Eimeria tenella heat shock protein 70 enhances protection of recombinant microneme protein MIC2 subunit antigen vaccination against E. tenella challenge

Veterinary Parasitology 188 (2012) 239–246

Contents lists available at SciVerse ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Eimeria tenella heat shock protein 70 enhances protection of recombinant microneme protein MIC2 subunit antigen vaccination against E. tenella challenge Lei Zhang a,1 , Liping Ma a,1 , Renqiang Liu a , Yunfei Zhang a , Shouping Zhang a , Chunmei Hu a , Meng Song a , Jianping Cai b , Ming Wang a,∗ a

National Laboratory of Veterinary Protozoology, College of Veterinary Medicine, China Agricultural University, Beijing 100193, People’s Republic of China Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, No. 1 Xu Jia Ping, Chengguan District, Lanzhou, Gansu Province, People’s Republic of China b

a r t i c l e

i n f o

Article history: Received 26 October 2011 Received in revised form 16 March 2012 Accepted 16 March 2012 Keywords: Eimeria tenella Heat shock protein 70 Toll-like receptor Cytokine Chicken

a b s t r a c t Heat shock proteins have been reported to stimulate the immune system via innate receptors. Our study found that the novel immunopotentiator, Eimeria tenella (E. tenella) heat shock protein 70 (HSP70), enhanced protective immunity elicited by E. tenella antigen microneme protein 2 (EtMIC2) against avian coccidiosis. It demonstrated that the expression of TLR2 and TLR4 were strongly upregulated in EtHSP70 and EtMIC2 plus EtHSP70 stimulated chicken embryo fibroblasts (CEF) compared with untreated controls and EtMIC2 alone. In addition, the same treatment induced high levels of interleukin (IL)-12 and interferon (IFN)-␥ that are critical cytokines of innate immunity. In vivo experiments involved using broiler chickens subcutaneously immunized with EtMIC2 alone or EtMIC2 plus EtHSP70 at 7 and 14 days post-hatch, which were then orally challenged with live E. tenella at 7 days following secondary immunization. Body weight gains, cecal lesion scores, fecal oocyst shedding, serum antibody responses against MIC2, and intestinal cytokine transcript levels were assessed as measures of protective immunity. Chickens immunized with EtMIC2 plus EtHSP70 showed increased body weight gains, decreased oocyst shedding, increased serum antibody responses, and high levels of IL-12, IFN-␥, and IL-17 compared with the EtMIC2 only or control groups. Moreover, chickens immunized with EtHSP70 alone showed significantly protective effect against E. tenella infection. In summary, this study provides the first evidence of the immunoenhancing activities of EtHSP70 in poultry. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Avian coccidiosis is an intestinal protozoan disease caused by apicomplexan parasites of the genus Eimeria,

∗ Corresponding author at: College of Veterinary Medicine, China Agricultural University, Beijing 100193, People’s Republic of China. Tel.: +86 10 62732840; fax: +86 10 62733961. E-mail address: [email protected] (M. Wang). 1 These authors are the first authors of this article. 0304-4017/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2012.03.025

which results in annual economic losses for the worldwide poultry industry of more than three billion US dollars (Shirley et al., 2004). Prophylactic medication has been successfully used to control avian coccidiosis, but alternative strategies are sought due to the increasing emergence of drug-resistance in commercial production settings (Williams, 2002). Although there is a growing reliance on the use of Eimeria parasite live vaccines for coccidiosis control (Williams and Catchpole, 2000), cross protection against heterologous Eimeria spp. or antigenic variants is poor (Jang et al., 2010). On the other hand, subunit proteins and DNA vaccines are of limited

