- Email: [email protected]
Mapping and expression of microneme genes in Eimeria tenella
International Journal for Parasitology 30 (2000) 1493±1499
www.parasitology-online.com
Mapping and expression of microneme genes in Eimeria tenella Rachel Ryan, Martin Shirley, Fiona Tomley* Division of Molecular Biology, Institute for Animal Health, Compton, Berkshire, RG20 7NN, UK Received 17 August 2000; received in revised form 1 September 2000; accepted 1 September 2000
Abstract Microneme organelles are located at the apical tip of invading stages of all apicomplexan parasites and they contain proteins that are critical for parasite adhesion to host cells. In this paper, we have utilised the process of oocyst sporulation in Eimeria tenella to investigate the timing of expression of components of the microneme organelle, at both mRNA and protein levels. Two time-course studies showed that there is a high level of synchrony in the sporulation process, especially during the time period when sporozoites are formed. Western blotting showed that the expression of ®ve microneme proteins (EtMIC1±5) is differentially regulated and highly co-ordinated during sporulation with the proteins being detected only towards the end of the process, as the sporozoites matured within the sporocysts. In contrast, mRNA for all ®ve of these microneme proteins was detected some 10±12 h earlier in sporulation than when the corresponding proteins were seen. Overall these data suggest that the expression of proteins destined for the microneme is regulated both at the transcriptional and translational level. The single copy genes encoding EtMIC1±5 are not clustered on the genome, but are found on four different chromosomes. q 2000 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Eimeria; Microneme; Gene; Expression; Organisation; Sporulation
1. Introduction Micronemes are secretory organelles that are located at the anterior end of invasive stages of all apicomplexan parasites [1]. Morphological, biochemical and functional evidence has shown that some microneme proteins function as specialised adhesins, which are essential for substratedependent parasite motility and attachment to host cells [2]. Secretion of microneme proteins occurs via the parasite apical tip [3,4] and is stimulated by contact with host cells [3,5,6] and regulated, in Toxoplasma gondii, by parasite cytoplasmic free Ca 21 [3]. Microneme secretion is unaffected by treatment with Brefeldin A [7] indicating that the organelles contain a pre-formed store of proteins which are rapidly released onto the parasite surface at the appropriate time for invasion. Little is known about the formation of microneme organelles or of the regulation of microneme protein expression, but from ultrastructural studies it is clear that micronemes are formed afresh during each successive stage of the life cycle. For example, during ®rst generation schizogony the micronemes, together with the pellicle, conoid and subpellicular microtubules of the invading sporozoite, gradually disappear * Corresponding author. Tel.: 144-1635-577-276; fax: 144-1635-577263. E-mail address: ®[email protected] (F. Tomley).
[8] and new micronemes, probably originating from the golgi apparatus, appear late in schizogony, when daughter merozoites separate from the residuum [9,10]. In agreement with this scenario, the Eimeria tenella microneme proteins EtMIC2 and 5 gradually disappear during early schizogony but are detected later as merozoites mature, suggesting that microneme protein expression is co-ordinated and occurs only when micronemes are being assembled in readiness for the next round of host cell invasion [6,11]. Sporulation of the eimerian oocyst results in the formation of sporozoites and has some merits for the study of gene expression during the formation of a discrete, invasive lifecycle stage. For example, sporulation can be carried out under controlled conditions and samples withdrawn for analysis at any time, and newly synthesised proteins are produced within tough cysts that can be rendered surfacesterile and free from contaminating host material and debris. RNA and protein synthesis in semi-permeabilised oocysts of E. tenella has been demonstrated by incorporation of uridine and leucine into trichloroacetic acid (TCA) insoluble fractions [12] and a range of studies have shown major changes in mRNA and protein abundance during sporulation [13± 16]. In this paper, we have used the process of E. tenella sporulation to investigate the timing of expression of components of the microneme organelles at the mRNA
0020-7519/00/$20.00 q 2000 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. PII: S 0020-751 9(00)00116-8
1494
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
and protein level. We also report the chromosomal locations of ®ve genes encoding microneme proteins. 2. Materials and methods 2.1. Parasites Starter cultures of oocysts of the Weybridge (W) and Wisconsin (Wis) strains of E. tenella were kindly provided by Janet Catchpole, Veterinary Laboratories Agency, UK and Dr TK Jeffers, Eli Lilly and Co, USA, respectively. Oocysts were propagated, recovered, sporulated and broken to yield sporozoites that were puri®ed over columns of nylon wool and DE-52 [17]. For the sporulation time-course studies, freshly recovered oocysts were suspended at 2.5 £ 10 5 ml 21 in 2% w/v aqueous potassium dichromate and decanted into 5 l ¯asks, with no more than 2 l of suspension in each ¯ask. The oocysts were sporulated at room temperature (ca. 258C), with continuous bar magnet stirring and vigorous forced aeration through rubber airlines. At sampling times, an aliquot of oocyst suspension was removed and the oocysts pelleted by centrifugation, surface-sterilised using sodium hypochlorite [17], washed several times in water and stored in 1 mM sodium dithionite at 48C. Oocysts from each sample were mounted onto glass slides in 90% glycerol in 100 mM Tris pH 7.6 for photographing at £ 400 magni®cation or in 100 mM Tris pH 7.6 for photographing at £ 1000 magni®cation by differential interference contrast microscopy. 2.2. Antibodies Micronemes were prepared from freshly excysted, puri®ed sporozoites by sonication and sucrose density gradient ultracentrifugation as described previously [18]. Microneme proteins were separated by one and two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE), visualised by staining in aqueous Coomassie brilliant blue and harvested by electro-elution. Hyperimmune sera were prepared in rabbits against ®ve microneme proteins, designated EtMIC1±5. 2.3. Recovery and analysis of proteins from oocysts Oocysts (10 7) were suspended in 300 ml phosphatebuffered saline (PBS), pH 7.6 and 30 ml proteinase inhibitor cocktail (Sigma P2714) in a 1.5 ml eppendorf tube. Three hundred microlitres of #8 glass ballotini (Fisons) were added and the contents of the tube vortexed vigorously. Oocyst breakage was monitored by microscopic examination and the vortexing continued until no intact oocysts, sporocysts or sporozoites could be seen. After three rounds of freezethawing, the oocyst lysate was centrifuged at 14 000 £ g and the supernatant harvested and sonicated for three bursts of 20 s at 10 mm amplitude. The concentration of solubilised protein was determined by spectrophotometry and lysates
