Eimeria tenella: Effects of diclazuril treatment on microneme genes expression in second-generation merozoites and pathological changes of caeca in parasitized chickens

Experimental Parasitology 125 (2010) 264–270

Contents lists available at ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

Eimeria tenella: Effects of diclazuril treatment on microneme genes expression in second-generation merozoites and pathological changes of caeca in parasitized chickens Bian-hua Zhou a,b, Hong-wei Wang b, Xiao-yang Wang a, Li-fang Zhang a, Ke-yu Zhang a, Fei-qun Xue a,* a

Key Laboratory of Veterinary Drug Safety Evaluation and Residues Research, Chinese Academy of Agricultural Sciences, Key Laboratory of Animal Parasitology of Ministry of Agriculture, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Minhang, Shanghai 200241, People’s Republic of China College of Animal Science and Technology, Henan University of Science and Technology, Luoyang, Hehan 471003, People’s Republic of China

b

a r t i c l e

i n f o

Article history: Received 17 July 2009 Received in revised form 26 January 2010 Accepted 27 January 2010 Available online 6 February 2010 Keywords: Diclazuril Microneme Second-generation merozoites E. tenella Caeca Quantitative real-time PCR (QRT-PCR)

a b s t r a c t The effects of diclazuril on mRNA expression levels of invasion-related microneme genes were examined in second-generation merozoites of Eimeria tenella (E. tenella) by quantitative real-time (QRT) PCR. Diclazruil treatment of infected chickens significantly decreased the number of second-generation merozoites by 65.13%, and resulted in downregulation of EtMIC genes: EtMIC1 by 65.63%, EtMIC2 by 64.12%, EtMIC3 by 56.82%, EtMIC4 by 73.48%, and EtMIC5 by 78.17%. SEM images of caecum tissue from uninfected chickens showed regular intestinal villus structure. In infected chickens, a distinct loss of the superficial epithelium, with a flattened mucosa and large-area necrosis and anabrosis, was evident. In diclazruil-treated chickens, a decrease in merozoite number and a visibly improved appearance of the caeca were noted. These improvements appeared to be mediated in part by downregulation of the expression of invasion-related EtMIC genes in response to diclazuril. Ó 2010 Elsevier Inc. All rights reserved.

1. Introduction Eimeria tenella (E. tenella) is an obligate intracellular apicomplexan (coccidian) parasite that infects chickens. It causes a severe form of coccidiosis, an enteric disease that is a major welfare and economic problem for the poultry industry. The E. tenella lifecycle is complex, involving both endogenous (schizogamy and gametogony) and exogenous (sporogony) developmental stages. In the course of schizogamy, the second-generation merozoites are released by host cell lysis. However, the merozoites are incapable of extracellular growth or cell division and must rapidly attach to and reinvade other host cells in order to survive and complete their life cycle (Russell, 1983). Repeated developmental cycles of host cell invasion, parasite replication, host cell lysis, and parasite invasion of new host cells result in extensive host tissue damage. In chickens, one of the key symptoms of E. tenella infection is tissue damage in the caecum. The invasive stages (sporozoites, merozoites) of E. tenella are highly polarized cells that have classical structural features shared * Corresponding author. Address: Key Laboratory of Veterinary Drug Safety Evaluation and Residues Research, Chinese Academy of Agricultural Sciences, Key Laboratory of Animal Parasitology of Ministry of Agriculture, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 518 Ziyue Road, Minhang, Shanghai 200241, People’s Republic of China. Fax: +86 21 34293396. E-mail address: [email protected] (F.-q. Xue). 0014-4894/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2010.01.022

