017. The antagonistic effect of selenium on lead-induced apoptosis via mitochondrial dynamics pathway in the chicken kidney. Chemosphere. 180:259–266. Kaushik, S., and J. Kaur. 2005. Effect of chronic cold stress on intestinal epithelial cell proliferation and inflammation in rats. Stress. 8:191–197. Kips, J. C., J. H. Tavernier, G. F. Joos, R. A. Peleman, and R. A. Pauwels. 1993. The potential role of tumour necrosis factor a in asthma. Clin. Exp. Allergy. 23:247–250. Ko, E. Y., S. H. Cho, S. H. Kwon, C. Y. Eom, M. S. Jeong, W. W. Lee, S. Y. Kim, S. J. Heo, G. Ahn, P. L. Kang, Y. J. Jeon, and K. N. Kim. 2017. The roles of NF-κB and ROS in regulation of pro-inflammatory mediators of inflammation induction in LPSstimulated zebrafish embryos. Fish Shellfish Immunol. 68:525– 529. Lee, Y. S., S. H. Lee, U. D. Gadde, S. T. Oh, S. J. Lee, and H. S. Lillehoj. 2018. Allium hookeri supplementation improves intestinal immune response against necrotic enteritis in young broiler chickens. Poult. Sci. 97:1899–1908. Li, J. H., F. F. Huang, X. Li, Y. Y. Su, H. T. Li, and J. Bao. 2017. Effects of intermittent cold stimulation on antioxidant capacity and mRNA expression in broilers. Livest. Sci. 204:110–114. Li, R. J., X. J. Kou, J. J. Tian, Z. Q. Meng, Z. W. Cai, F. Q. Cheng, and C. Dong. 2014. Effect of sulfur dioxide on inflammatory and immune regulation in asthmatic rats. Chemosphere. 112:296–304. Liu, H., B. L. Li, X. J. Jia, Y. Ma, Y. F. Gu, P. Zhang, Q. Wei, J. M. Cai, J. G. Cui, F. Gao, and Y. Y. Yang. 2017. Radiation-induced decrease of CD8 + dendritic cells contributes to Th1/Th2 shift. Int. Immunopharmacol. 46:178–185. Liu, X., L. He, L. Stensaas, B. Dinger, and S. Fidone. 2009. Adaptation to chronic hypoxia involves immune cell invasion and increased expression of inflammatory cytokines in rat carotid body. Am. J. Physiol. Lung Cell. Mol. Physiol. 296:L158–L166. M¨ akinen, T. M., M. M¨ antysaari, T. P¨ aa¨kk¨ onen, J. Jokelainen, L. A. Palinkas, J. Hassi, J. Lepp¨ aluoto, K. Tahvanainen, and H. Rintam¨ aki. 2008. Autonomic nervous function during whole-body cold exposure before and after cold acclimation. Aviat. Space Environ. Med. 79:875–882. M¨ akinen, T. M., L. A. Palinkas, D. L. Reeves, T. P¨ aa¨kk¨ onen, H. Rintam¨ aki, J. Lepp¨ aluoto, and J. Hassi. 2006. Effect of repeated exposures to cold on cognitive performance in humans. Physiol. Behav. 87:166–176. Manukhina, E. B., H. F. Downey, and R. T. Mallet. 2006. Role of nitric oxide in cardiovascular adaptation to intermittent hypoxia. Exp. Biol. Med. (Maywood). 231:343–365. Mazzarella, G., A. Bianco, E. Catena, R. De Palma, and G. F. Abbate. 2000. Th1/Th2 lymphocyte polarization in asthma. Allergy. 55:6–9. Mccracken, S. A., E. Gallery, and J. M. Morris. 2004. Pregnancyspecific down-regulation of NF-kappa B expression in T cells in humans is essential for the maintenance of the cytokine profile required for pregnancy success. J. Immunol. 172:4583–4591. Morabito, M., M. Iannuccilli, A. Crisci, V. Capecchi, A. Baldasseroni, S. Orlandini, and G. F. Gensini. 2014. Air temperature exposure and outdoor occupational injuries: a significant cold effect in Central Italy. Occup. Environ. Med. 71:713–716. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. Polat, B., H. Suleyman, and H. H. Alp. 2010. Adaptation of rat gastric tissue against indomethacin toxicity. Chem. Biol. Interact. 186:82–89.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

In conclusion, the results of this study showed that cold stimulation environment of 12◦ C lower than the normal temperature led to cold stress of the birds accompanied by inflammation and the imbalance of Th1/Th2. However, cold stimulation environment of 3◦ C lower than normal was in the range of cool temperature the broiler chicken could adapt to. The mild and prolonged cold stimulation of 3◦ C lower for 34 d could make the chicken establish cold acclimation. Cold acclimation improved the immune function and the resistance to cold stress of the birds to a certain extent, and effectively reduced cold injury caused by cold stress. Cold acclimation effectively alleviated the high levels of pro-inflammatory cytokines in the NF-κB inflammatory pathway such as NF-κB, iNOS, COX-2, PTGEs, and TNF-α as well as Th1/Th2 imbalance induced by cold stress, which may be a protective mechanism of cold acclimation.