stored at 2708C. Proteins were analysed by SDS-PAGE electrophoresis and Western blotting. Brie¯y, samples containing 500 ng protein were boiled in SDS-PAGE sample buffer [19] containing 1 mM dithiothreitol (DTT). Proteins were separated on 10% SDS-PAGE minigels and transferred to nitrocellulose ®lters by semi-dry electroblotting. Non-speci®c binding sites were blocked by incubation for 1 h in 5% w/v milk powder in PBS then ®lters were probed with rabbit antisera against E. tenella microneme proteins followed by goat anti-rabbit IgG conjugated to alkaline phosphatase. Antigen-antibody interactions were visualised by incubation in nitroblue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate, as described previously [20]. 2.4. Recovery of RNA from oocysts Oocysts (2.5 £ 10 7) were suspended in 200 ml RNAsefree water in a 1.5 ml eppendorf tube and 200 ml of sterilised #8 glass ballotini beads were added. After oocyst breakage, as described above, the supernatant was harvested and RNA extracted using a detergent-based total RNA extraction kit (PureScript, Gentra Systems, supplied by Flowgen) according to the manufacturer's instructions. Residual DNA in the preparation was removed by adding 4 U RNAse-free DNAse (Invitrogen) for each 1 mg of RNA and incubating at 378C for 10 min. DNAse was inactivated by incubation at 658C for 5 min and the RNA stored at 2708C in diethylpyrocarbonate-treated water until use. 2.5. Reverse transcription-polymerase chain reaction (RTPCR) Messenger RNAs speci®c for microneme genes EtMIC1± 5, were ampli®ed from total RNA preparations by RT-PCR. Reverse transcriptions to produce ®rst strand cDNAs were done from 8 mg samples of total RNA using random hexanucleotide primers and Moloney murine leukaemic virus reverse transcriptase in a ProSTARe kit (Stratagene). Mock ®rst strand syntheses were also carried out in which reverse transcriptase was omitted. All ®rst strand reactions were used in polymerase chain reaction (PCR) ampli®cations with oligonucleotides speci®c for individual microneme genes and for EtACTIN. The primers and predicted sizes of products are shown in Table 1. 2.6. Pulsed ®eld gel electrophoresis and Southern blotting Chromosomal DNA was prepared from sporozoites of E. tenella in agarose blocks as previously described [21] and loaded into the slots of 0.6% TBE agarose gels (Seakem ME or SeaPlaque low melting point agarose, FMC BioProducts) cast onto 21 cm square glass plates. Electrophoresis was carried out in a CHEF DR11 cell (Bio-Rad) at 45 V for ®rstly 240 h with a ramped pulse time of 1800±6500 s, then 48 h with a pulse time of 2500 s and ®nally 30 h with a pulse time of 300±1700 s. DNA was stained with ethidium bromide and blotted onto nylon ®lters (Hybond-
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
1495
Table 1 Oligonucleotide primers used for the ampli®cation of microneme-speci®c products in RT-PCR analysis, including primer sequence and predicted size of products Gene
Primers
Sequence (5 0 ±3 0 )
Product size (bp)
EtMIC1
Mic23 Tsp5D Mic2rr5.1 Mic2rr3.1 Mic3g Mic3b Mic4rr5.1 Mic4rr3.1 Pjb6 Pjb7 Act1 Act8rr
TTGGTCATGACTGACGGC GTGCAAGCTTAGCATGGAACTTCATTGCATC GAGCGAACGGGACTTCATTG ACTCTGCTTGAACCTCTTCC TGTCGCTGTCAATGACCGCTTGAA GAGGCCGCGGGGCCAGGCTGTGTA CCACGCCTCTTGTGCCAACA GAAGGTGGTGTTGTCGTCGC TTCCGTCAGGGCGTTGGATAC ACTTCGTAGGCCGAAGGGCTG CTGTGAGAAGAACCGGGTGCTCTTC CGTGCGAAAATGCCGGACGAAGAG
1100
EtMIC2 EtMIC3 EtMIC4 EtMIC5 EtACTIN
N, Amersham) as described previously [21]. DNA fragments excised from pBluescript recombinant plasmids, and corresponding to the coding regions of microneme proteins EtMIC1±5, were 32P-labelled by random priming (Prime-It w II, Stratagene) and hybridised to ®lters at 658C in 0.5 M sodium phosphate, pH 7.2, 5% SDS. Filters were washed three times at high stringency (0.1% SDS, 0.1 £ standard saline citrate (SSC)) then exposed to X-ray ®lm (XB-200, X-ograph imaging systems) at 2708C using intensifying screens (Harmer, London).
3. Results 3.1. Synchrony of development and oocyst morphology during sporulation It has been reported that oocyst sporulation in eimerians can be asynchronous [22] such that internal structures show
800 500 1200 400 350
heterogeneity in their morphological appearance at a single time point. To investigate the extent of variation in our system we examined low-power micrographs of oocysts (Fig. 1) and to get a more detailed picture of oocyst morphology we also examined high-power micrographs (Fig. 2). The ®rst time course experiment had sampling times over a 3 day period and the second covered a narrower time-span during the critical period in which sporoblasts and sporozoites matured inside the oocyst. In the ®rst experiment, at 0 h of sporulation the cytoplasm of the sporont in the majority of oocysts was contracted away from the oocyst wall and the central position was occupied by the nucleus (Figs. 1 and 2A). At 6 h, 60% of oocysts looked the same as at 0 h but for 25% the cytoplasm had constricted further (Figs. 1 and 2A), suggesting that nuclear divisions were complete [23] and a further 15% of oocysts had progressed to the two sporont stage. By 12 h, blasting to the four cell stage had occurred in the great majority of the oocysts (Figs. 1 and 2A) but the stage of development varied with 20%
Fig. 1. Morphology of oocysts during sporulation. Oocysts were removed at various times, pelleted by centrifugation, surface-sterilised with sodium hypochlorite and stored in 1mM sodium dithionite at 48C. Oocysts from each sampling point were wet-mounted onto glass slides in 90% glycerol and viewed at 400 £ magni®cation by differential interference microscopy.
