Efficient propagation of single gene deleted recombinant Sendai virus vectors

Virus Research 99 (2004) 193–197

Short communication

Efficient propagation of single gene deleted recombinant Sendai virus vectors Christian Bernloehr a,1 , Sascha Bossow b , Guy Ungerechts a , Sorin Armeanu a , Wolfgang J. Neubert b , Ulrich M. Lauer a , Michael Bitzer a,∗,1 a

b

Internal Medicine I, University Clinic Tübingen, D-72076 Tübingen, Germany Max-Planck-Institute for Biochemistry, Molecular Virology, D-82152 Martinsried, Germany

Received 1 August 2003; received in revised form 3 November 2003; accepted 4 November 2003

Abstract Recombinant Sendai virus vectors (SeVV) have become an attractive tool for basic virological as well as for gene transfer studies. However, to (i) reduce the cellular injury induced by basic recombinant SeV vectors (encoding all six SeV genes as being present in SeV wild-type (wt) genomes) and to (ii) improve SeV vector safety, deletions of viral genes are necessary for the construction of superior SeVV generations. As a strong expression system recombinant replication-incompetent adenoviruses, coding for SeV proteins hemagglutinin-neuraminidase (HN), fusion (F), or matrix (M), were generated and successfully employed for the propagation of single gene deleted (HN, F, M) recombinant SeVV. Further investigations of the propagation procedures required for single gene deleted recombinant SeVV demonstrated (i) modifications of the cell culture medium composition as well as (ii) incubation with vitamin E as crucial steps for the enhancement of SeVV–HN, –F, or –M viral particle yield. Such optimized propagation procedures even led to a successful propagation of HN-deleted viral particles (SeVV–HN), which has not been reported before. © 2003 Elsevier B.V. All rights reserved. Keywords: Paramyxoviridae; Sendai virus; Viral vector; Propagation; Vitamin E

According to the latest incidences in clinical trials the potential of new viral vector systems has to be investigated in detail (Thomas et al., 2003). In this context, the negative-strand RNA virus Sendai virus (Parainfluenzavirus type I; SeV) has become an attractive tool as a new vector system for gene transfer studies during the last few years (Nagai, 1999; Kano et al., 2000; Yonemitsu et al., 2000; Masaki et al., 2001; Shiotani et al., 2001; Griesenbach et al., 2002; Bitzer et al., 2003a,b). One important safety issue for future SeV vectors (SeVV) will be the introduction of single or multiple gene deletions into the viral genome which basically consists of six structural genes (nucleocapsid protein, N; phosphoprotein, P; matrix protein, M; fusion protein, F; hemagglutinin-neuraminidase protein, HN; and the large protein L; Fig. 1), to minimize cellular toxicity and to prevent vector amplification or mobilization in vivo. However, ∗ Corresponding author. Tel.: +49-7071-2983189; fax: +49-7071-295692. E-mail address: [email protected] (M. Bitzer). 1 These authors contributed equally to this study.

0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2003.11.005

gene deletions in the viral genome have to be substituted during vector propagation by potent helper systems in trans. To date, only F- (Li et al., 2000) or M-deficient (Inoue et al., 2003) SeVV (SeVV–F, SeVV–M) have been successfully rescued and propagated. Due to an inefficient initial rescue procedure after vaccinia helper virus infection and transfection of packaging cell lines, thereby generated SeVV nucleocapsids had to be isolated by freezing and thawing up to now and subsequently transfected for further propagation into other helper cell lines supplying either M or F in trans by a Cre/loxP induction system (Li et al., 2000; Inoue et al., 2003). Infectious titers of F- or M-gene deleted SeVV particles reported for this sophisticated rescue/propagation system were pointed out to be up to 108 and 107 cell infectious U/ml (ciu/ml), respectively (Li et al., 2000; Inoue et al., 2003). The aim of our study was to further improve and simplify the propagation of single gene deleted SeVV by the generation of a strong expression system based on adenoviral helper viruses efficiently supplying the genes deleted in the SeV vector genomes in trans. Subsequently, the improvement

194

C. Bernloehr et al. / Virus Research 99 (2004) 193–197

Fig. 1. Schematic representation of constructs used in the rescue procedure in comparison to the wild-type genome (SeV wt). The gene for the “green fluorescent protein” (GFP) was inserted as a reporter between the viral leader (ld) and N sequences as described in the text.