240

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

immunogenicity and there is a lack of suitable immunoenhancing agents for use in the poultry industry (Ding et al., 2005; Du and Wang, 2005; Min et al., 2001). Heat shock protein (HSP) 70 is a molecular chaperone which is critically involved in the maintenance of cell homeostasis, so it may be the reason why the protein is highly conserved. HSPs function as both chaperones and cytokines in the extracellular milieu (Asea et al., 2000). Microbial HSP70s have been found to be potent activators of the innate immune system and generate specific immune responses against tumors and various infectious agents, such as protozoan parasites (de Miguel et al., 2009; Qazi et al., 2007; Srivastava, 2002). It is found that Toxoplasma gondii (T. gondii) HSP70 was an agonist of Toll-like receptor (TLR) 2 and TLR4 (Aosai et al., 2006; Mun et al., 2003, 2005), and could activate B cells and dendritic cells (DC) (Aosai et al., 2002, 2006; Kang et al., 2004; Kikumura et al., 2010). In addition to the activation of innate immunity, HSPs can also facilitate antigen presentation on major histocompatibility protein class I (MHC-I) and class II (MHC-II) for the promotion of antigen-specific pathways (Segal et al., 2006). HSP-based vaccines target multiple innate and antigendriven pathways, making this approach attractive for the treatment of intracellular and extracellular pathogens. For example, DNA vectors containing Mycobacterium tuberculosis alanine–proline-rich antigen (Apa), Hsp65, and Hsp70 mycobacterial antigens, combined with the BCG vaccine, induced more robust immunity and conferred greater protection than BCG alone in mice challenged with tuberculosis (Ferraz et al., 2004). Many studies have described the ability of protozoan HSP70 to enhance the immunogenicity of associated antigens. HSP70 from Trypanosoma cruzi (T. cruzi), Plasmodium falciparum (P. falciparum), and T. gondii can function as adjuvants and can greatly enhance the protective immunity induced by antigens against protozoan infection (Makino et al., 2011; Planelles et al., 2001; Qazi et al., 2005; Rahman et al., 2003). Although there are many data supporting the adjuvant-like effects of HSP70, the effect of EtHSP70 from Eimeria tenella has not been investigated. The aim of the present study is to investigate the immunoenhancing effects of EtHSP70 to augment the immunogenicity of EtMIC2 against E. tenella infection in chickens. 2. Material and methods 2.1. Chickens One-day-old Arbor Acre (AA) broiler chickens obtained from the Huadu Broiler Hatchery (Being, China) were reared in a coccidia-free laboratory, housed in cages, and provided free access to feed and water. Chickens were randomly assigned to four groups of 16 birds per group (4 birds per cage). 2.2. Parasites Parental Houghton strain E. tenella was kindly provided by Martin W. Shirley (Institute for Animal Health, Compton Laboratory, UK) and maintained by passage

every three months in susceptible chickens at the College of Veterinary Medicine, China Agricultural University, China. 2.3. Expression and purification of recombinant EtMIC2 and EtHSP70 Recombinant EtMIC2 and EtHSP70 were prepared according to the previously described method (Subramanian et al., 2008; Tomley et al., 1996). Briefly, the total RNA was isolated from the Houghton strain E. tenella sporozoites using Trizol reagent (Invitrogen, USA), and was reverse transcribed into cDNA using random primers. The recombinant EtMIC2 and EtHSP70 were cloned from E. tenella cDNA. The 2034-base pair HSP70 and 1029-base pair MIC2 cDNA were subcloned into the pET-21a plasmid with a 6x His tag. Transformed Escherichia coli Rossetta bacteria was grown overnight to mid-log phase, induced with 1.0 mM of isopropyl-␤-d-thiogalactopyranoside for 4 h at 37 ◦ C, collected by centrifugation, and disrupted by sonication on ice. The recombinant protein EtMIC2 was isolated on Ni-NTA affinity column (Merck, Darmstadt, Germany) according to the manufacturer’s instructions. EtHSP70 was isolated from inclusion bodies and was refolded by serial dialysis by different concentration of urea (8 M, 6 M, 4 M, 2 M) into phosphate buffer. Final purity was confirmed by sodium dodecyl sulphate–polyacrylamide gel electrophoresis and Western blotting with rabbit anti-6X His monoclonal antibody (Abcam, Cambridge, MA) at a 1:1500 dilution. 2.4. Stimulation of CEFs by EtHSP70 and EtMIC2 Primary cell cultures of CEFs (9-day embryos) were prepared according to standard techniques. Cells were cultured in Dulbecco’s modified Eagles medium (DMEM) supplemented with penicillin/streptomycin, 10% foetal bovine serum, and incubated at 41 ◦ C, 5% CO2 for 18–24 h. The cells were stimulated with 2 ␮g/mL EtMIC2 alone, 2 ␮g/mL EtHSP70 alone, 2 ␮g/mL EtMIC2 plus EtHSP70 (1 ␮g/mL, separately), and 2 ␮g/mL chicken egg ovalbumin (OVA) (Sigma Chemical Co., St. Louis, MO) respectively. The endotoxin was removed using an endotoxin-removing column (Thermo Scientific, Rockford, IL, USA) in accordance with the manufacturer’s instructions. Optimal concentrations for stimulation of CEFs were determined by our pre-tests (unpublished data). CEFs were harvested 12 h post-stimulation and lysed using TRIzol (Invitrogen, Carlsbad, CA). Samples were stored at −80 ◦ C until used for TLR and cytokine expression analysis. Each experiment was repeated three times. 2.5. Immunization and parasite-challenge infection The experimental plan is summarized in Table 1. At 1 week of age, chickens were subcutaneously immunized with 100 ␮g of EtMIC2 alone or EtMIC2 supplemented with EtHSP70 in 100 ␮L phosphate buffered saline (PBS). Control chickens were immunized with PBS or 100 ␮g EtHSP70. At 1 week post primary immunization (PPI), chickens were given an identical secondary subcutaneous

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

241

Table 1 Summary of the experimental design. Treatment group

Number of birds

Protein (␮g/bird)

Challenge infection

Uninfected control MIC2 HSP70 MIC2 + HSP70 Infected control

16 16 16 16 16

0 100 100 100 0

– 3.0 × 104 3.0 × 104 3.0 × 104 3.0 × 104

E. tenella E. tenella E. tenella E. tenella

booster injection. At 7 days post secondary immunization (PSI), all groups were orally challenged with 30,000 sporulated E. tenella oocysts. The number of challenged E. tenella sporulated oocysts was determined by our pre-tests (unpublished data).