1496
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
during sporocyst and sporozoite formation, the second time course experiment was carried out with samples removed between 13 and 29.5 h. In this experiment, a similar high level of synchrony was seen at all time points under low power microscopy (data not shown). Thus the sporulation of oocysts of E. tenella appeared suf®ciently synchronous with regard to the main events, for utility in a study of the expression of microneme genes. In terms of morphology during the second time course experiment, the oocysts at 13 h closely resembled those at 12 h in the ®rst experiment, with four sporoblasts containing granular material (Fig. 2B). By 15.5 h, blasts were developing into elliptical shape and by 18 h these had developed into sporocysts, which did not contain discernible sporozoites (Fig. 2B). By 22.5 h the stieda bodies of the sporoblasts were fully formed and mature sporozoites were clearly visible within the sporocysts (Fig. 2B). The time-scale of morphological events for the sporulation of E. tenella (Wis) reported in this study is similar, but not identical, to that reported for Eimeria maxima [23]. Similar temperatures of incubation were used for both studies, but the development of E. tenella during the ®rst 6 h was faster than that of E. maxima. In fact, E. tenella oocysts at 6 h were at a stage comparable with those of E. maxima at 11 h of sporulation. The reason for this difference is not known, but oocysts of E. maxima are larger than those of E. tenella and are more dif®cult to break by vortexing with glass balls. Thus, it is possible that gaseous exchange across the oocyst wall of E. maxima is less ef®cient than that of E. tenella. 3.2. The appearance of microneme proteins
Fig. 2. Detection of microneme proteins during oocyst sporulation. Oocysts were broken by mechanical shearing and protein samples (500 mg) examined by Western blotting using monospeci®c antibodies against microneme proteins EtMIC1±5. Experiment 1: samples taken from 0±72 h, covering the whole of a sporulation time course. Experiment 2: samples taken from 13± 29.5 h, during which time sporoblasts and sporozoites mature within the oocyst.
being at the `pyramid stage' and 80% having sporoblasts in their ®nal shape. By 24 h, four sporocysts, each containing two apparently mature sporozoites, were clearly visible within the oocysts (Figs. 1 and 2A) and no further morphological changes were seen at 36, 60 and 72 h (Figs. 1 and 2A). Thus, whilst we observed some variation in the degree of cytoplasmic contraction at 0 h and considerable heterogeneity in the rate of development to the two-cell stage at 6 h, a good degree of synchrony was achieved by 12 h and maintained throughout the rest of the sporulation period. Overall, around 10% of the oocysts remained completely unsporulated and 90% proceeded to full sporulation by 24 h. This is very similar to the degree of synchrony previously reported during sporulation of E. tenella [24]. To examine more closely the morphological changes that occurred
Lysates were prepared from oocysts harvested throughout each time course experiments and examined by SDS-PAGE and Western blotting using antibodies speci®c for ®ve different microneme proteins, EtMIC1±5 (Fig. 2). All ®ve proteins were present in oocysts harvested at 22.5 h of sporulation and at all later times. EtMIC4 was detected, very faintly, at 6 and 12 h in the ®rst time course (Fig. 2A) and at 18 h in the second (Fig. 2B) and EtMIC3 was detected very faintly at 18 h. This suggests that these proteins may be expressed, at a low level, at earlier times than the other three microneme proteins that were examined. From examination of high-power photomicrographs, the oocyst morphology at 22.5 h corresponded to the earliest sampling time at which fully formed sporozoites could be seen within the sporocysts. 3.3. Chromosomal localisation of genes encoding microneme proteins Since there was a high level of synchronicity in the detection of the ®ve microneme proteins during sporulation, the chromosomal localisation of genes encoding these proteins was determined to see whether they are clustered in the genome (Fig. 3). Probes corresponding to genes EtMIC1± 5 were hybridised to Southern blots of separated chromosomes of E. tenella. Each probe hybridised to a single chro-
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
1497
carried out several times from batches of RNA prepared on three separate occasions and the same pattern of mRNA expression was detected on each occasion. Thus, it seems that all the microneme speci®c mRNAs are expressed from the time of sporoblast formation onwards and that those for EtMIC3 and 4 are switched on a few hours earlier than those for the remaining genes that were examined. 4. Discussion For apicomplexan parasites, successful progression Fig. 3. Chromosomal localisations of EtMIC1±5. Chromosomes of two strains of E. tenella were separated by pulsed ®eld gel electrophoresis (PFGE) and stained with ethidium bromide (left panel, lhs, E. tenella Wey; rhs, E. tenella Wis). Numbers assigned to chromosomes, which range in size from 1 (chromosome 1) to 7 Mbp (chromosome 14), are indicated by arrows. The line of origin is at the top of the ®gure and the PFGE conditions gave separation of the major chromosomes without any compression zone just below the origin. Chromosomes of E. tenella Wis and Wey from gels subjected to identical PFGE conditions were transferred to ®lters and probed with sequences from EtMIC1±5. Probes and their chromosomal locations are given below the panels; the panel on the right was probed with both EtMIC4 and 5 and the asterisk denotes hybridisation due to EtMIC5. The chromosomal locations of EtMIC3±5, which hybridised to bands that contain two chromosomes under the conditions shown, were con®rmed using gels run under different PFGE conditions (data not shown). The hybridisation of EtMIC3 to chromosome 9 and EtMIC5 to chromosome 14 of the Wis strain was not reproducible.
mosome band and the analysis indicated that EtMIC1 is on chromosome 12, EtMIC2 on chromosome 9, EtMIC3 on chromosome 3, EtMIC4 on chromosome 5 and EtMIC5 on chromosome 9. Thus there is no clustering of genes encoding EtMIC proteins within the genome. 3.4. Expression of microneme-speci®c mRNAs during sporulation To determine whether the co-ordination of microneme protein expression during sporulation is likely to be controlled at the level of transcription or translation, total RNA was isolated from oocysts sampled during the time course experiments and subjected to speci®c RT-PCR reactions (Fig. 4). Before use, RNA preparations were checked for quality by electrophoresis and quanti®ed by spectrophotometry (data not shown). To check that all RT-PCR reactions were working, primers speci®c for the EtACTIN gene, which is expressed constitutively, were included in each reaction. Controls lacking RT were set up for each reaction to ensure that contaminating residual genomic DNA did not contribute to the PCR signals. No signals were obtained in any of these RT negative controls (data not shown). Messenger RNAs speci®c for each of EtMIC1±5 were detected in oocysts from 12 h of sporulation and remained detectable throughout the remainder of the time course (Fig. 4A,B). For EtMIC3 and 4, distinct signals were also detected at 6 h of sporulation (Fig. 4A). These RT-PCR reactions were
Fig. 4. Detection of microneme-speci®c RNA during oocyst sporulation. Oocysts were broken by mechanical shearing and total RNA extracted as described in Section 2. Eight microgram samples of RNA were subjected to RT-PCR reactions using primers speci®c for EtACTIN and for each EtMIC gene. Control reactions, in which RT was omitted, were done on all samples and were negative (data not shown). (A) Experiment 1. (B) Experiment 2.