of viral vector propagation should enable an efficient and simple production of SeVV–F and –M, as well as the so far not reported SeVV–HN particles required for basic virological studies and future applications in biotechnology. As a first step, recombinant adenoviruses containing a deletion in the E1 region from nucleotide (nt) 455–3328, were generated and propagated according to (Wybranietz et al., 2001). The SeV genes HN (position 6697-8420, sequence and numbering of the SeV genome as described by Leyrer et al., 1998), F (position 4866-6563) or M (position 3669-4715) were introduced into the adenoviral backbone by homologous recombination (Wybranietz et al., 2001), generating the adenoviruses Ad–HN, Ad–F, and Ad–M. Recombinant adenoviruses could be propagated to high titers (Ad–HN: 3 × 1011 pfu/ml, Ad–M: 3 × 1011 pfu/ml, Ad–F: 1×1011 pfu/ml). Successful adenoviral-mediated expression of the SeV proteins HN, F, and M in Vero and HeLa cell lines could be demonstrated by western blot analysis using specific antibodies (beginning at an adenoviral MOI of 25; data not shown). Next, vector cDNAs of SeVV–HN, –F or –M (Fig. 1) were generated based by using a novel tripel transcriptional cassette (1972 bp) comprising the SanDI fragment from the SeV genome without the ORFs coding for M, F, and HN (but including parts of the P- and L-ORF with the respective 3 - and 5 -UTR) according to SeV wild-type (wt) positions 2714-3624 and 8538-9137 (sequence and numbering as described by Leyrer et al., 1998). In brief, M-, F- and HN-ORFs were replaced by selected unique restriction sites as described below, each flanked by the original respective gene end and gene start signals and also the UTRs. In successive stages this cassette was filled up to generate M-, F- or HN-deficient constructs. The

M-ORF was flanked with the restriction sites for MluI and BssHII, HN- and F-ORFs were flanked with those for SalI and XhoI. The fragments were compatible for successive insertion into the SanDI cassette. For the construction of genome equivalents to be used in the following rescue procedure these various pre-constructs could be inserted into the SeVV–cDNA backbone as SanDI fragments containing the respective single gene deletion. As a recipient vector an equivalently cut pRS ld-EGFP was used, which is a derivate of pRS3G, being described previously (Leyrer et al., 1998). For the recovery of viral particles the procedure described by Leyrer et al. (1998) and Bitzer et al. (2003b) was used. Subsequently, propagation of SeVV–HN, –F or –M was initiated using Vero cells (infection with a MOI of 0.1), followed by an additional infection with the corresponding adenoviral helper virus (Ad–HN, –F or –M; MOI 100–200). Every day the complete culture medium was replaced by fresh medium containing 3 ␮g/ml acetylated trypsin (acT; Sigma, Germany), pooled and stored at 4 ◦ C. The presence of trypsin was needed to activate the F-fusion protein, being a prerequisite for further amplification. Three days post infection (p.i.) the harvested medium was ultracentrifugated at 100.000 × g at 4 ◦ C for 2 h. The pellet was resuspended in PBS, activated by adding 4 ␮g/ml acT (20 min, 37 ◦ C). To stop acT activity and to stabilize the particles, fetal calf serum was added to a final concentration of 1%; subsequently, aliquots were stored at −80 ◦ C. Using this protocol, all single gene deleted SeVV particles could be propagated, leading to titers between 4 × 104 and 6 × 105 ciu/ml in the cell culture medium. As an example, Fig. 2 shows the spread of SeVV–M during the propagation procedure at different time points post infection. To ensure that no recombination took place during the rescue procedure, or a contamination with SeV wild-type or transducing-competent adenoviral helper viruses occurred, Vero cells were infected with the different –SeVV constructs and RT-PCR was done using primers detecting the deleted genes HN, M or F (Fig. 3). As a result we could show the lack of all the genes HN, M, and F in the host cells harboring recombinant SeVV–HN, SeVV–M, and SeVV–F particles, respectively. In contrast to this, control experiments using wild-type SeV led to a clear detection of all three viral genes (Fig. 3, right side). However, due to the use of a helper virus during the rescue procedure of –SeVV constructs and the cytopathic effect caused by

Fig. 2. Virus propagation of SeVV–M–GFP in Vero cells at different time points (left picture: 24 h; middle picture 48 h; right picture 72 h). GFP expression was analyzed by fluorescence microscopy. Magnification 40×.