(Johnson and Reid, 1970) and evaluated by three independent observers.

2.6. Measurements of body weight gains and fecal oocyst shedding

In both experiments, five birds from each group were euthanized by cervical dislocation at 3, 6, and 10 dpi before ceca were collected. IELs were isolated according to the previously described method (Hong et al., 2006). Briefly, ceca were cut longitudinally and washed five times with ice-cold Hank’s balanced salt solution (HBSS) containing 100 U/mL of penicillin and 100 mg/mL of streptomycin (M&C gene Technology, China). The tissue was incubated in HBSS containing 0.5 mM EDTA and 5% foetal calf serum for 20 min at 37 ◦ C with constant swirling. Released cells were further purified using a commercial lymphocyte separation medium (M&C gene Technology, China) with centrifugation at 200 × g for 20 min at room temperature. Cell viability was consistently greater than 90% by trypan blue dye exclusion assay, and IELs consisted 84–90% in the total cell harvest under a microscope. Flow analysis was conducted by using the surface markers CD4 and CD8 (Southern Bio tech, Birmingham, AL). The proportion of CD4+ 12.98 ± 0.47% and the proportion of CD8+ cells was 73.94 ± 2.19% (see Supplementary Figure). The concentration of IELs from each chicken was counted under a blood cell counting plate, 5 × 107 IELs from each sample were lysed using TRIzol (Invitrogen) and stored at −80 ◦ C.

Body weights were measured between 0 and 10 days post-infection (dpi). For the determination of fecal oocyst shedding, birds (10 per group) were placed in oocyst collection cages and fecal samples were collected between 6 and 10 dpi. Numbers of oocyst were determined using a McMaster chamber according to the following formula: total oocysts/bird = [oocyst count × dilution factor × (fecal sample volume/counting chamber volume)]/2 (Xu et al., 2006). 2.7. Measurement of serum antibody responses At 7 days PPI and PSI, blood was collected from the wing static vein of the birds (five per group), and sera were prepared by low speed centrifugation and used to measure antibody responses against EtMIC2 by enzyme-linked immunosorbent assay (ELISA). Microtiter plates were coated with EtMIC2 (2 ␮g/well) overnight, and washed with PBS containing 0.05% Tween 20, and blocked with 5% non-fat milk. Diluted serum samples (1:10) were incubated with continuous shaking. The plates were washed, and bound antibody was detected with 1:1000 diluted peroxidase-conjugated rabbit anti-chicken IgG (Sigma, St. Louis, MO). Optical density values at 450 nm (OD450) were measured using an automated microplate reader (Bio-Rad, Richmond, CA). 2.8. Determination of intestinal lesion scores At 6 dpi, lesion scores (five birds per group) were determined using a numerical scale from 0 (normal) to 4 (severe)

2.9. Isolation of cecal intestinal intraepithelial lymphocyte (IELs)

2.10. RNA extraction and quantitative polymerase chain reaction (qPCR) Total RNA was extracted from IELs using TRIzol (Invitrogen) and the concentration determined using a spectrophotometer (DU 800; Beckman-Coulter, Indianapolis, IN), and the OD 260/280 ratio was examined to assess RNA quality. RNA (0.2 ␮g) was treated with DNase I (Sigma–Aldrich, St Louis, MO) and was reverse transcribed into cDNA using random primers and stored at −20 ◦ C.

Table 2 Real-time PCR primer and GenBank accession numbers of chicken TLRs. Target gene

Forward primer (5 –3 )

Reverse primer (5 –3 )

Genbank accession

TLR2 TLR4 IL-12 IFN-␥ IL-17 ␤-Actin

GATTGTGGACAACATCATTGACTC CCAACCCAACCACA GAGCCAAGCAAGACG GCCGCACATCAAACACATATCT ATGGGAAGGTGATACGGC CAACACAGTGCTGTCTGGTGGTA

AGAGCTGCTTTCAAGTTTTCCC AACAAAGGCATCATAGA TTTATCAGTGCGAGCC TGAGACTGGCTCCTTTTCCTT GATGGGCACGGAGTTGA ATCGTACTCCTGCTTGCTGATCC