by all members of the phylum Apicomplexa. These include a number of specialized secretory organelles (micronemes, rhoptries and dense granules) at their apical end (Tabarés et al., 2004). The microneme organelles contain several proteins that are critical for motility of the parasite, for identification and binding of host cell-surface proteins, and for invasion of the host cells (Ryan et al., 2000). Five important microneme proteins have been identified in E. tenella. One of these, EtMIC1, is a member of the thrombospondin-related anonymous protein (TRAP) family. EtMIC1 is characterized as having one integrin-insertion-I domain, 5 thrombospondin type-I (TSP-I) modules, and conserved transmembrane and C-terminal regions (Tomley et al., 1991). A second protein, EtMIC2, a 50 kDa acidic protein, has been found within the microneme organelles of E. tenella sporozoites and merozoites (Tomley et al., 1996). EtMIC3, cloned by screening a sporozoite cDNA library with two independent monoclonal antibodies raised against the oocyst stage, plays an important role in the invasion and further coccidial development (Labbé et al., 2005). EtMIC4, a 218 kDa microneme protein, is expressed in sporozoites and in all of the merozoite stages of the parasite. EtMIC4, another TRAP family member, contains 31 epidermal growth factor (EGF) modules, 12 TSP-I modules and a highly acidic, proline and glycine-rich region in its extracellular region, in addition to a conserved transmembrane and cytosolic tail (Tomley et al., 2001; Periz et al., 2005). EtMIC5 is a soluble protein composed of eleven tandemly

B.-h. Zhou et al. / Experimental Parasitology 125 (2010) 264–270

repeating modules and belongs to the plasminogen-apple-nematode (PAN) superfamily. Members of this family are found in blood clotting proteins, some growth factors, and some nematode proteins (Brown et al., 2003). In the Apicomplexa, the contents of the microneme are thought to be required for invasion of potential host cells and for the formation of the parasitophorous vacuole. Diclazuril is a triazine-based anticoccidial agent that has proved effective against multiple types of coccidia in numerous hosts, e.g., poultry (Vanparijs et al., 1989a,b,c, 1990), rabbits (Pan et al., 2008), and ruminants (Taylor et al., 2003; Daugschies et al., 2007). In poultry, dose-titration studies and pilot floor-pen trials have clearly demonstrated its potential as an effective agent against Eimeria spp. (Vanparijs et al., 1989a,b,c, 1990; McDougald et al., 1990a,b; Conway et al., 2001; El-Banna et al., 2005). Diclazuril has been found highly effective against both the asexual and sexual stages of the E. tenella life cycle (Maes et al., 1988; Verheyen et al., 1988; Xie et al., 1991; Nodeh et al., 2008; Zhou et al., 2009, 2010). However, the exact mode of action of diclazuril against merozoites has not yet been established. In the present study, we have used a diclazuril clinical procedure trial to investigate the mRNA expression levels of EtMIC genes in second-generation merozoites of E. tenella. We then relate the diclazuril-induced changes in gene expression to the amelioration of pathological changes seen in the caeca of infected chickens treated with diclazuril. 2. Materials and methods 2.1. Chickens For this study, 360 one-day-old male Chinese Yellow Broiler chickens were purchased from the Hatchery of Huizhong, Shanghai, China. The chickens were reared on wire-floored batteries under standard hygienic conditions and given ad libitum access to water and an artificial prepared diet that contained no anthelmintics or anticoccidial drugs. Electric radiators and ventilation fans were used to control the recommended temperature and 24 h of light was provided. The experimental design was approved by the local committee of the Faculty of Veterinary Medicine and conformed to the guidelines of Institutional Animal Care and Use Committee of China. At 14 days of age, the chickens were randomly assigned to three groups of 120, and then further subdivided into three biological replications of 40 chickens each. The three test groups were as follows: (1) Chickens were challenged with distilled water as a sham inoculation and were not treated with either E. tenella oocysts or diclazuril; this was the normal/control group (henceforth the Control group); (2) Chickens were inoculated with E. tenella oocysts (prepared as described below) but were not treated with diclazuril; this represented the infected and untreated group (henceforth the Infected group); (3) Chickens were inoculated with E. tenella oocysts by gavage as described. After 96 h, when infection had set in, these chickens were administered a dose of 1 mg/kg diclazuril in feed for 24 h (i.e., from the 96th to the 120th h); this was the infected and treated group (henceforth the Diclazuril group). 2.2. Preparation of inoculum Oocysts of E. tenella were propagated, isolated, and allowed to sporulate using standard procedures. Sporulated oocysts were placed into 2.5% potassium dichromate (K2Cr2O7) solution. The K2Cr2O7 was then removed by repeated centrifugation and washing in distilled water. Oocysts were counted prior to inoculation of subjects. The total number of sporulated oocysts was estimated by multiplication of the obtained number by the dilution factor. An