C. Bernloehr et al. / Virus Research 99 (2004) 193–197

195

Fig. 3. RT-PCR analysis of recombinant SeVV. Cellular RNA was isolated from SeVV–HN, SeVV–M, and SeVV–F infected Vero cells (MOI 0,1) and RT-PCR was performed using either one of the following specific primer pairs for each viral gene, which is indicated at the bottom of each lane. HN “forward”: 5 GGTGATAGGGGCAAACGTG3 /“reverse”: 5 GACTCGGCCTTGCATAATTTAG 3 ; F “forward”: 5 ATGACAGCA-TATATCCAGAGGTC 3 /“reverse”: 5 TCATCTTTTCTCAGCCATCGC 3 ; M “forward”: 5 GAAATTTCACCTAACACGGC 3 /“reverse”: 5 TCTGCTTGGGGCATTGTC 3 . RT-PCR results from SeVV–HN, –M and F infected cells are shown in lanes 2–4, 5–7, and 8–10, respectively. The amplified genes consisted of 1727 bp by using the HN-, 1046 bp the M- and 1687 bp the F-primers. As a control RNA from SeV wild-type infected Vero cells (MOI 0,1) was used in lanes 13–15. Lane 16 shows a negative control using all three primer pairs (HN, M, and F) but without using cellular RNA.

SeVV infections, it was assumed that there could be at least some adenoviral genomic sequences present within the viral suspensions, being released from dying SeVV particle producing cells. Using a highly sensitive PCR assay (BD AdvantageTM 2 PCR kit, Clontech) we indeed could detect positive signals using adenovirus-specific primer pairs for the regions E1A and E2B (data not shown). In contrast, a RT-PCR done on RNA isolated from –SeVV transduced Vero cells did not result in detection of any of the adenovirally encoded SeV genes (Fig. 3). This clearly indicates that the presence of adenoviral DNA in –SeVV vector suspensions has to be considered as non-functional resulting from a contamination effect. Current work concentrates on improving the system in this respect. For a further raise in SeVV particle yield, we next investigated the impact of different modifications in the rescue and propagation procedure: First, the effectiveness of the amplification process employing different monkey kidney cell lines (Vero, CV-1, LLC-MK2) was compared. As a result, we could not detect any significant difference in titers using these cell lines (data not shown). Second, we and others reported previously that SeV wild-type is able to induce apoptosis in viral host cells (Tropea et al., 1995; Bitzer et al., 1999, 2002). Subsequently, we investigated whether the expression of apoptosis inhibiting genes in potential host cells significantly improves vector titers during the propagation period. For these experiments SeVV host cells were transduced with an additional aden-

oviral vector, coding either for the X chromosome-linked inhibitor of apoptosis (XIAP), a protease inhibitor of the serpin family (CrmA) or the baculovirus protein p35 (kind gifts from S. Kügler, University of Göttingen, Germany (Gerhardt et al., 2001)). The adenoviral encoded apoptosis modifying proteins are known to inhibit the activation of caspases-3/-7/-9 (XIAP), caspases-1/-8 (CrmA) or have a broad inhibitory activity against most of the caspase family enzymes (p35). However, expression of these apoptosis modifying proteins did not significantly influence resulting vector titers (data not shown). Third, we investigated the usage of different cell culture media during the propagation procedure: X-VIVO20TM (Cambrex, Verviers, Belgium; originally produced for the serum-free cultivation of lymphokine activated killer cells, containing human recombinant insulin, albumin and transferrin), DMEM (Cambrex; Dulbeccos Modified Eagles Medium), MEM (Biochrom, Berlin, Germany; Modified Eagle’s Medium), and UltracultureTM (Cambrex; produced for the serum-free cultivation of a wide variety of mammalian cell types, containing human recombinant insulin, bovine transferrin and a purified mixture of bovine serum proteins). Thereby we found that the usage of different media was a crucial factor of virus growth, leading to differences in titers up to a factor of 104 (Fig. 4A–C). UltracultureTM medium was found to yield the lowest titers in all of these experiments, suggesting that it’s composition does not efficiently support SeVV propagation. In contrast, the usage of X-VIVO20TM (for SeVV–HN and