NM 001161650 NM 001030693 NM 213571 AY705909 AM773756 NM 205518

242

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

Primers for IL-12, IFN-␥, and IL-17 are shown in Table 2. The qPCR analysis was performed using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). The reaction was performed on an ABI 7500 with the steps: 95 ◦ C for 10 min, 40 cycles of denaturation at 95 ◦ C for 15 s, annealing at 52 ◦ C for 30 s, extension at 72 ◦ C for 50 s. Data analysis was performed using the 7500 software (version 2.0; Applied Biosystems). The efficiency of amplification of the target gene and internal control was examined using real-time PCR detection which can validate of the 2−Ct method used in this investigation. Gene expression was normalized to the control group by the 2−Ct method using ␤-actin as an internal standard (Livak and Schmittgen, 2001). 2.11. Statistical analysis All data were expressed as the mean ± SD of 3–10 chickens per group with three replicates per sample. Comparisons of the mean values were performed by one-way analysis of variance followed by the Duncan’s multiple range test using SPSS software (SPSS 15.0 for Windows; SPSS, Chicago, IL, USA). Differences between groups were considered statistically significant at P < 0.05. 3. Results 3.1. EtHSP70 stimulated TLR signaling in CEFs In this experiment, the involvement of TLRs in EtHSP70stimulated CEFs was examined. TLR2 and TLR4 were significantly upregulated in EtHSP70 compared with EtMIC2 alone treated CEFs (Fig. 1A and B). IL-12 and IFN␥ were also increased in EtHSP70 treated CEFs compared with control cells (Fig. 1C and D). 3.2. Reduced oocyst shedding and enhanced body weight gain in chickens vaccinated with EtMIC2 plus EtHSP70 In the absence of EtMIC2 immunization, E. tenella infected chickens showed significantly reduced body weight gains (433.3 ± 25.4 g) compared with the uninfected controls (660.5 ± 23.4 g) (Fig. 2A). Chickens immunized with EtMIC2 alone and infected with parasites also exhibited weight gains (511.7 ± 15.8 g). Chickens immunized with EtMIC2 plus EtHSP70 exhibited additional weight gains (631.2 ± 13.8 g) compared with animals immunized with EtMIC2 alone. In contrast, fecal oocyst shedding in the EtMIC2 plus EtHSP70 group (5.70 ± 0.95 × 108 oocysts) was significantly reduced compared with those immunized with EtMIC2 alone (12.64 ± 0.91 × 108 oocysts) (Fig. 2B). 3.3. Enhanced serum antibody responses in EtMIC2 plus EtHSP70 chickens Serum antibody against EtMIC2 levels in the EtMIC2 plus EtHSP70 group showed no significantly change compared with EtMIC2 alone groups at 7 days PPI (Fig. 3A). At 7 days PSI, antibody against EtMIC2 levels in the EtMIC2 plus

Fig. 1. Effect of CEFs stimulated with EtMIC2 plus EtHSP70 on TLR signaling. CEFs were stimulated with 2 ␮g/mL EtMIC2 alone, EtHSP70 alone, EtMIC2 plus EtHSP70 and OVA. Optimal concentrations for stimulation of CEFs were determined by previous trials. CEFs were harvested 12 h poststimulation and TLRs and cytokine expression analysis was performed by qPCR. Each experiment was repeated at least three times. (A) TLR2 expression; (B) TLR4 expression; (C) IL-12 expression; (D) IFN-␥ expression; Bars not sharing the same letters were significantly different according to the Duncan’s multiple range test (P < 0.05).

EtHSP70 group was significantly enhanced in EtMIC2 plus EtHSP70 group compared to EtMIC2 alone (Fig. 3B). 3.4. The effect of vaccination with EtMIC2 plus EtHSP70 on intestinal lesion scores and cytokine expression Intestinal lesion scores in the EtMIC2 plus EtHSP70 group (2.02 ± 0.1) were significantly decreased compared with those of the control group (3.9 ± 0.2) (Fig. 4). Comparison of the intestinal lesion scores of animals immunized with only EtMIC2 (2.3 ± 0.2) and EtMIC2 plus EtHSP70 revealed significant difference. The levels of transcripts encoding IL-12, IFN-␥, and IL-17 cytokines in the cecum IELs increased in the animals immunized with EtMIC2 only

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

243

Fig. 2. Effect of vaccination with EtMIC2 plus EtHSP70 on body weight gains and fecal oocyst shedding. Chickens were immunized subcutaneously with PBS (infected and uninfected control), or 100 ␮g EtMIC2 alone, or EtHSP70 alone or EtMIC2 supplemented with EtHSP70 and infected with 3.0 × 104 Eimeria tenella oocysts (except for uninfected control). The body weight gains (A) were determined between 0 and 10 dpi and fecal oocyst shedding was determined between 6 and 10 dpi (B). Each bar represents the mean ± SD values (n = 10). Bars not sharing the same letters were significantly different according to the Duncan’s multiple range test (P < 0.05). Fig. 4. Effect of vaccination with EtMIC2 plus EtHSP70 on intestinal lesion scores. Chickens were immunized and infected as in Fig. 2, and lesions were scored from 0 (normal) to 4 (severe) at 10 dpi. Each bar represents the mean ± SD values from three independent observers (n = 5). Bars not sharing the same letters were significantly different according to the Duncan’s multiple range test (P < 0.05).