265

inoculation dose of 8  104 oocysts/chicken, suspended in 1 ml of distilled water, was given to the chickens by oral gavage. 2.3. Experimental drug Diclazuril (>99%, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Product No: 20080812) was given through the diet at concentration of 1 mg/kg (Vanparijs et al., 1989b; McDougald et al., 1990a). 2.4. Preparation of the second-generation merozoites Second generation E. tenella merozoites were obtained from infected caeca using a technique described previously (Liu et al., 2006), with some modifications. Briefly, the method was as follows: (1) Liberation of merozoites: the chickens were euthanized 120 h post infection, and the merozoites were harvested from parasitized caeca by incubation with hyaluronidase with shaking at 37 °C for 45 min. (2) Crude preparation of merozoites: the parasites were purified by filtration through four layers of gauze and collected by centrifugation. (3) Removal of erythrocytes: erythrocytes were lysed by an erythrocyte disruption solution. The merozoites were pelleted by centrifugation. (4) Percoll density gradient centrifugation: The merozoite pellet was resuspended in 30% Percoll in phosphate-buffered saline (Percoll-PBS). Five volumes of this merozoite solution was layered gently onto one volume of high density 50% Percoll-PBS and centrifuged at 2200g for 15 min. The lower aqueous layer was carefully collected and placed in a fresh centrifuge tube, washed with PBS, and collected by centrifugation. The number of merozoites was counted using a hemocytometer under a light microscope. 2.5. Total RNA extraction and purification RNA was extracted from second generation E. tenella merozoites in TRIzolÒ solution (Invitrogen, USA) following the manufacturer’s instructions. To avoid DNA contamination, the extracted RNA preparations (5 lg) were additionally treated with 5 U of RNase-free DNase I (Takara, China) for 30 min at 37 °C. DNase I was inactivated afterwards by heating (75 °C, 10 min). The total RNA was purified by the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. The total RNA was quantified using a spectrophotometer (Eppendorf, Germany). The integrity of total RNA was confirmed by electrophoresis on a 1% (w/v) agarose/EtBr gel in 1 TAE buffer. Purified total RNA probes were stored at 80 °C until further use. 2.6. Preparation and purification of cDNA The generation of first strand cDNA was conducted using purified total RNA from second-generation merozoites using a SuperScript™ II Reverse Transcriptase kit (Invitrogen, USA) according to the manufacturer’s instructions. Reverse transcriptions were performed at 25 °C for 10 min with 1 lg of total RNA in a final volume of 20 ll containing 150 ng random primer, 0.2 M DTT and 200 U of SuperScript™ II Reverse Transcriptase. Subsequently, first strand cDNA was purified with a QIAquick PCR Purification Kit (Qiagen, Germany), quantified by spectrophotometer (Eppendorf, Germany), and stored at 20 °C. 2.7. QRT-PCR for the relative quantification of EtMIC1, EtMIC2, EtMIC3, EtMIC4 and EtMIC5 The expression levels of microneme genes were quantified by real-time PCR amplification from the cDNA preparation with a RG-3000A real-time PCR system (RoterGene, USA) and SYBRÒ

B.-h. Zhou et al. / Experimental Parasitology 125 (2010) 264–270

2.8. Preparation for SEM

7.0 6.0

per chicken ( 106)

Premix Ex Taq™ (Perfect Real Time) kit (Takara, China). The housekeeping gene was 18S rRNA. The QRT-PCR mixture (20 ll) contained 10 ll SYBR Premix Ex Taq (2), 0.2 lM of primer, 1 ll cDNA template, and 7 ll RNase-free distilled H2O. The QRT-PCR protocol included an initial denaturation at 95 °C for 15 s, followed by 40 PCR cycles consisting of a denaturation step at 95 °C for 5 s, an annealing step at 50–60 °C (depending on the primer pairs) for 10 s, an extension step at 72 °C for 15 s. This was followed by a melting protocol from 72 °C to 95 °C with a 1 °C increment and 45 s holding on first step, then waiting for 5 s for each step afterwards to confirm the specificity of the amplified products. A negative control reaction was included that contained all of the reagents except cDNA to ensure the absence of contamination. The sequences of the primers used are reported in Table 1. The specificity of amplification was confirmed by a melting curve and electrophoretic analysis. Each reaction was performed in twice and the entire experiment was carried out in triplicate.