1498
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
through the life-cycle is dependent upon the ability of transiently extracellular zoites to rapidly invade host cells within which they will replicate. In this paper, we have explored the utility of oocyst sporulation in E. tenella for examining the expression of genes encoding proteins that reside in the microneme, a specialised sub-cellular organelle that is important in the early part of the invasion process. Dramatic morphological changes occur within the oocyst during sporulation that culminate in the production of invasive sporozoites. During the time of sporocyst and sporozoite formation, sporulation is highly synchronous and around 90% of the culture proceeds to full sporulation by 24 h. Thus, samples taken from time-course experiments should give valuable insights into patterns of speci®c gene expression during the differentiation process. From Western blotting it is clear that there is a good degree of co-ordination in the timing of expression of microneme proteins. EtMIC4 was detected at low levels from 6 h, and EtMIC3 detected at low levels from 18 h. However, from 22.5 h onwards, coinciding with the time at which sporozoite maturation occurred, all ®ve of the microneme proteins examined were detected strongly. This pattern of expression is similar to that seen for EtMIC2 and 5 during ®rst generation schizogony, when the proteins are detected only from the time at which daughter merozoites are forming [6,11]. Thus, it appears that expression of microneme proteins is a regulated process and that they are made predominantly during zoite maturation when, presumably, microneme organelles are formed. Since there is no clustering of microneme genes in the E. tenella genome, this regulation is not due to positional effects. To determine whether oocyst sporulation time courses are useful for examining gene expression at the mRNA level, a series of RT-PCR reactions was carried out. Using primers for EtACTIN, a single copy gene, a PCR product of the predicted size was obtained with RNA samples taken throughout the time-courses, con®rming that this gene is expressed constitutively. In contrast, mRNAs for EtMIC1± 5 were not detected until 6 or 12 h into sporulation, indicating that there is regulation of expression between the unsporulated and the sporulating oocyst stages. Whether this temporal regulation is due to differences in transcription between the stages, or is due to post-transcriptional effects, such as differential mRNA turnover, remains to be determined. Interestingly, mRNAs for EtMIC3 and 4 were detected earlier than those for EtMIC1, 2 and 5, which correlates with the slightly earlier detection of these two proteins by Western blotting. For all of the micronemes (MICs), protein was not detected until some 10±12 h after detection of speci®c mRNAs, indicating that post-transcriptional factors are important in the regulation of microneme protein expression. Whether this is due to post-transcriptional effects, or differences in mRNA translation during sporulation also remains to be determined. Overall, this study has shown that the oocyst offers a convenient, synchronous system for analysing speci®c
products of gene expression during the differentiation of the invasive sporozoite. A disadvantage of the system may prove to be the impermeability of the oocyst wall, which could limit its utility for metabolic labelling and/or inhibitor studies. However, following sodium hypochlorite and dimethyl sulphoxide (DMSO) treatment, it has been reported that labelled nucleotides and amino acids can be introduced into the oocyst [12]. Therefore, in combination with speci®c antibodies and DNA sequences, it may be possible to use the model of oocyst sporulation for more detailed studies on the transcription, translation and processing of target proteins.
Acknowledgements We would like to thank Philip Brown for the EtMIC5 primers and Janene Bumstead and Karen Billington for technical advice. RR is supported by an IAH research studentship.
References [1] Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical organelles and host-cell invasion by Apicomplexa. Int J Parasitol 1998;28:1007±13. [2] Tomley FM, Soldati DS. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Parasitol Today 2000, in press. [3] Carruthers VB, Sibley LD. Mobilization of intracellular calcium stimulates microneme discharge in Toxoplasma gondii. Mol Microbiol 1999;31:421±8. [4] Bumstead JM, Tomley FM. Induction of secretion and surface capping of microneme proteins in Eimeria tenella. Mol Biochem Parasitol 2000;110:311±21. [5] Entzeroth R, Kerckhoff H, Konig A. Microneme secretion in Coccidia: confocal laser scanning and electron microscope study of Sarcocystis muris in cell culture. Eur J Cell Biol 1992;59:405±13. [6] Tomley FM, Bumstead JM, Billington KJ, Dunn PP. Molecular cloning and characterization of a novel acidic microneme protein (Etmic2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol Biochem Parasitol 1996;79:195±206. [7] Wan KL, Carruthers VB, Sibley LD, Ajioka JW. Molecular characterisation of an expressed sequence tag locus of Toxoplasma gondii encoding the micronemal protein MIC2. Mol Biochem Parasitol 1997;84:203±14. [8] Chobotar B, Scholtyseck E, SeÂnaud J, Ernst JV. A ®ne structural study of asexual stages of the murine coccidium Eimeria ferrisi Levine and Ivens 1965. Z Parasitenkd 1975;45:291±306. [9] Dubremetz JF. Genesis of merozoites in the coccidian, Eimeria necatrix. Ultrastructural study. J Protozool 1975;22:71±84. [10] Dubremetz JF, Elsner YY. Ultrastructural study of schizogony of Eimeria bovis in cell cultures. J Protozool 1979;26:367±76. [11] Brown PJ, Billington KJ, Bumstead JM, et al. A microneme protein from Eimeria tenella with homology to the apple domains of coagulation factor XI and plasma pre-kallikrein. Mol Biochem Parasitol 2000;107:91±102. [12] Wang CC, Stotish RL. Changes of nucleic acids and proteins in the oocysts of Eimeria tenella during sporulation. J Protozool 1975;22:438±43. [13] Sutton CA, Shirley MW, Wisher MH. Characterization of coccidial
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
[14] [15] [16] [17]
[18]
proteins by two-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Parasitology 1989;99:175±87. Ellis J, Thurlby T. Changes in the messenger RNA population during sporulation of Eimeria maxima. Parasitology 1991;102:1±8. Tomley F. Antigenic diversity of the asexual developmental stages of Eimeria tenella. Parasite Immunol 1994;16:407±13. Abrahamsen MS, Johnson RR, Clark TG, White MW. Developmental regulation of an Eimeria bovis mRNA encoding refractile body-associated proteins. Mol Biochem Parasitol 1994;68:25±34. Shirley MW. Eimeria species and strains of chickens. In: Eckert J, Braun R, Shirley MW, Coudert P, editors. Biotechnology ± guidelines on techniques in coccidiosis research. Luxembourg: European Commission, 1995. pp. 1±24. Tomley F. Techniques for isolation and characterization of apical organelles from Eimeria tenella sporozoites. Methods 1997;13:171±6.