and EtMIC2 plus EtHSP70 groups compared with the control group (Fig. 5). The levels of transcripts encoding IL-17 and IL-10 were also found to be increased in the EtMIC2 plus EtHSP70 group compared with the EtMIC2 only group. 4. Discussion

Fig. 3. Effect of vaccination with EtMIC2 plus EtHSP70 on EtMIC2 serum antibody levels. Chickens were subcutaneously immunized with 100 ␮g of EtMIC2 alone or EtMIC2 supplemented with EtHSP70 in 100 ␮L PBS at 7 and 14 days. Control chickens were immunized with PBS (infected and uninfected control) or 100 ␮g EtHSP70. The serum antibody against EtMIC2 was determined by ELISA at 7 days post-primary (A) and 7 days post-secondary (B). Each bar represents the mean ± SD values from quadruplicate samples per bird (n = 5). Bars not sharing the same letters were significantly different according to the Duncan’s multiple range test (P < 0.05).

Novel vaccination control strategies, including recombinant protein or DNA vaccination strategies, have been attempted for the control of avian coccidiosis (Shirley et al., 2007). However, accumulating evidence indicates that subunit vaccines based on recombinant proteins require strong adjuvants for eliciting adequate immune responses (Lillehoj et al., 2000). Intensive research efforts are being made to develop adjuvants as immunostimulators to enhance the immunogenicity of subunit vaccines (Jang et al., 2011; Lee et al., 2010). Previous studies have shown HSP70 from T. gondii and P. falciparum can be recognized by TLR2 and TLR4 to induce the production of IL-12 and IFN-␥ (Aosai et al., 2006; Mun et al., 2003, 2005). Stimulation of TLRs is not only sufficient for activation of innate

244

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

Fig. 5. Effect of vaccination with EtMIC2 plus EtHSP70 on intestinal cytokine transcript levels. Chickens were immunized as in Fig. 2, and intestinal cecum IELs tissues were isolated at 3 dpi (A–C), 6 dpi (D–F), 10 dpi (G–I), and transcripts encoding IL-12 (A–C), IFN-␥ (D–F), IL-17 (G–I) were quantified by qPCR (normalized to ␤-actin transcript levels). Each bar represents the mean ± SD values from triplicate samples/bird (n = 3 birds/group). Bars not sharing the same letters are significantly different according to the Duncan’s multiple range test (P < 0.05).

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

immune responses, but also required for induction of Thelper type 1 (Th1) responses (Schnare et al., 2001). HSP70 can be used as an adjuvant in combination with immunogens that enhance immune responses to the antigen of interest (Segal et al., 2006). EtMIC2 is one of the most important microneme proteins which is secreted from the host–parasite interface and intimately involved in host–cell invasion (Bumstead and Tomley, 2000). Immunization of chickens with the EtMIC2 gene or recombinant protein EtMIC2 was shown to partially reduce oocyst output and increase weight gain upon challenge (Dalloul et al., 2005; Ding et al., 2005). The current study used an EtMIC2 subunit vaccine to evaluate the immunoenhancing effects of EtHSP70 to afford protection against oral challenge infection with live sporulated E. tenella oocysts. First, we investigated whether EtHSP70 can activate innate immunity and enhance the immune response of EtMIC2 through chicken TLRs. The results showed that chicken TLR2 and TLR4 were both significantly (P < 0.05) upregulated when exposed to EtHSP70 plus EtMIC2 compared with EtMIC2 alone (Fig. 1A and B). EtHSP70 also significantly enhanced the induction of the proinflammatory cytokines, IL-12 and IFN-␥, by CEFs compared with EtMIC2 alone (P < 0.05) (Fig. 1C and D). Based on the results of in vitro studies that showed EtHSP70 can enhance the activation of innate immunity to EtMIC2 by producing high levels of IL-12 and IFN-␥ mRNA, we next investigated whether EtHSP70 can enhance the protective effect of EtMIC2 vaccination against E. tenella infection in vivo. The major findings are that immunization of chickens with EtMIC2 plus EtHSP70 can reduce fecal oocyst shedding, enhance body weight gain, elicit higher antibody responses, and produce high levels of IL-12, IFN␥, and IL-17 compared with EtMIC2 alone. It is generally accepted that body weight gain and fecal oocyst shedding are reliable clinical signs for the evaluation of vaccine efficacy and protective immunity in avian coccidiosis (Lillehoj and Lillehoj, 2000). The adjuvant effect of cytokines, such as chicken IL-2, IL-15, IFN-␥, in vaccines against coccidiosis was previously described by Min and Lillehoj (Lillehoj et al., 2005; Min et al., 2001). The study found that IFN-␣ and lymphotactin can only enhance body weight gain, whereas IL-8, IFN-␥, IL-15, TGF-␤4, and IL-1␤ can only decrease fecal oocyst shedding. The current study showed that EtHSP70 produced a better adjuvant effect than cytokines when coadministrated with EtMIC2. From the results, we found the protective effect of EtHSP70 alone was quite remarkable which showed increased body weight gains, decreased oocyst shedding, and high levels of IL-12, IFN-␥, and IL-17 compared to the EtMIC2. This study showed EtHSP70 is a better candicate subunit vaccine compared to EtMIC2. Transcript levels of IL-12, IFN-␥, and IL-17 were significantly upregulated in the cecum of animals vaccinated with EtMIC2 plus EtHSP70 compared with EtMIC2 alone. Chicken IL-12, IFN-␥, and IL-17 production together play a critical immunoregulatory role in the initiation, maintenance, and control of intestinal inflammatory responses (Min and Lillehoj, 2002). IFN-␥ can significantly increase host protection against coccidiosis and reduce the intracellular development of Eimeria in