Mean number of E. tenella merozoites

266

5.0 4.0 3.0

**

2.0 1.0 0.0

Infected group

Diclazuril group

Fig. 1. Mean number of E. tenella merozoites per chicken. **P < 0.01 (the Diclazuril group compared with the Infected group).

At 120 h after inoculation, experimental chickens were euthanized; the caecum was rapidly removed, opened, and rinsed with iced PBS. The tissue was then clamped on a piece of sterile stereoplasm paper and fixed with 2.5% glutaraldehyde PBS (pH 7.4) for SEM (JEOL6380LV) observation. Samples were post fixed in osmium tetroxide solution (pH 7.0), dehydrated with increasing ethanol solutions, mounted on specimen holders, and sputtered with gold. 2.9. Statistical analysis Data are presented as mean ± standard deviation (SD) and were submitted to analysis of variance followed by the student’s t test to compare the results between groups. Differences were deemed significant with a P value < 0.05.

Fig. 2. Agarose gel electrophoretic analysis of total RNA from the second generation E. tenella merozoites.

3. Results 3.1. Extraction of second-generation merozoites The extent of merozoite infection per chicken is shown in Fig. 1. Compared with the Infected group, the number of merozoites of per chicken in the Diclazuril group was decreased by 65.13%. 3.2. Purified total RNA Total RNA was extracted from the second-generation merozoites of E. tenella (Fig. 2). Spectrophotometric and electrophoretic analysis showed the RNA to be of high purity and integrity and it was used for further study.

using the relative standard curve method to calculate the normalized relative expression, using the software of Rotor-Gene version 6.1. Fig. 3 shows the data for two independent reactions performed in triplicate. Compared with the Infected group, in the Diclazuril group, the expression levels of EtMIC1 in second generation merozoite of E. tenella was downregulated by 65.63%, EtMIC2 by 64.12%, EtMIC3 by 56.82%, EtMIC4 by 73.48% and EtMIC5 by 78.17%. Melting curve profiles and electrophoretic analysis of amplification products from each pair of primers showed specificity and the expected size (Fig. 4). 3.4. SEM observation

3.3. Quantification of EtMIC gene expression Standard curves were obtained by correlation of the Ct values (threshold cycles) with the dilution series of both the 18S rRNA and EtMIC genes (Table 2). Quantitative analysis was carried out

The SEM evaluation of chicken caeca in the Control group revealed a normal appearance with regular intestinal villus structure (Fig. 5a and A). However, chickens from the Infected groups showed a superficial epithelial injury characterized by a flattened

Table 1 Primer sequences with their corresponding PCR product size and position. Gene

Primers (50 ? 30 )

Primer locations

Product (base pairs)

Genbank Accession No.

18S rRNA EtMIC1 EtMIC2 EtMIC3 EtMIC4 EtMIC5

ATCGCAGTTGGTTCTTTTGGCCTGCTGCCTTCCTTAGATG CGTCACCTACACGCATTACGTCCTGCACTCACTCGAATTG TCAGCCGTTAGGACGAGAGTAGACAATGAAGTCCCGTTCG CTATACGGAAGGAGCGCTTGGCTGCAGAACTCTTGTGTGC ACACTCCCCATATCCCCTTCCCGCCGTCAGCTCTCTATAC TGGGGTCAAAGAGGGTAGTGTTATCCTCAGCGGATCCAAC

248–417 458–678 101–314 339–507 7460–7652 838–1065

170 221 214 169 193 228

U67121 AF032905 AF111839 FJ374765 AJ306453 AJ245536

267

B.-h. Zhou et al. / Experimental Parasitology 125 (2010) 264–270 Table 2 Equations and related parameters of standard curves. Equations of standard curves

EtMIC1

18S rRNA EtMIC1

Y = 3.354  log(X) + 36.257 Y = 3.281  log(X) + 48.655

99 102

99.96 99.99

EtMIC2

18S rRNA EtMIC2

Y = 3.282  log(X) + 33.810 Y = 3.243  log(X) + 49.369

102 103

99.98 99.97

EtMIC3

18S rRNA EtMIC3

Y = 3.328  log(X) + 35.447 Y = 3.171  log(X) + 42.571

100 107

99.99 99.8

EtMIC4

18s rRNA EtMIC4

Y = 3.345  log(X) + 35.130 Y = 3.181  log(X) + 42.473

99 106

99.99 99.89

EtMIC5

18s rRNA EtMIC5

Y = 3.321  log(X) + 35.496 Y = 3.134  log(X) + 49.367

100 109

100.00 99.75

Relatative expression

Gene

Efficiency (%)