1499
[19] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680±5. [20] Kawazoe U, Tomley FM, Frazier JA. Fractionation and antigenic characterization of organelles of Eimeria tenella sporozoites. Parasitology 1992;104:1±9. [21] Shirley MW. The genome of Eimeria tenella: further studies on its molecular organisation. Parasitol Res 1994;80:366±73. [22] Ferguson DJ, Birch-Andersen A, Hutchinson WM, Siim JC. Light and electron microscopy on the sporulation of the oocysts of Eimeria brunetti. II. Development into the sporocyst and formation of the sporozoite. Acta Pathol Microbiol Scand B 1978;86:13±24. [23] Canning EU, Anwar M. Studies on meiotic division in coccidial and malarial parasites. J Protozool 1968;15:290±8. [24] Wang CC. Inhibition of the respiration of Eimeria tenella by quinolone coccidiostats. Biochem Pharmacol 1976;25:343±9.
www.parasitology-online.com
Mapping and expression of microneme genes in Eimeria tenella Rachel Ryan, Martin Shirley, Fiona Tomley* Division of Molecular Biology, Institute for Animal Health, Compton, Berkshire, RG20 7NN, UK Received 17 August 2000; received in revised form 1 September 2000; accepted 1 September 2000
Abstract Microneme organelles are located at the apical tip of invading stages of all apicomplexan parasites and they contain proteins that are critical for parasite adhesion to host cells. In this paper, we have utilised the process of oocyst sporulation in Eimeria tenella to investigate the timing of expression of components of the microneme organelle, at both mRNA and protein levels. Two time-course studies showed that there is a high level of synchrony in the sporulation process, especially during the time period when sporozoites are formed. Western blotting showed that the expression of ®ve microneme proteins (EtMIC1±5) is differentially regulated and highly co-ordinated during sporulation with the proteins being detected only towards the end of the process, as the sporozoites matured within the sporocysts. In contrast, mRNA for all ®ve of these microneme proteins was detected some 10±12 h earlier in sporulation than when the corresponding proteins were seen. Overall these data suggest that the expression of proteins destined for the microneme is regulated both at the transcriptional and translational level. The single copy genes encoding EtMIC1±5 are not clustered on the genome, but are found on four different chromosomes. q 2000 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Eimeria; Microneme; Gene; Expression; Organisation; Sporulation
1. Introduction Micronemes are secretory organelles that are located at the anterior end of invasive stages of all apicomplexan parasites [1]. Morphological, biochemical and functional evidence has shown that some microneme proteins function as specialised adhesins, which are essential for substratedependent parasite motility and attachment to host cells [2]. Secretion of microneme proteins occurs via the parasite apical tip [3,4] and is stimulated by contact with host cells [3,5,6] and regulated, in Toxoplasma gondii, by parasite cytoplasmic free Ca 21 [3]. Microneme secretion is unaffected by treatment with Brefeldin A [7] indicating that the organelles contain a pre-formed store of proteins which are rapidly released onto the parasite surface at the appropriate time for invasion. Little is known about the formation of microneme organelles or of the regulation of microneme protein expression, but from ultrastructural studies it is clear that micronemes are formed afresh during each successive stage of the life cycle. For example, during ®rst generation schizogony the micronemes, together with the pellicle, conoid and subpellicular microtubules of the invading sporozoite, gradually disappear * Corresponding author. Tel.: 144-1635-577-276; fax: 144-1635-577263. E-mail address: ®[email protected] (F. Tomley).
[8] and new micronemes, probably originating from the golgi apparatus, appear late in schizogony, when daughter merozoites separate from the residuum [9,10]. In agreement with this scenario, the Eimeria tenella microneme proteins EtMIC2 and 5 gradually disappear during early schizogony but are detected later as merozoites mature, suggesting that microneme protein expression is co-ordinated and occurs only when micronemes are being assembled in readiness for the next round of host cell invasion [6,11]. Sporulation of the eimerian oocyst results in the formation of sporozoites and has some merits for the study of gene expression during the formation of a discrete, invasive lifecycle stage. For example, sporulation can be carried out under controlled conditions and samples withdrawn for analysis at any time, and newly synthesised proteins are produced within tough cysts that can be rendered surfacesterile and free from contaminating host material and debris. RNA and protein synthesis in semi-permeabilised oocysts of E. tenella has been demonstrated by incorporation of uridine and leucine into trichloroacetic acid (TCA) insoluble fractions [12] and a range of studies have shown major changes in mRNA and protein abundance during sporulation [13± 16]. In this paper, we have used the process of E. tenella sporulation to investigate the timing of expression of components of the microneme organelles at the mRNA
0020-7519/00/$20.00 q 2000 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. PII: S 0020-751 9(00)00116-8
1494
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
and protein level. We also report the chromosomal locations of ®ve genes encoding microneme proteins. 2. Materials and methods 2.1. Parasites Starter cultures of oocysts of the Weybridge (W) and Wisconsin (Wis) strains of E. tenella were kindly provided by Janet Catchpole, Veterinary Laboratories Agency, UK and Dr TK Jeffers, Eli Lilly and Co, USA, respectively. Oocysts were propagated, recovered, sporulated and broken to yield sporozoites that were puri®ed over columns of nylon wool and DE-52 [17]. For the sporulation time-course studies, freshly recovered oocysts were suspended at 2.5 £ 10 5 ml 21 in 2% w/v aqueous potassium dichromate and decanted into 5 l ¯asks, with no more than 2 l of suspension in each ¯ask. The oocysts were sporulated at room temperature (ca. 258C), with continuous bar magnet stirring and vigorous forced aeration through rubber airlines. At sampling times, an aliquot of oocyst suspension was removed and the oocysts pelleted by centrifugation, surface-sterilised using sodium hypochlorite [17], washed several times in water and stored in 1 mM sodium dithionite at 48C. Oocysts from each sample were mounted onto glass slides in 90% glycerol in 100 mM Tris pH 7.6 for photographing at £ 400 magni®cation or in 100 mM Tris pH 7.6 for photographing at £ 1000 magni®cation by differential interference contrast microscopy. 