196

C. Bernloehr et al. / Virus Research 99 (2004) 193–197

Fig. 4. Different cell culture conditions dramatically influence virus yield. (A–C) The use of different cell culture media influences virus vector growth. Shown are the propagation of SeVV–HN, –M, and –F particles in the different media X-VIVO20TM (Cambrex), DMEM (Cambrex), MEM (Biochrom), and UltracultureTM (Cambrex). (D) Vitamin E incubation prior to infection enhances virus yield. Vero cells were treated with 50 ␮M vitamin E 1 h before infection with SeVV–HN (MOI 0.1) and Ad–HN (MOI 100) and observed for a period of 8 days. Virus titers in the cell culture supernatant for all experiments have been determined according to Li et al. (2000).

–M propagation), as well as X-VIVO20TM , DMEM or MEM (for SeVV–F propagation) substantially improved the yield of infectious viral particles (Fig. 4A–C). Vitamin E (␣-Tocopherol), a well-known antioxidant substance, potentially protects cells from apoptosis and has been shown to increase viral particle yields in other systems (Li-Weber et al., 2002). As a further improvement of our vector propagation procedure, incubation of the SeVV propagation cells (Vero cells) with vitamin E prior to infection prolonged cell survival (data not shown) and further increased the resulting virus titers (SeVV–HN) by a factor of 30 (Fig. 4D). In conclusion, our experiments demonstrated for the first time that recombinant replication-incompetent adenoviruses can be used to provide SeV proteins in trans during the amplification process of single gene deleted SeVV. Furthermore, we could define experimental conditions that led to optimized SeVV vector titers, leading to much better results following final ultracentrifugation rounds. These changes in the propagation protocol also enabled us to amplify SeVV–HN particles, which had not been described before, and which now can be used for basic virological as well as gene transfer studies. Current work concentrates on a further optimization of vector production for genomes

exhibiting deletions of two (so-called double –SeVV constructs) or even more SeV genes (so-called multiple –SeVV constructs) as a prerequisite for a safe and efficient SeVV application strategy in future gene transfer studies.

Acknowledgements This work was supported by grants from the Deutsche Forschungsgemeinschaft (BI 669/3-1 and 3-2), from the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie (Programm “Gesundheitsforschung 2000” FKZ 312193/4, 01 KV 9806/2, 01 KV 9801), the European Commission (FP5, QLK2-CT-2002-01722) and from the research program “fortüne” of the Medical faculty at Tübingen (fortüne F1281291).

References Bitzer, M., Armeanu, S., Lauer, U.M., Neubert, W.J., 2003a. Sendai virus vectors as an emerging negative-strand RNA viral vector system. J. Gene Med. 5, 543–553. Bitzer, M., Prinz, F., Bauer, M., Spiegel, M., Neubert, W.J., Gregor, M., Schulze-Osthoff, K., Lauer, U., 1999. Sendai virus infection induces

