- Email: [email protected]
In vivo immunoprotective comparison between recombinant protein and DNA vaccine of Eimeria tenella surface antigen 4
Veterinary Parasitology 278 (2020) 109032
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
In vivo immunoprotective comparison between recombinant protein and DNA vaccine of Eimeria tenella surface antigen 4
T
Pengfei Zhaoa, Yuncan Lib, Yanqin Zhoua, Junlong Zhaoa, Rui Fanga,* a b
State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China College of Animal Science and Technology, Tibet Agriculture & Animal Husbandry Univerity, Nyingchi, 860000, Tibet, People’s Republic of China
A R T I C LE I N FO
A B S T R A C T
Keywords: E. tenella Recombinant EtSAG4 protein pEGFP-N1-EtSAG4 plasmid Immunoprotective
Eimeria tenella, belonging to protozoon, is the causative agent of cecal coccidiosis in chicken and causes enormous impacts for poultry industry. The surface antigens of apicomplexan parasites function as attachment and invasion in host-parasite interaction. Meanwhile, host immune response is triggered as a result of parasitic invasion. Immunogenicity and potency as a vaccinal candidate antigen of E. tenella surface antigen 4 (EtSAG4) have been unknown. Therefore, a gene segment of E. tenella EtSAG4 was amplified and transplanted to pET28a prokaryotic vector for recombinant protein expression. Similarly, pEGFP-N1 eukaryotic vectors with EtSAG4 gene segment (pEGFP-N1-EtSAG4) amplified in 293 T cells as DNA vaccines. Reverse transcription-polymerase chain reaction (RT-PCR) assay and western blot analysis were used to demonstrate successful expressions of EtSAG4 in Escherichia coli or 293 T cells. Subsequently, animal experiments (72 cobb broilers) were performed to evaluate immunoprotective between recombinant protein and DNA vaccine of E. tenella EtSAG4 using different immunizing doses (50 or 100 μg), respectively. Serum from chickens infected with E. tenella identified recombinant EtSAG4 (rEtSAG4) protein. Chickens vaccinated with either rEtSAG4 protein or pEGFP-N1-EtSAG4 plasmids both shown a significant increase in concentration of IFN-γ (p < 0.05) compared with control groups indicating production of cell-mediated immunity. Besides, pEGFP-N1-EtSAG4 plasmids motivated more intense immune responses for immunoglobulin Y (IgY) and interleukin 17 (IL-17) (p < 0.05) contrast to control groups. However, there was no increase in concentration of interleukin 10 (IL-10) and interleukin 4 (IL-4) for both rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmids. Chickens vaccinated with rEtSAG4 protein or pEGFP-N1EtSAG4 plasmids both show higher weight, lower oocyst output and mean lesion scores compared with infection control groups. The highest anticoccidial index (ACI) value of immunized groups was 168.24 from EGFP-N1EtSAG4 plasmids (100 μg) group. Generally, EGFP-N1-EtSAG4 plasmids as DNA vaccines provided a more effective immunoprotective for chickens against E. tenalla than that of rEtSAG4 protein as subunit vaccines. EtSAG4 is a promising candidate antigen gene for development of coccidiosis vaccine.
1. Introduction Coccidiosis is a protozoal intestinal disease in chicken caused by Eimeria spp. E. tenella, the causative agent of cecal coccidiosis, is considered the most virulent among Eimeria spp and resulted in devasting losses in poultry industry (Blake et al., 2015; Blake and Tomley, 2013). The main pathological alterations of coccidiosis contain cecal damage, low feed conversion ratios and high mortality (Bussière et al., 2018; Clark et al., 2016). Anticoccidial drug was used to control Eimeria infection predominantly. However, misuse of anticoccidials resulted in the emergence of drug resistance among Eimeria spp (Chapman, 1975; Shirley et al., 2007). Vaccination against Eimeria spp is considered an
important prophylaxis approach in controlling coccidiosis (Shirley et al., 2005). Although live oocyst vaccines had been used commercially in some regions, high cost of vaccine production and virulence variation had been main barriers for large-scale use of live vaccines (Chapman and Jeffers, 2014). Recently, many researchers paid attention to recombinant protein subunit vaccine and DNA vaccine as novel strategies for coccidiosis. Microneme 5 gene of E. acervulina is cloned into pET32a vector to express recombinant proteins, which protects chickens against E. acervulina homologous challenge (Zhang et al., 2014). 80 %–100 % animals immunized with p1tpA-SAG1 plasmid survive from infection of Toxoplasma gondii RH strain (Nielsen et al., 2000). Microneme recombinant gene (MIC2) DNA of E. tenella was inoculated in ovo
⁎
Corresponding author. E-mail addresses: [email protected] (P. Zhao), [email protected] (Y. Li), [email protected] (Y. Zhou), [email protected] (J. Zhao), [email protected] (R. Fang). https://doi.org/10.1016/j.vetpar.2020.109032 Received 13 October 2019; Received in revised form 14 January 2020; Accepted 16 January 2020 0304-4017/ © 2020 Published by Elsevier B.V.