2.2. Antibodies Micronemes were prepared from freshly excysted, puri®ed sporozoites by sonication and sucrose density gradient ultracentrifugation as described previously [18]. Microneme proteins were separated by one and two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE), visualised by staining in aqueous Coomassie brilliant blue and harvested by electro-elution. Hyperimmune sera were prepared in rabbits against ®ve microneme proteins, designated EtMIC1±5. 2.3. Recovery and analysis of proteins from oocysts Oocysts (10 7) were suspended in 300 ml phosphatebuffered saline (PBS), pH 7.6 and 30 ml proteinase inhibitor cocktail (Sigma P2714) in a 1.5 ml eppendorf tube. Three hundred microlitres of #8 glass ballotini (Fisons) were added and the contents of the tube vortexed vigorously. Oocyst breakage was monitored by microscopic examination and the vortexing continued until no intact oocysts, sporocysts or sporozoites could be seen. After three rounds of freezethawing, the oocyst lysate was centrifuged at 14 000 £ g and the supernatant harvested and sonicated for three bursts of 20 s at 10 mm amplitude. The concentration of solubilised protein was determined by spectrophotometry and lysates
stored at 2708C. Proteins were analysed by SDS-PAGE electrophoresis and Western blotting. Brie¯y, samples containing 500 ng protein were boiled in SDS-PAGE sample buffer [19] containing 1 mM dithiothreitol (DTT). Proteins were separated on 10% SDS-PAGE minigels and transferred to nitrocellulose ®lters by semi-dry electroblotting. Non-speci®c binding sites were blocked by incubation for 1 h in 5% w/v milk powder in PBS then ®lters were probed with rabbit antisera against E. tenella microneme proteins followed by goat anti-rabbit IgG conjugated to alkaline phosphatase. Antigen-antibody interactions were visualised by incubation in nitroblue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate, as described previously [20]. 2.4. Recovery of RNA from oocysts Oocysts (2.5 £ 10 7) were suspended in 200 ml RNAsefree water in a 1.5 ml eppendorf tube and 200 ml of sterilised #8 glass ballotini beads were added. After oocyst breakage, as described above, the supernatant was harvested and RNA extracted using a detergent-based total RNA extraction kit (PureScript, Gentra Systems, supplied by Flowgen) according to the manufacturer's instructions. Residual DNA in the preparation was removed by adding 4 U RNAse-free DNAse (Invitrogen) for each 1 mg of RNA and incubating at 378C for 10 min. DNAse was inactivated by incubation at 658C for 5 min and the RNA stored at 2708C in diethylpyrocarbonate-treated water until use. 2.5. Reverse transcription-polymerase chain reaction (RTPCR) Messenger RNAs speci®c for microneme genes EtMIC1± 5, were ampli®ed from total RNA preparations by RT-PCR. Reverse transcriptions to produce ®rst strand cDNAs were done from 8 mg samples of total RNA using random hexanucleotide primers and Moloney murine leukaemic virus reverse transcriptase in a ProSTARe kit (Stratagene). Mock ®rst strand syntheses were also carried out in which reverse transcriptase was omitted. All ®rst strand reactions were used in polymerase chain reaction (PCR) ampli®cations with oligonucleotides speci®c for individual microneme genes and for EtACTIN. The primers and predicted sizes of products are shown in Table 1. 2.6. Pulsed ®eld gel electrophoresis and Southern blotting Chromosomal DNA was prepared from sporozoites of E. tenella in agarose blocks as previously described [21] and loaded into the slots of 0.6% TBE agarose gels (Seakem ME or SeaPlaque low melting point agarose, FMC BioProducts) cast onto 21 cm square glass plates. Electrophoresis was carried out in a CHEF DR11 cell (Bio-Rad) at 45 V for ®rstly 240 h with a ramped pulse time of 1800±6500 s, then 48 h with a pulse time of 2500 s and ®nally 30 h with a pulse time of 300±1700 s. DNA was stained with ethidium bromide and blotted onto nylon ®lters (Hybond-
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
1495
Table 1 Oligonucleotide primers used for the ampli®cation of microneme-speci®c products in RT-PCR analysis, including primer sequence and predicted size of products Gene
Primers
Sequence (5 0 ±3 0 )
Product size (bp)
EtMIC1
Mic23 Tsp5D Mic2rr5.1 Mic2rr3.1 Mic3g Mic3b Mic4rr5.1 Mic4rr3.1 Pjb6 Pjb7 Act1 Act8rr
TTGGTCATGACTGACGGC GTGCAAGCTTAGCATGGAACTTCATTGCATC GAGCGAACGGGACTTCATTG ACTCTGCTTGAACCTCTTCC TGTCGCTGTCAATGACCGCTTGAA GAGGCCGCGGGGCCAGGCTGTGTA CCACGCCTCTTGTGCCAACA GAAGGTGGTGTTGTCGTCGC TTCCGTCAGGGCGTTGGATAC ACTTCGTAGGCCGAAGGGCTG CTGTGAGAAGAACCGGGTGCTCTTC CGTGCGAAAATGCCGGACGAAGAG
1100
EtMIC2 EtMIC3 EtMIC4 EtMIC5 EtACTIN
N, Amersham) as described previously [21]. DNA fragments excised from pBluescript recombinant plasmids, and corresponding to the coding regions of microneme proteins EtMIC1±5, were 32P-labelled by random priming (Prime-It w II, Stratagene) and hybridised to ®lters at 658C in 0.5 M sodium phosphate, pH 7.2, 5% SDS. Filters were washed three times at high stringency (0.1% SDS, 0.1 £ standard saline citrate (SSC)) then exposed to X-ray ®lm (XB-200, X-ograph imaging systems) at 2708C using intensifying screens (Harmer, London).
3. Results 3.1. Synchrony of development and oocyst morphology during sporulation It has been reported that oocyst sporulation in eimerians can be asynchronous [22] such that internal structures show
800 500 1200 400 350
heterogeneity in their morphological appearance at a single time point. To investigate the extent of variation in our system we examined low-power micrographs of oocysts (Fig. 1) and to get a more detailed picture of oocyst morphology we also examined high-power micrographs (Fig. 2). The ®rst time course experiment had sampling times over a 3 day period and the second covered a narrower time-span during the critical period in which sporoblasts and sporozoites matured inside the oocyst. In the ®rst experiment, at 0 h of sporulation the cytoplasm of the sporont in the majority of oocysts was contracted away from the oocyst wall and the central position was occupied by the nucleus (Figs. 1 and 2A). At 6 h, 60% of oocysts looked the same as at 0 h but for 25% the cytoplasm had constricted further (Figs. 1 and 2A), suggesting that nuclear divisions were complete [23] and a further 15% of oocysts had progressed to the two sporont stage. By 12 h, blasting to the four cell stage had occurred in the great majority of the oocysts (Figs. 1 and 2A) but the stage of development varied with 20%
Fig. 1. Morphology of oocysts during sporulation. Oocysts were removed at various times, pelleted by centrifugation, surface-sterilised with sodium hypochlorite and stored in 1mM sodium dithionite at 48C. Oocysts from each sampling point were wet-mounted onto glass slides in 90% glycerol and viewed at 400 £ magni®cation by differential interference microscopy.