R-square (%)

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 EtMIC1

EtMIC2

Infected group

EtMIC3

EtMIC4

EtMIC5

Diclazuril group

Fig. 3. QRT-PCR analysis of different microneme gene levels in second generation E. tenella merozoites. Columns in the graph represent the mean and SD values of independent reaction performed in triplicate. *P < 0.05, **P < 0.01 (the Diclazuril group compared with the Infected group).

Fig. 4. Specificity of QRT-PCR amplification was determined by melting curve profile analysis and conventional electrophoresis. The horizontal ordinate shows the melting temperature of the amplification product, and the vertical ordinate shows the fluorescence intensity. Lanes 1–3 show 18S rRNA; lanes 4–6 show purpose genes; the left lane show the DNA Marker 2000 (2000, 1000, 750, 500, 250, and 100 bp). Both melting curve profiles and electrophoretic analysis of amplification products from each pair of primers showed specificity and the expected size.

268

B.-h. Zhou et al. / Experimental Parasitology 125 (2010) 264–270

Fig. 5. SEM observation. (a, A) Normal appearance of the caecum in chickens at 120 h after inoculation revealed a normal appearance with regular intestinal villus structure; (b, B) Flattened mucosa, epithelial loss, and even large areas of necrosis and anabrosis of the mucosa of the caecum at 120 h post infection with E. tenella; (c, C) Superficial mucosa of caecum had visibly repaired at 120 h after inoculation following treatment with diclazuril.

mucosa and areas of mucosal damage and epithelial loss, and even complete mucosal sloughing (Fig. 5b). Higher magnification of the lesions clearly demonstrated large areas of necrosis and anabrosis of the mucosa in patches of the superficial epithelial layer of the caecum examined at 120 h post infection (Fig. 5B). In the Diclazuri group, the superficial mucosa of the caecum had visibly repaired to a great extent, although appreciable tumefaction of the intestinal mucosa had occurred within the mucosa in response to the original infection (Fig. 5c and C). 4. Discussion The present study showed that diclazuril decreased the number of second generation E. tenella merozoites in the caeca of parasit-

ized chickens (Fig. 1). Diclazuril treatment also resulted in the downregulation of mRNA expression of EtMIC in these merozoites (Fig. 3). When viewed by SEM, a heavy degree of superficial epithelial injury was apparent in the Infected group (Fig 5b and B). In the Diclazuril group, following the downregulation of the EtMIC genes by diclazuril, the damage to the caeca of the parasitized chickens was visibly repaired (Fig 5c and C). This indicated that downregulation of invasion-related EtMIC genes by diclazuril had allowed the attenuation of damage to caecal mucosa induced by merozoite infection. This finding suggests a theoretical grounding for a mechanism that may underlie the anticoccidiosis properties of diclazuril. The Eimeria lifecycle is complex, involving several asexual stages that are followed by sexual stages in the intestines of the