9

10

SU ET AL. Wallace, J. L., N. S. Track, and M. M. Cohen. 1983. Chronic mild restraint protects the rat gastric mucosa from injury by ethanol or cold restraint. Gastroenterology. 85:370–375. Wang, C. P., B. Wang, T. L. Miao, C. W. Han, Q. B. Zhou, G. D. Cheng, H. S. Yang, and B. Wang. 2017. The study of cold stimulation effecting on production performance of China-Lindian native chickens. Proc. 2016 Int. Conf. Biotechnol. Med. Sci. 139–144. Wang, W., M. H. Chen, X. Jin, X. J. Li, Z. J. Yang, H. J. Lin, and S. W. Xu. 2018. H2 S induces Th1/Th2 imbalance with triggered NF-κB pathway to exacerbate LPS-induce chicken pneumonia response. Chemosphere. 208:241–246. Wu, B. Y., H. R. Guo, H. M. Cui, X. Peng, J. Fang, Z. C. Zuo, J. L. Deng, X. Wang, and J. Y. Huang. 2016. Pathway underlying small intestine apoptosis by dietary nickel chloride in broiler chickens. Chem. Biol. Interact. 243:91–106. Wu, Q. J., N. Liu, X. H. Wu, G. Y. Wang, and L. Lin. 2018. Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers. Poult. Sci. 97:2675–2683. Xu, Y., Z. T. Yang, and C. Z. Su. 1992. Enhancement of cellular immune function during cold adaptation of inbred mice. Cryobiology. 29:422–427. Zhang, Z. W., Z. H. Lv, J. L. Li, S. Li, S. W. Xu, and X. L. Wang. 2011. Effects of cold stress on nitric oxide in duodenum of chicks. Poult. Sci. 90:1555–1561. Zhao, F. Q., Z. W. Zhang, H. D. Yao, L. L. Wang, T. Liu, X. Y. Yu, S. Li, and S. W. Xu. 2013. Effects of cold stress on mRNA expression of immunoglobulin and cytokine in the small intestine of broilers. Res. Vet. Sci. 95:146–155.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey308/5074501 by Insead user on 26 November 2018

Rad´ ak, Z., H. Y. Chung, H. Naito, R. Takahashi, K. J. Jung, H. J. Kim, and S. Goto. 2004. Age-associated increase in oxidative stress and nuclear factor kappaB activation are attenuated in rat liver by regular exercise. FASEB J. 18:749–750. Rengarajan, J., S. J. Szabo, and L. H. Glimcher. 2000. Transcriptional regulation of Th1/Th2 polarization. Immunol. Today. 21:479–483. Rintam¨ aki, H. 2000. Predisposing factors and prevention of frostbite. Int. J. Circumpolar Health. 59:114–121. Schmitt, N., and H. Ueno. 2015. Regulation of human helper T cell subset differentiation by cytokines. Curr. Opin. Immunol. 34:130– 136. Shieh, Y. H., H. M. Huang, C. C. Wang, C. C. Lee, C. K. Fan, and Y. L. Lee. 2015. Zerumbone enhances the Th1 response and ameliorates ovalbumin-induced Th2 responses and airway inflammation in mice. Int. Immunopharmacol. 24:383–391. Shinkai, K., M. Mohrs, and R. M. Locksley. 2002. Helper T cells regulate type-2 innate immunity in vivo. Nature. 420:825–829. Sinclair, B. J., and S. P. Roberts. 2005. Acclimation, shock and hardening in the cold. J. Therm. Biol. 30:557–562. Sofi, M. H., W. Li, M. H. Kaplan, and C. H. Chang. 2009. Elevated IL-6 expression in CD4 T cells via PKCθ and NF-κB induces Th2 cytokine production. Mol. Immunol. 46:1443–1450. Tak, P. P., and G. S. Firestein. 2001. NF-kappaB: a key role in inflammatory diseases. J. Clin. Invest. 107:7–11. Thiel, C. S., B. A. Lauber, J. Polzer, and O. Ullrich. 2017. Time course of cellular and molecular regulation in the immune system in altered gravity: Progressive damage or adaptation? REACHRev. Human Space Explor. 5:22–32.