1496
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
during sporocyst and sporozoite formation, the second time course experiment was carried out with samples removed between 13 and 29.5 h. In this experiment, a similar high level of synchrony was seen at all time points under low power microscopy (data not shown). Thus the sporulation of oocysts of E. tenella appeared suf®ciently synchronous with regard to the main events, for utility in a study of the expression of microneme genes. In terms of morphology during the second time course experiment, the oocysts at 13 h closely resembled those at 12 h in the ®rst experiment, with four sporoblasts containing granular material (Fig. 2B). By 15.5 h, blasts were developing into elliptical shape and by 18 h these had developed into sporocysts, which did not contain discernible sporozoites (Fig. 2B). By 22.5 h the stieda bodies of the sporoblasts were fully formed and mature sporozoites were clearly visible within the sporocysts (Fig. 2B). The time-scale of morphological events for the sporulation of E. tenella (Wis) reported in this study is similar, but not identical, to that reported for Eimeria maxima [23]. Similar temperatures of incubation were used for both studies, but the development of E. tenella during the ®rst 6 h was faster than that of E. maxima. In fact, E. tenella oocysts at 6 h were at a stage comparable with those of E. maxima at 11 h of sporulation. The reason for this difference is not known, but oocysts of E. maxima are larger than those of E. tenella and are more dif®cult to break by vortexing with glass balls. Thus, it is possible that gaseous exchange across the oocyst wall of E. maxima is less ef®cient than that of E. tenella. 3.2. The appearance of microneme proteins
Fig. 2. Detection of microneme proteins during oocyst sporulation. Oocysts were broken by mechanical shearing and protein samples (500 mg) examined by Western blotting using monospeci®c antibodies against microneme proteins EtMIC1±5. Experiment 1: samples taken from 0±72 h, covering the whole of a sporulation time course. Experiment 2: samples taken from 13± 29.5 h, during which time sporoblasts and sporozoites mature within the oocyst.
being at the `pyramid stage' and 80% having sporoblasts in their ®nal shape. By 24 h, four sporocysts, each containing two apparently mature sporozoites, were clearly visible within the oocysts (Figs. 1 and 2A) and no further morphological changes were seen at 36, 60 and 72 h (Figs. 1 and 2A). Thus, whilst we observed some variation in the degree of cytoplasmic contraction at 0 h and considerable heterogeneity in the rate of development to the two-cell stage at 6 h, a good degree of synchrony was achieved by 12 h and maintained throughout the rest of the sporulation period. Overall, around 10% of the oocysts remained completely unsporulated and 90% proceeded to full sporulation by 24 h. This is very similar to the degree of synchrony previously reported during sporulation of E. tenella [24]. To examine more closely the morphological changes that occurred
Lysates were prepared from oocysts harvested throughout each time course experiments and examined by SDS-PAGE and Western blotting using antibodies speci®c for ®ve different microneme proteins, EtMIC1±5 (Fig. 2). All ®ve proteins were present in oocysts harvested at 22.5 h of sporulation and at all later times. EtMIC4 was detected, very faintly, at 6 and 12 h in the ®rst time course (Fig. 2A) and at 18 h in the second (Fig. 2B) and EtMIC3 was detected very faintly at 18 h. This suggests that these proteins may be expressed, at a low level, at earlier times than the other three microneme proteins that were examined. From examination of high-power photomicrographs, the oocyst morphology at 22.5 h corresponded to the earliest sampling time at which fully formed sporozoites could be seen within the sporocysts. 3.3. Chromosomal localisation of genes encoding microneme proteins Since there was a high level of synchronicity in the detection of the ®ve microneme proteins during sporulation, the chromosomal localisation of genes encoding these proteins was determined to see whether they are clustered in the genome (Fig. 3). Probes corresponding to genes EtMIC1± 5 were hybridised to Southern blots of separated chromosomes of E. tenella. Each probe hybridised to a single chro-
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
1497
carried out several times from batches of RNA prepared on three separate occasions and the same pattern of mRNA expression was detected on each occasion. Thus, it seems that all the microneme speci®c mRNAs are expressed from the time of sporoblast formation onwards and that those for EtMIC3 and 4 are switched on a few hours earlier than those for the remaining genes that were examined. 4. Discussion For apicomplexan parasites, successful progression Fig. 3. Chromosomal localisations of EtMIC1±5. Chromosomes of two strains of E. tenella were separated by pulsed ®eld gel electrophoresis (PFGE) and stained with ethidium bromide (left panel, lhs, E. tenella Wey; rhs, E. tenella Wis). Numbers assigned to chromosomes, which range in size from 1 (chromosome 1) to 7 Mbp (chromosome 14), are indicated by arrows. The line of origin is at the top of the ®gure and the PFGE conditions gave separation of the major chromosomes without any compression zone just below the origin. Chromosomes of E. tenella Wis and Wey from gels subjected to identical PFGE conditions were transferred to ®lters and probed with sequences from EtMIC1±5. Probes and their chromosomal locations are given below the panels; the panel on the right was probed with both EtMIC4 and 5 and the asterisk denotes hybridisation due to EtMIC5. The chromosomal locations of EtMIC3±5, which hybridised to bands that contain two chromosomes under the conditions shown, were con®rmed using gels run under different PFGE conditions (data not shown). The hybridisation of EtMIC3 to chromosome 9 and EtMIC5 to chromosome 14 of the Wis strain was not reproducible.
mosome band and the analysis indicated that EtMIC1 is on chromosome 12, EtMIC2 on chromosome 9, EtMIC3 on chromosome 3, EtMIC4 on chromosome 5 and EtMIC5 on chromosome 9. Thus there is no clustering of genes encoding EtMIC proteins within the genome. 3.4. Expression of microneme-speci®c mRNAs during sporulation To determine whether the co-ordination of microneme protein expression during sporulation is likely to be controlled at the level of transcription or translation, total RNA was isolated from oocysts sampled during the time course experiments and subjected to speci®c RT-PCR reactions (Fig. 4). Before use, RNA preparations were checked for quality by electrophoresis and quanti®ed by spectrophotometry (data not shown). To check that all RT-PCR reactions were working, primers speci®c for the EtACTIN gene, which is expressed constitutively, were included in each reaction. Controls lacking RT were set up for each reaction to ensure that contaminating residual genomic DNA did not contribute to the PCR signals. No signals were obtained in any of these RT negative controls (data not shown). Messenger RNAs speci®c for each of EtMIC1±5 were detected in oocysts from 12 h of sporulation and remained detectable throughout the remainder of the time course (Fig. 4A,B). For EtMIC3 and 4, distinct signals were also detected at 6 h of sporulation (Fig. 4A). These RT-PCR reactions were
Fig. 4. Detection of microneme-speci®c RNA during oocyst sporulation. Oocysts were broken by mechanical shearing and total RNA extracted as described in Section 2. Eight microgram samples of RNA were subjected to RT-PCR reactions using primers speci®c for EtACTIN and for each EtMIC gene. Control reactions, in which RT was omitted, were done on all samples and were negative (data not shown). (A) Experiment 1. (B) Experiment 2.