B.-h. Zhou et al. / Experimental Parasitology 125 (2010) 264–270

chicken. It is in the asexual stages that considerable numbers of merozoites shuttle between the cells of the caecal epithelium and it is this movement of merozoites to new sites of infection that leads to the most damage to the intestinal/caecal tissues. In poultry, merozoite infection causes varying degrees of digestive disturbance, fluid and blood loss, and susceptibility to other diseases. In the present study, the normal caecal tissue of the chickens showed an appearance characterized by a regular intestinal villus structure under SEM (Fig. 5a and A). However, in the Infected group, a distinct loss of the superficial epithelia with atrophy of the intestinal villus and necrosis and sloughing of the mucosal tissue, was seen (Fig. 5b). Higher magnification of these lesions also clearly demonstrated some focal damage to the apical villus structures (Fig. 5B). Thus, second-generation merozoites clearly caused serious physical damage to the caecum following E. tenella infection. In contrast, diclazuril administration visibly ameliorated these negative effects (Fig. 5c and C). In addition, the number of second-generation merozoites was significantly decreased by 65.13%, in the Diclaruril group, compared to the Infected group (Fig. 1). E. tenalla is an obligate intracellular parasite of the caecum and is responsible for coccidiosis. Host cell invasion is a prerequisite for the establishment and maintenance of infection. Merozoites actively invade the superficial mucosa of the caecum in a complex, organized, stepwise process that involves specialized secretory organelles (the micronemes, rhoptries and dense granules) and a unique form of movement termed gliding motility. Microneme proteins, secreted by microneme organelles, play an important role in the E. tenalla infection process (Adams et al., 1992; Bumstead and Tomley, 2000; Naguleswaran et al., 2001; Periz et al., 2007; Kessler et al., 2008). There is an increasing awareness that proper functioning of many biological systems require the formation of complexes composed of many different proteins. In coccidial infection, a cooperative role of the microneme proteins has been elucidated. In E. tenella, EtMIC1 forms a complex with EtMIC2 that is analogous to the TgMIC2-M2AP complex in Toxoplasma gondii (T. gondii) The EtMIC1–2 complex is presumably mobilized from the micronemes to the parasite surface during attachment and is redistributed towards the posterior end of the parasite during penetration of the host cell (Morahan et al., 2007). The different MICs appear to have synergistic roles in the course of apicomplexan parasite infection. Cérède et al. (2005) showed that deletion of MIC1 decreased the invasion rate of tachyzoites in human fibroblasts and that MIC1 and MIC3 performed complementary functions in T. gondii virulence in mice. In the present study, treatment with diclazuril downregulated the expression of EtMIC1, EtMIC2 and EtMIC3 by 65.63%, 64.12% and 56.82%, respectively, in second-generation merozoites in the Diclazuril group, compared to the Infected group. Periz et al. (2007) reported that EtMIC4 and EtMIC5 interact to form an oligomeric, ultrahigh molecular mass protein complex and that the purified complex can bind to a number of epithelial cell lines in culture. In the present study, the expression of both EtMIC4 and EtMIC5 were downregulated by 73.48% and 78.17%, respectively, following treatment with diclazuril. Diclazuril apparently inhibited the expression of the invasion-related EtMIC genes, thus cutting off the conjunction between merozoites and the caecal epithelium and causing the merozoites to lose their invasive capacity. By interfering with this crucial parasitic link, injury to the caecum of the chicken was reduced, as shown by SEM observation (Fig. 5c and C). As well, a decreased invasiveness would also be expected to cause a decrease in merozoite number, which was also supported by the data presented here (Fig. 1). The findings in the present study help to elucidate the complex mechanism underlying diclazuril effects on coccidiosis at the molecular level. The merozoite organelles and its genome would appear to represent valuable targets for development of new

269

therapeutic drugs. However, as seen in the present study, the regulation of the EtMIC genes is complex and involves both transcriptional and post-transcriptional mechanisms. Dissection of the sites affected by diclazuril in terms of regulation of EtMIC genes should now be investigated with further studies that focus on the translation and processing of target proteins. In addition to the microneme proteins described in this study, subtractive PCR and cDNA microarray work ongoing in our laboratory is also pointing out other anticoccidiosis-related targets, such as surface antigens, metabolism related enzymes, etc., (unpublished data), that will need further investigation.

Acknowledgments We gratefully acknowledge Professor Huiqi Zhang of Shanghai Normal University for technical assistance during electron microscopy evaluation. This work was funded by Central Grade Public Welfare Fundamental Science fund for Scientific Research Institute (contract Grant No.: 2008JB09).