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
competent cells to induce expression of rEtSAG4 protein. 1.0 mM isopropyl β-D-thiogalactoside (IPTG, BS044B, Biosharp, Hefei, China) was added into DE3 cells at log-phase cultures (OD600 of 0.5). Bacterial cells were collected by centrifugation at 8000 rpm for 10 min after cultivating for 10 h. Soluble portion and insoluble portion were suspended with buffer A (Tris-HCl 50 mmol/L, EDTA 0.5 mmol/L, NaCl 50 mmol/ L, 5 % glycerol, and DTT 0.5 mmol/L), and fragmented by ultrasonic crusher. Degeneration and renaturation of rEtSAG4 protein from insoluble portion were performed by adding oxidative (50 mmol/L) and reductive glutathione (100 mmol/L). Dialysis buffer (Tris-HCl 50 mmol/L, EDTA 0.5 mmol/L, NaCl 50 mmol/L, 5 % glycerol) and sucrose were utilized to purify proteins. Protein purity and concentration were assayed by 12 % (w/v) sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and BCA protein assay Kit (P0012, Biyuntian, Shanghai, China), respectively. Purified protein was stored at −80 °C until use.
stimulating protective immunity and resisting infection of E. tenella and E. acervuline simultaneously (Ding et al., 2005). Recombinant subunit vaccine and DAN vaccine are promising for development of coccidiosis vaccine. Surface antigens of apicomplexan parasites play an essential role in host-parasite interaction involving attachment and invasion. Furthermore, homologous surface antigens gene of E. tenella with glycosylphosphatidylinositol (GPI) anchoring to cell membranes were classified as multi-gene families A and B based on six conserved cysteines (Lekutis et al., 2001; Ramly et al., 2013; Tabarés et al., 2004). Meanwhile, immunodominance of E. tenella surface antigens has been identified (Jahn et al., 2009). EtSAG4 gene belonging to multi-gene family A (containing EtSAG1-12), expressed in the second-generation merozoites stage of E. tenella specifically (Tabarés et al., 2004). Cellmediated immunity is considered as predominant sponsors against coccidiosis with Th1 cell responses mediated by cytokines (Lillehoj, 1987). Interferon-γ (IFN-γ) correlated with CD4+ cells had been demonstrated primary cytokines to survive mice from E. falciformis, and inhibit replication of Toxoplasma gondii in vivo and E. tenella in embryo fibroblast (Dimier and Bout, 1997; Dimier et al., 1998; Ovington et al., 1995). However, potency and immunogenicity of E. tenella EtSAG4 as recombinant subunit vaccine and DNA vaccine keep unknown in vivo until now. Therefore, EtSAG4 gene of E. tenella had been translated into the prokaryotic expression vector to express rEtSAG4 protein. Moreover, pEGFP-N1-EtSAG4 plasmid was successfully constructed as a DNA vaccine. Subsequently, animal experiments were used to evaluate immunoprotective activity of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmids in vivo using different immunizing doses (50 or 100 μg).
2.4. Preparation of anti-rEtSAG4 serum and verification of rEtSAG4 recombinant protein Twenty cobb broiler chickens (14 days of age) were purchased from ZhengKang livestock and poultry Co., Ltd (Jingzhou, China), reared under the same condition described in 2.1 and divided to two groups averagely. Chickens of experimental groups were infected with E. tenella sporulated oocysts (5.0 × 104). Blood was collected from wings and stored at 4℃ overnight 15 days later (Hoan et al., 2016), centrifuged by 4500 rpm for 3 min and stored at -20℃ until use. Western blots were performed to verify expression of rEtSAG4 protein. Briefly, a wet transfer method was used to move SDS-PAGE to Polyvinylidene Fluoride (PVDF) membranes (Merck, Millipore Ltd., Tullagreen, Carrigtwohill, Co. Cork, IRL) after separated. Western blots were performed according to standard method described as follow (Towbin et al., 1979): (i) PVDF membranes were blocked by 1 % (w/v) albumin from bovine serum in Tween 20 (TBST) and Tris-buffered saline at 4 °C; (ii) Two hours later, the membranes were washed by TBST three times, then incubated with Anti-E. tenella polyclonal antibody serum (dilutions 1:300), noninfectious Eimeria serum (dilutions 1:300) and His-tag monoclonal antibody (dilutions 1:2000) (Biyuntian Co., LTD Shanghai, China) as primary antibody at 4℃ overnight, respectively; (iii) following day, primary antibody was removed and TBST was added to wash five times. Also, membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-chicken IgG (dilutions 1:2000) (Biosynthesis Co., LTD, Beijing, China) or goat anti-mouse IgG (dilutions 1:2000) (Biyuntian Co., LTD Shanghai, China) as secondary antibody at 37 °C, respectively; (iv) After incubating two hours, secondary antibody was discarded and adding TBST to rewash five times. Finally, the membranes were examined antibody band by Electro-Chemi-Luminescence (ECL) kit (Juneng, Wuhan, China), according to the manufacturer’s instructions.