1498
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
through the life-cycle is dependent upon the ability of transiently extracellular zoites to rapidly invade host cells within which they will replicate. In this paper, we have explored the utility of oocyst sporulation in E. tenella for examining the expression of genes encoding proteins that reside in the microneme, a specialised sub-cellular organelle that is important in the early part of the invasion process. Dramatic morphological changes occur within the oocyst during sporulation that culminate in the production of invasive sporozoites. During the time of sporocyst and sporozoite formation, sporulation is highly synchronous and around 90% of the culture proceeds to full sporulation by 24 h. Thus, samples taken from time-course experiments should give valuable insights into patterns of speci®c gene expression during the differentiation process. From Western blotting it is clear that there is a good degree of co-ordination in the timing of expression of microneme proteins. EtMIC4 was detected at low levels from 6 h, and EtMIC3 detected at low levels from 18 h. However, from 22.5 h onwards, coinciding with the time at which sporozoite maturation occurred, all ®ve of the microneme proteins examined were detected strongly. This pattern of expression is similar to that seen for EtMIC2 and 5 during ®rst generation schizogony, when the proteins are detected only from the time at which daughter merozoites are forming [6,11]. Thus, it appears that expression of microneme proteins is a regulated process and that they are made predominantly during zoite maturation when, presumably, microneme organelles are formed. Since there is no clustering of microneme genes in the E. tenella genome, this regulation is not due to positional effects. To determine whether oocyst sporulation time courses are useful for examining gene expression at the mRNA level, a series of RT-PCR reactions was carried out. Using primers for EtACTIN, a single copy gene, a PCR product of the predicted size was obtained with RNA samples taken throughout the time-courses, con®rming that this gene is expressed constitutively. In contrast, mRNAs for EtMIC1± 5 were not detected until 6 or 12 h into sporulation, indicating that there is regulation of expression between the unsporulated and the sporulating oocyst stages. Whether this temporal regulation is due to differences in transcription between the stages, or is due to post-transcriptional effects, such as differential mRNA turnover, remains to be determined. Interestingly, mRNAs for EtMIC3 and 4 were detected earlier than those for EtMIC1, 2 and 5, which correlates with the slightly earlier detection of these two proteins by Western blotting. For all of the micronemes (MICs), protein was not detected until some 10±12 h after detection of speci®c mRNAs, indicating that post-transcriptional factors are important in the regulation of microneme protein expression. Whether this is due to post-transcriptional effects, or differences in mRNA translation during sporulation also remains to be determined. Overall, this study has shown that the oocyst offers a convenient, synchronous system for analysing speci®c
products of gene expression during the differentiation of the invasive sporozoite. A disadvantage of the system may prove to be the impermeability of the oocyst wall, which could limit its utility for metabolic labelling and/or inhibitor studies. However, following sodium hypochlorite and dimethyl sulphoxide (DMSO) treatment, it has been reported that labelled nucleotides and amino acids can be introduced into the oocyst [12]. Therefore, in combination with speci®c antibodies and DNA sequences, it may be possible to use the model of oocyst sporulation for more detailed studies on the transcription, translation and processing of target proteins.
Acknowledgements We would like to thank Philip Brown for the EtMIC5 primers and Janene Bumstead and Karen Billington for technical advice. RR is supported by an IAH research studentship.
References [1] Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical organelles and host-cell invasion by Apicomplexa. Int J Parasitol 1998;28:1007±13. [2] Tomley FM, Soldati DS. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Parasitol Today 2000, in press. [3] Carruthers VB, Sibley LD. Mobilization of intracellular calcium stimulates microneme discharge in Toxoplasma gondii. Mol Microbiol 1999;31:421±8. [4] Bumstead JM, Tomley FM. Induction of secretion and surface capping of microneme proteins in Eimeria tenella. Mol Biochem Parasitol 2000;110:311±21. [5] Entzeroth R, Kerckhoff H, Konig A. Microneme secretion in Coccidia: confocal laser scanning and electron microscope study of Sarcocystis muris in cell culture. Eur J Cell Biol 1992;59:405±13. [6] Tomley FM, Bumstead JM, Billington KJ, Dunn PP. Molecular cloning and characterization of a novel acidic microneme protein (Etmic2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol Biochem Parasitol 1996;79:195±206. [7] Wan KL, Carruthers VB, Sibley LD, Ajioka JW. Molecular characterisation of an expressed sequence tag locus of Toxoplasma gondii encoding the micronemal protein MIC2. Mol Biochem Parasitol 1997;84:203±14. [8] Chobotar B, Scholtyseck E, SeÂnaud J, Ernst JV. A ®ne structural study of asexual stages of the murine coccidium Eimeria ferrisi Levine and Ivens 1965. Z Parasitenkd 1975;45:291±306. [9] Dubremetz JF. Genesis of merozoites in the coccidian, Eimeria necatrix. Ultrastructural study. J Protozool 1975;22:71±84. [10] Dubremetz JF, Elsner YY. Ultrastructural study of schizogony of Eimeria bovis in cell cultures. J Protozool 1979;26:367±76. [11] Brown PJ, Billington KJ, Bumstead JM, et al. A microneme protein from Eimeria tenella with homology to the apple domains of coagulation factor XI and plasma pre-kallikrein. Mol Biochem Parasitol 2000;107:91±102. [12] Wang CC, Stotish RL. Changes of nucleic acids and proteins in the oocysts of Eimeria tenella during sporulation. J Protozool 1975;22:438±43. [13] Sutton CA, Shirley MW, Wisher MH. Characterization of coccidial
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499
[14] [15] [16] [17]
[18]
proteins by two-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Parasitology 1989;99:175±87. Ellis J, Thurlby T. Changes in the messenger RNA population during sporulation of Eimeria maxima. Parasitology 1991;102:1±8. Tomley F. Antigenic diversity of the asexual developmental stages of Eimeria tenella. Parasite Immunol 1994;16:407±13. Abrahamsen MS, Johnson RR, Clark TG, White MW. Developmental regulation of an Eimeria bovis mRNA encoding refractile body-associated proteins. Mol Biochem Parasitol 1994;68:25±34. Shirley MW. Eimeria species and strains of chickens. In: Eckert J, Braun R, Shirley MW, Coudert P, editors. Biotechnology ± guidelines on techniques in coccidiosis research. Luxembourg: European Commission, 1995. pp. 1±24. Tomley F. Techniques for isolation and characterization of apical organelles from Eimeria tenella sporozoites. Methods 1997;13:171±6.
1499
[19] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680±5. [20] Kawazoe U, Tomley FM, Frazier JA. Fractionation and antigenic characterization of organelles of Eimeria tenella sporozoites. Parasitology 1992;104:1±9. [21] Shirley MW. The genome of Eimeria tenella: further studies on its molecular organisation. Parasitol Res 1994;80:366±73. [22] Ferguson DJ, Birch-Andersen A, Hutchinson WM, Siim JC. Light and electron microscopy on the sporulation of the oocysts of Eimeria brunetti. II. Development into the sporocyst and formation of the sporozoite. Acta Pathol Microbiol Scand B 1978;86:13±24. [23] Canning EU, Anwar M. Studies on meiotic division in coccidial and malarial parasites. J Protozool 1968;15:290±8. [24] Wang CC. Inhibition of the respiration of Eimeria tenella by quinolone coccidiostats. Biochem Pharmacol 1976;25:343±9.