References Adams, J.H., Sim, B.K., Dolan, S.A., Fang, X., Kaslow, D.C., Miller, L.H., 1992. A family of erythrocyte binding proteins of malaria parasites. Proceedings of the National Academy of Sciences, USA 89, 7085–7089. Brown, P.J., Mulvey, D., Potts, J.R., Tomley, F.M., Campbell, I.D., 2003. Solution structure of a PAN module from the apicomplexan parasite Eimeria tenella. Journal of Structural and Functional Genomics 4, 227–234. Bumstead, J., Tomley, F., 2000. Induction of secretion and surface capping of microneme proteins in Eimeria tenella. Molecular and Biochemical Parasitology 110, 311–321. Cérède, O., Dubremetz, J.F., Soête, M., Deslée, D., Vial, H., Bout, D., Lebrun, M., 2005. Synergistic role of micronemal proteins in Toxoplasma gondii virulence. The Journal of Experimental Medicine 201, 453–463. Conway, D.P., Mathis, G.F., Johnson, J., Schwartz, M., Baldwin, C., 2001. Efficacy of diclazuril in comparison with chemical and ionophorous anticoccidials against Eimeria spp. in broiler chickens in floor pens. Poultry Science 80, 426–430. Daugschies, A., Agneessens, J., Goossens, L., Mengel, H., Veys, P., 2007. The effect of a metaphylactic treatment with diclazuril (VecoxanÒ) on the oocyst excretion and growth performance of calves exposed to a natural Eimeria infection. Veterinary Parasitology 149, 199–206. El-Banna, H.A., El-Bahy, M.M., El-Zorba, H.Y., El-Hady, M., 2005. Anticoccidial efficacy of drinking water soluble diclazuril on experimental and field coccidiosis in broiler chickens. Journal of Veterinary Medicine A, Physiology Pathology Clinical Medicine 52, 287–291. }z1, A., Hegge, S., Rauch, M., Soldati-Favre, D., Frischknecht, F., Kessler, H., Herm-Go Meissner, M., 2008. Microneme protein 8—a new essential invasion factor in Toxoplasma gondii. Journal of Cell Science 121, 947–956. Labbé, M., de Venevelles, P., Girard-Misguich, F., Bourdieu, C., Guillaume, A., Péry, P., 2005. Eimeria tenella microneme protein EtMIC3: identification, localisation and role in host cell infection. Molecular and Biochemical Parasitology 140, 43–53. Liu, L.H., Li, J., Xu, L.X., Li, X.R., He, T.W., 2006. Separation and purification of second generation merozoites of Eimeria tenella. Animal Husbandy & Veterinary Medicine 38, 38–40. Maes, L., Coussement, W., Vanparijs, O., Marsboom, R., 1988. In vivo action of the anticoccidial diclazuril (ClinacoxÒ) on the developmental stages of Eimeria tenella: a histological study. Journal of Parasitology 74, 931–938. McDougald, L.R., Mathis, G.F., Seibert, B.P., 1990a. Anticoccidial efficacy of diclazuril against recent field isolates of Eimeria from commercial poultry farms. Avian Diseases 34, 911–915. McDougald, L.R., Seibert, B.P., Mathis, G.F., Quarles, C.L., 1990b. Anticoccidial efficacy of diclazuril in broilers under simulated natural conditions in floor pens. Avian Diseases 34, 905–910. Morahan, B.J., Wang, L., Coppel, R.L., 2007. No TRAP, no invasion. Trends in Parasitology 25, 77–84. Naguleswaran, A., Cannas, A., Keller, N., Vonlaufen, N., Schares, G., Conraths, F.J., }rkman, C., Hemphill, A., 2001. Neospora caninum microneme protein Bjo NcMIC3: secretion, subcellular localization, and functional involvement in host cell interaction. Infection and Immunity 69, 6483–6494. Nodeh, H., Mansoori, B., Rahbari, S., Modirsanei, M., Aparnak, P., 2008. Assessing the effect of diclazuril on the intestinal absorptive capacity of broilers infected with experimental coccidiosis, using D-xylose absorption test. Journal of Veterinary Pharmacology and Therapeutics 31, 265–267. Pan, B.L., Zhang, Y.F., Suo, X., Xue, Y., 2008. Effect of subcutaneously administered diclazuril on the output of Eimeria species oocysts by experimentally infected rabbits. Veterinary Research 162, 153–155. Periz, J., Gill, A.C., Knott, V., Handford, P.A., Tomley, F.M., 2005. Calcium binding activity of the epidermal growth factor-like domains of the apicomplexan