245

chickens when administrated with recombinant chicken IFN-␥ alone (Lillehoj et al., 2004). IL-12 plays a critical role during Eimeria infection by promoting the early production of IFN-␥ (Hong et al., 2006). High levels of IL-12 and IFN␥ indicate that a stronger Th1 response was activated that was predominant for protective responses during coccidiosis (Dalloul and Lillehoj, 2005). IL-17 is a cytokine which is secreted by activated memory CD4+ T cells and modulates the early stage of immune responses (Broxmeyer, 1996). Previous study has shown that IL-17 production started at day 1 and peaked at day 2 in LPS-stimulated lymphocytes (Ferretti et al., 2003; Lockhart et al., 2006). In our experiment, expression of IL-17 was peaked at 3 dpi. Recently, IL-17, the typical cytokine produced by T-hepler type 17 (Th17) cells, has been intensively investigated for various infectious diseases (Korn et al., 2009). Chicken IL17 may also play a protective role during Eimeria infection (Hong et al., 2006; Kim et al., 2008). The high expression of intestinal cytokine transcripts may suggest that EtHSP70 enhances the EtMIC2 protection against coccidiosis by promoting strong adaptive immunity. On the other hand, high proinflammatory cytokines can induce damage of host tissue (Gazzinelli and Denkers, 2006) that may explain why EtHSP70 had no effect on cecal lesion scores compared with EtMIC2 alone. In conclusion, the current study indicated that EtHSP70 may be an important immunopotentiator in subunit vaccines. The enhanced protection observed against experimental avian coccidiosis by EtHSP70 is the result of augmented cellular and humoral immune responses. Our in vitro studies may partially explain why EtHSP70 can enhance the protection of EtMIC2 against E. tenella infection. Acknowledgments This work was partially supported by the Joint Project of Natural Science Foundation of China and the Natural Science Foundation of Guangdong Province (No. U0831004). We also thank the technical staff of our laboratory for their assistance during this study. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.vetpar.2012.03.025. References Aosai, F., Chen, M., Kang, H.K., Mun, H.S., Norose, K., Piao, L.X., Kobayashi, M., Takeuchi, O., Akira, S., Yano, A., 2002. Toxoplasma gondii-derived heat shock protein HSP70 functions as a B cell mitogen. Cell Stress Chaperones 7, 357–364. Aosai, F., Rodriguez, P.M., Mun, H.S., Fang, H., Mitsunaga, T., Norose, K., Kang, H.K., Bae, Y.S., Yano, A., 2006. Toxoplasma gondii-derived heat shock protein 70 stimulates maturation of murine bone marrowderived dendritic cells via Toll-like receptor 4. Cell Stress Chaperones 11, 13–22. Asea, A., Kraeft, S.K., Kurt-Jones, E.A., Stevenson, M.A., Chen, L.B., Finberg, R.W., Koo, G.C., Calderwood, S.K., 2000. HSP70 stimulates cytokine production through a CD14-dependant pathway, demonstrating its dual role as a chaperone and cytokine. Nat. Med. 6, 435–442.