C. Bernloehr et al. / Virus Research 99 (2004) 193–197 apoptosis through activation of caspase-8 (FLICE) and caspase-3 (CPP32). J. Virol. 73, 702–708. Bitzer, M., Ungerechts, G., Bossow, S., Graepler, F.T.C., Sedlmeier, R., Armeanu, S., Bernloehr, C., Spiegel, M., Gross, D.C., Gregor, M., Neubert, W.J., Lauer, U.M., 2003b. Negative-strand RNA viral vectors: intravenous application of Sendai virus vectors for the systemic delivery of therapeutic genes. Mol. Ther. 7, 210–217. Bitzer, M., Armeanu, S., Prinz, F., Ungerechts, G., Wybranietz, W., Spiegel, M., Bernlohr, C., Cecconi, F., Gregor, M., Neubert, W.J., Schulze-Osthoff, K., Lauer, U.M., 2002. Caspase-8 and Apaf-1-independent caspase-9 activation in Sendai virus-infected cells. J. Biol. Chem. 277, 29817–29824. Gerhardt, E., Kugler, S., Leist, M., Beier, C., Berliocchi, L., Volbracht, C., Weller, M., Bahr, M., Nicotera, P., Schulz, J.B., 2001. Cascade of caspase activation in potassium-deprived cerebellar granule neurons: targets for treatment with peptide and protein inhibitors of apoptosis. Mol. Cell. Neurosci. 17, 717–731. Griesenbach, U., Cassady, R.L., Ferrari, S., Fukumura, M., Muller, C., Schmitt, E., Zhu, J., Jeffery, P.K., Nagai, Y., Geddes, D.M., Hasegawa, M., Alton, E.W., 2002. The nasal epithelium as a factory for systemic protein delivery. Mol. Ther. 5, 98–103. Inoue, M., Tokusumi, Y., Ban, H., Kanaya, T., Shirakura, M., Tokusumi, T., Hirata, T., Nagai, Y., Iida, A., Hasegawa, M., 2003. A new Sendai virus vector deficient in the matrix gene does not form virus particles and shows extensive cell-to-cell spreading. J. Virol. 77, 6419– 6429. Kano, M., Matano, T., Nakamura, H., Takeda, A., Kato, A., Ariyoshi, K., Mori, K., Sata, T., Nagai, Y., 2000. Elicitation of protective immunity against simian immunodeficiency virus infection by a recombinant Sendai virus expressing the Gag protein. AIDS 14, 1281–1282. Leyrer, S., Neubert, W.J., Sedlmeier, R., 1998. Rapid and efficient recovery of Sendai virus from cDNA: factors influencing recombinant virus rescue. J. Virol. Methods 75, 47–58. Li, H.O., Zhu, Y.F., Asakawa, M., Kuma, H., Hirata, T., Ueda, Y., Lee, Y.S., Fukumura, M., Iida, A., Kato, A., Nagai, Y., Hasegawa, M., 2000.

197

A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression. J. Virol. 74, 6564–6569. Li-Weber, M., Weigand, M.A., Giaisi, M., Suss, D., Treiber, M.K., Baumann, S., Ritsou, E., Breitkreutz, R., Krammer, P.H., 2002. Vitamin E inhibits CD95 ligand expression and protects T cells from activation-induced cell death. J. Clin. Invest. 110, 681–690. Masaki, I., Yonemitsu, Y., Komori, K., Ueno, H., Nakashima, Y., Nakagawa, K., Fukumura, M., Kato, A., Hasan, M.K., Nagai, Y., Sugimachi, K., Hasegawa, M., Sueishi, K., 2001. Recombinant Sendai virus-mediated gene transfer to vasculature: a new class of efficient gene transfer vector to the vascular system. FASEB J. 15, 1294–1296. Nagai, Y., 1999. Paramyxovirus replication and pathogenesis. Reverse genetics transforms understanding. Rev. Med. Virol. 9, 83–99. Shiotani, A., Fukumura, M., Maeda, M., Hou, X., Inoue, M., Kanamori, T., Komaba, S., Washizawa, K., Fujikawa, S., Yamamoto, T., Kadono, C., Watabe, K., Fukuda, H., Saito, K., Sakai, Y., Nagai, Y., Kanzaki, J., Hasegawa, M., 2001. Skeletal muscle regeneration after insulin-like growth factor I gene transfer by recombinant Sendai virus vector. Gene Ther. 8, 1043–1050. Thomas, C.E., Ehrhardt, A., Kay, M.A., 2003. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346–358. Tropea, F., Troiano, L., Monti, D., Lovato, E., Malorni, W., Rainaldi, G., Mattana, P., Viscomi, G., Ingletti, M.C., Portolani, M., Ceremelli, C., Cossatizza, A., Franceschi, C., 1995. Sendai virus and herpes virus type 1 induce apoptosis in human peripheral blood mononuclear cells. Exp. Cell Res. 218, 63–70. Wybranietz, W.A., Gross, C.D., Phelan, A., O’Hare, P., Spiegel, M., Graepler, F., Bitzer, M., Stahler, P., Gregor, M., Lauer, U.M., 2001. Enhanced suicide gene effect by adenoviral transduction of a VP22-cytosine deaminase (CD) fusion gene. Gene Ther. 8, 1654–1664. Yonemitsu, Y., Kitson, C., Ferrari, S., Farley, R., Griesenbach, U., Judd, D., Steel, R., Scheid, P., Zhu, J., Jeffery, P.K., Kato, A., Hasan, M.K., Nagai, Y., Masaki, I., Fukumura, M., Hasegawa, M., Geddes, D.M., Alton, E.W., 2000. Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat. Biotechnol. 18, 970–973.