270

B.-h. Zhou et al. / Experimental Parasitology 125 (2010) 264–270

microneme protein EtMIC4. Molecular and Biochemical Parasitology 143, 192– 199. Periz, J., Gill, A.C., Hunt, L., Brown, P., Tomley, F.M., 2007. The microneme proteins EtMIC4 and EtMIC5 of Eimeria tenella form a novel, ultra-high molecular mass protein complex that binds target host cells. The Journal of Biological Chemistry 282, 16891–16898. Russell, D.G., 1983. Host cell invasion by Apicomplexa: an expression of the parasite’s contractile system? Parasitology 87, 199–209. Ryan, R., Shirley, M., Tomley, F., 2000. Mapping and expression of microneme genes in Eimeria tenella. International Journal of Parasitology 30, 1493–1499. Tabarés, E., Ferguson, D., Clark, J., Soon, P.E., Wan, K.L., Tomley, F., 2004. Eimeria tenella sporozoites and merozoites differentially express glycosylphosphatidylinositol-anchored variant surface proteins. Molecular and Biochemical Parasitology 135, 123–132. Taylor, M.A., Catchpole, J., Marshall, J., Marshall, R.N., Hoeben, D., 2003. Histopathological observations on the activity of diclazuril (VecoxanÒ) against the endogenous stages of Eimeria crandallis in sheep. Veterinary Parasitology 116, 305–314. Tomley, F.M., Clarke, L.E., Kawazoe, U., Dijkema, R., Kok, J.J., 1991. Sequence of the gene encoding an immunodonimant microneme protein of Eimeria tenella. Molecular and Biochemical Parasitology 49, 277–288. Tomley, F.M., Bumstead, J.M., Billington, K.J., Dunn, P.P., 1996. Molecular cloning and characterization of a novel acidic microneme protein (EtMIC2) from the apicomplexan protozoan parasite, Eimeria tenella. Molecular and Biochemical Parasitology 79, 195–206. Tomley, F.M., Billington, K.J., Bumstead, J.M., Clark, J.D., Monaghan, P., 2001. EtMIC4: a microneme protein from Eimeria tenella that contains tandem arrays of

epidermal growth factor-like repeats and thrombospondin type-I repeats. International Journal of Parasitology 31, 1303–1310. Vanparijs, O., Hermans, L., Marsboom, R., 1989a. Efficacy of diclazuril against turkey coccidiosis in a floor-pen experiment. Avian Diseases 33, 479–481. Vanparijs, O., Marsboom, R., Desplenter, L., 1989b. Diclazuril, a new broad spectrum anticoccidial drug in chickens. 1. Dose titration studies and pilot floor pen trials. Poultry Science 68, 489–495. Vanparijs, O., Marsboom, R., Hermans, L., Van der Flaes, L., 1989c. Diclazuril, a new broad spectrum anticoccidial drug in chickens. 2. Battery trials. Poultry Science 68, 496–500. Vanparijs, O., Marsboom, R., Hermans, L., Van der Flaes, L., 1990. Diclazuril, a new broad- spectrum anticoccidial for chickens. 3. Floor-pen trials. Poultry Science 69, 60–64. Verheyen, A., Maes, L., Coussement, W., Vanparijs, O., Lauwers, F., Vlaminckx, E., Borgers, M., Marsboom, R., 1988. In vivo action of the anticoccidial diclazuril (ClinacoxÒ) on the developmental stages of Eimeria tenella: an ultrastructural evaluation. Journal of Parasitology 74, 939–949. Xie, M.Q., Fukata, T., Gilbert, J.M., McDougald, L.R., 1991. Evaluation of anticoccidial drugs in chicken embryos. Parasitology Research 77, 595–599. Zhou, B.H., Wang, H.W., Xue, F.Q., Wang, X.Y., Fei, C.Z., Wang, M., Zhang, T., Yao, X.J., He, P.Y., 2009. Effects of diclazuril on apoptosis and mitochondrial transmembrane potential in second generation merozoites of Eimeria tenella. Veterinary Parasitology. Doi: 10.1016/j.vetpar.2009.11.007. Zhou, B.H., Wang, H.W., Xue, F.Q., Wang, X.Y., Yang, F.K., Ban, M.M., Xin, R.X., Wang, C.C., 2010. Actin-depolymerizing factor of second generation merozoite in Eimeria tenella: clone, prokaryotic expression and diclazuril-induced mRNA expression. Parasitology Research 106, 571–576.