246

L. Zhang et al. / Veterinary Parasitology 188 (2012) 239–246

Broxmeyer, H.E., 1996. Is interleukin 17, an inducible cytokine that stimulates production of other cytokines, merely a redundant player in a sea of other biomolecules? J. Exp. Med. 183, 2411–2415. Bumstead, J., Tomley, F., 2000. Induction of secretion and surface capping of microneme proteins in Eimeria tenella. Mol. Biochem. Parasitol. 110, 311–321. Dalloul, R.A., Lillehoj, H.S., 2005. Recent advances in immunomodulation and vaccination strategies against coccidiosis. Avian Dis. 49, 1–8. Dalloul, R.A., Lillehoj, H.S., Klinman, D.M., Ding, X., Min, W., Heckert, R.A., Lillehoj, E.P., 2005. In ovo administration of CpG oligodeoxynucleotides and the recombinant microneme protein MIC2 protects against Eimeria infections. Vaccine 23, 3108–3113. de Miguel, N., Braun, N., Bepperling, A., Kriehuber, T., Kastenmuller, A., Buchner, J., Angel, S.O., Haslbeck, M., 2009. Structural and functional diversity in the family of small heat shock proteins from the parasite Toxoplasma gondii. Biochim. Biophys. Acta 1793, 1738–1748. Ding, X., Lillehoj, H.S., Dalloul, R.A., Min, W., Sato, T., Yasuda, A., Lillehoj, E.P., 2005. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 23, 3733–3740. Du, A., Wang, S., 2005. Efficacy of a DNA vaccine delivered in attenuated Salmonella typhimurium against Eimeria tenella infection in chickens. Int. J. Parasitol. 35, 777–785. Ferraz, J.C., Stavropoulos, E., Yang, M., Coade, S., Espitia, C., Lowrie, D.B., Colston, M.J., Tascon, R.E., 2004. A heterologous DNA bovis BCG boosting immunization priming-Mycobacterium strategy using mycobacterial Hsp70, Hsp65, and Apa antigens improves protection against tuberculosis in mice. Infect. Immun. 72, 6945–6950. Ferretti, S., Bonneau, O., Dubois, G.R., Jones, C.E., Trifilieff, A., 2003. IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger. J. Immunol. 170, 2106–2112. Gazzinelli, R.T., Denkers, E.Y., 2006. Protozoan encounters with Toll-like receptor signalling pathways: implications for host parasitism. Nat. Rev. Immunol. 6, 895–906. Hong, Y.H., Lillehoj, H.S., Lee, S.H., Dalloul, R.A., Lillehoj, E.P., 2006. Analysis of chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria tenella infections. Vet. Immunol. Immunopathol. 114, 209–223. Jang, S.I., Lillehoj, H.S., Lee, S.H., Lee, K.W., Lillehoj, E.P., Bertrand, F., Dupuis, L., Deville, S., 2011. Mucosal immunity against Eimeria acervulina infection in broiler chickens following oral immunization with profilin in Montanide adjuvants. Exp. Parasitol. 129, 36–41. Jang, S.I., Lillehoj, H.S., Lee, S.H., Lee, K.W., Park, M.S., Bauchan, G.R., Lillehoj, E.P., Bertrand, F., Dupuis, L., Deville, S., 2010. Immunoenhancing effects of Montanide ISA oil-based adjuvants on recombinant coccidia antigen vaccination against Eimeria acervulina infection. Vet. Parasitol. 172, 221–228. Johnson, J., Reid, W.M., 1970. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 28, 30–36. Kang, H.K., Lee, H.Y., Lee, Y.N., Jo, E.J., Kim, J.I., Aosai, F., Yano, A., Kwak, J.Y., Bae, Y.S., 2004. Toxoplasma gondii-derived heat shock protein 70 stimulates the maturation of human monocyte-derived dendritic cells. Biochem. Biophys. Res. Commun. 322, 899–904. Kikumura, A., Fang, H., Mun, H.S., Uemura, N., Makino, M., Sayama, Y., Norose, K., Aosai, F., 2010. Protective immunity against lethal anaphylactic reaction in Toxoplasma gondii-infected mice by DNA vaccination with T. gondii-derived heat shock protein 70 gene. Parasitol. Int. 59, 105–111. Kim, D.K., Lillehoj, H.S., Hong, Y.H., Park, D.W., Lamont, S.J., Han, J.Y., Lillehoj, E.P., 2008. Immune-related gene expression in two B-complex disparate genetically inbred Fayoumi chicken lines following Eimeria maxima infection. Poult. Sci. 87, 433–443. Korn, T., Bettelli, E., Oukka, M., Kuchroo, V.K., 2009. IL-17 and Th17 cells. Annu. Rev. Immunol. 27, 485–517. Lee, S.H., Lillehoj, H.S., Jang, S.I., Lee, K.W., Yancey, R.J., Dominowski, P., 2010. The effects of a novel adjuvant complex/Eimeria profilin vaccine on the intestinal host immune response against live E. acervulina challenge infection. Vaccine 28, 6498–6504. Lillehoj, H.S., Choi, K.D., Jenkins, M.C., Vakharia, V.N., Song, K.D., Han, J.Y., Lillehoj, E.P., 2000. A recombinant Eimeria protein inducing interferon-gamma production: comparison of different gene expression systems and immunization strategies for vaccination against coccidiosis. Avian Dis. 44, 379–389.

Lillehoj, H.S., Ding, X., Quiroz, M.A., Bevensee, E., Lillehoj, E.P., 2005. Resistance to intestinal coccidiosis following DNA immunization with the cloned 3-1E Eimeria gene plus IL-2, IL-15, and IFN-gamma. Avian Dis. 49, 112–117. Lillehoj, H.S., Lillehoj, E.P., 2000. Avian coccidiosis. A review of acquired intestinal immunity and vaccination strategies. Avian Dis. 44, 408–425. Lillehoj, H.S., Min, W., Dalloul, R.A., 2004. Recent progress on the cytokine regulation of intestinal immune responses to Eimeria. Poult. Sci. 83, 611–623. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Lockhart, E., Green, A.M., Flynn, J.L., 2006. IL-17 production is dominated by gammadelta T cells rather than CD4 T cells during Mycobacterium tuberculosis infection. J. Immunol. 177, 4662–4669. Makino, M., Uemura, N., Moroda, M., Kikumura, A., Piao, L.X., Mohamed, R.M., Aosai, F., 2011. Innate immunity in DNA vaccine with Toxoplasma gondii-heat shock protein 70 gene that induces DC activation and Th1 polarization. Vaccine 29, 1899–1905. Min, W., Lillehoj, H.S., 2002. Isolation and characterization of chicken interleukin-17 cDNA. J. Interferon. Cytokine Res. 22, 1123–1128. Min, W., Lillehoj, H.S., Burnside, J., Weining, K.C., Staeheli, P., Zhu, J.J., 2001. Adjuvant effects of IL-1beta, IL-2, IL-8, IL-15, IFN-alpha, IFNgamma TGF-beta4 and lymphotactin on DNA vaccination against Eimeria acervulina. Vaccine 20, 267–274. Mun, H.S., Aosai, F., Norose, K., Chen, M., Piao, L.X., Takeuchi, O., Akira, S., Ishikura, H., Yano, A., 2003. TLR2 as an essential molecule for protective immunity against Toxoplasma gondii infection. Int. Immunol. 15, 1081–1087. Mun, H.S., Aosai, F., Norose, K., Piao, L.X., Fang, H., Akira, S., Yano, A., 2005. Toll-like receptor 4 mediates tolerance in macrophages stimulated with Toxoplasma gondii-derived heat shock protein 70. Infect. Immun. 73, 4634–4642. Planelles, L., Thomas, M.C., Alonso, C., Lopez, M.C., 2001. DNA immunization with Trypanosoma cruzi HSP70 fused to the KMP11 protein elicits a cytotoxic and humoral immune response against the antigen and leads to protection. Infect. Immun. 69, 6558–6563. Qazi, K.R., Oehlmann, W., Singh, M., Lopez, M.C., Fernandez, C., 2007. Microbial heat shock protein 70 stimulatory properties have different TLR requirements. Vaccine 25, 1096–1103. Qazi, K.R., Wikman, M., Vasconcelos, N.M., Berzins, K., Stahl, S., Fernandez, C., 2005. Enhancement of DNA vaccine potency by linkage of Plasmodium falciparum malarial antigen gene fused with a fragment of HSP70 gene. Vaccine 23, 1114–1125. Rahman, Q.K., Berzins, K., Lopez, M.C., Fernandez, C., 2003. Breaking the non-responsiveness of C57BL/6 mice to the malarial antigen EB200—the role of carrier and adjuvant molecules. Scand. J. Immunol. 58, 395–403. Schnare, M., Barton, G.M., Holt, A.C., Takeda, K., Akira, S., Medzhitov, R., 2001. Toll-like receptors control activation of adaptive immune responses. Nat. Immunol. 2, 947–950. Segal, B.H., Wang, X.Y., Dennis, C.G., Youn, R., Repasky, E.A., Manjili, M.H., Subjeck, J.R., 2006. Heat shock proteins as vaccine adjuvants in infections and cancer. Drug Discov. Today 11, 534–540. Shirley, M.W., Ivens, A., Gruber, A., Madeira, A.M., Wan, K.L., Dear, P.H., Tomley, F.M., 2004. The Eimeria genome projects: a sequence of events. Trends Parasitol. 20, 199–201. Shirley, M.W., Smith, A.L., Blake, D.P., 2007. Challenges in the successful control of the avian coccidia. Vaccine 25, 5540–5547. Srivastava, P., 2002. Roles of heat-shock proteins in innate and adaptive immunity. Nat. Rev. Immunol. 2, 185–194. Subramanian, B.M., Sriraman, R., Rao, N.H., Raghul, J., Thiagarajan, D., Srinivasan, V.A., 2008. Cloning, expression and evaluation of the efficacy of a recombinant Eimeria tenella sporozoite antigen in birds. Vaccine 26, 3489–3496. Tomley, F.M., Bumstead, J.M., Billington, K.J., Dunn, P.P., 1996. Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol. Biochem. Parasitol. 79, 195–206. Williams, R.B., 2002. Anticoccidial vaccines for broiler chickens: pathways to success. Avian Pathol. 31, 317–353. Williams, R.B., Catchpole, J., 2000. A new protocol for a challenge test to assess the efficacy of live anticoccidial vaccines for chickens. Vaccine 18, 1178–1185. Xu, S.Z., Chen, T., Wang, M., 2006. Protective immunity enhanced by chimeric DNA prime-protein booster strategy against Eimeria tenella challenge. Avian Dis. 50, 579–585.