2. Materials and methods 2.1. Animals and parasite material One-day-old cobb broilers (numbers = 72) were purchased from ZhengKang livestock and poultry Co., Ltd (Jingzhou, China). Chickens were reared under coccidian-free conditions and fed with food and water ad libitum. E. tenella oocysts were propagated with SPF chickens and preserved with 2.5 % potassium dichromate at 4℃ in the parasite laboratory of Huazhong Agricultural University, referring to standard procedures (Smith and Ruff, 1975). Animal experiments were all implemented following the instruction of Huazhong Agricultural University ethical committee and Hubei province laboratory animal center and the regulations on care and use of laboratory animals in China. 2.2. Cloning EtSAG4 gene and constructing plasmids RNA was extracted from E. tenella sporozoites (5.0 × 104) using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) by manufacturer’s instructions. Complementary DNA (cDNA) was obtained by RT-PCR using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Normal PCR was used to amplify complete sequences of E. tenella EtSAG4 from cDNA. Then, truncated EtSAG4 gene without C-terminal hydrophobic GPI signal-anchor peptide and Nterminal hydrophobic signal peptide was obtained according to similar methods. Next, EtSAG4 gene was inserted into the pET28a vector and reproduced in DH5α competent cells. Simultaneously, EtSAG4 gene was also cloned into the pEGFP-N1 vector to construct pEGFP-N1-EtSAG4 plasmid. Electrophoretic separation of all PCR products was performed on 1 % agarose gels and sequenced by Tianyi Huiyuan Biotechnology Co., Ltd (Wuhan, China). Primers used for PCR or RT-PCR reaction were listed in Table 1.
2.5. Transfecting pEGFP-N1-EtSAG4 plasmid into 293 T cells Transfection of pEGFP-N1-EtSAG4 plasmid into 293 T cells was performed according to standard method (Liu et al., 2013). Briefly, DNA plasmids (1 μg) and lipofectamine 2000 (2 μl) (Thermo Fisher Scientific, Waltham, MA, USA) were diluted into 50 μl serum-free and antibiotic-free medium (Thermo Fisher Scientific, Waltham, MA, USA) at room temperature for 5 min, separately. Subsequently, medium of 293 T cells was discarded and 293 T cells were washed two times with 200 μl serum-free and antibiotic-free medium. Meanwhile, diluted plasmid and lipofectamine were mixed at room temperature for 20 min. 100 μl mixture and 500 μl medium (free serum and antibiotic) were added into 293 T cells to culture at 37 °C with 5 % CO2. Removing medium from 293 T cells six hours later. Then, 293 T cells were cultured in 1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) containing 10 % fetal bovine serum (Thermo Fisher Scientific,
2.3. Expression and purification of rEtSAG4 protein The pET28a-EtSAG4 plasmids extracted from DH5α were transformed into Transetta (DE3) (Quanshijin, Beijing, China) chemical 2
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Table 1 Primers of PCR amplification. Primer name a
EtSAG4F-1 EtSAG4R-1 EtSAG4F-2b EtSAG4R-2 EtSAG4-pET28aFc EtSAG4-pET28aR EtSAG4-pEGFP-N1Fd EtSAG4-pEGFP-N1R
Primer sequence 5′→3′ ATGGCTCGCGTCGCTTTCTT CTAGAAAAGAGCGAAAACGG CAACAAGCTGCTACTCCAGA AGGGCCCACTGGGGAAACTT TGACTGGTGGACAGCAAATGCAACAAGCTGCTACTCCAGA TTGTTAGCAGCCGGATCTCATCAAGGGCCCACTGGGGAAACTT CGGACTCAGATCTCGAGCTCATGCAACAAGCTGCTACTCC ATGGTGGCGACCGGTGGATCAGGGCCCACTGGGGAAACTT
Note：a, primers for complete EtSAG4 gene; b, primers for truncated EtSAG4 gene; c, primers for prokaryotic expression; d, primers for eukaryotic expression; Table 2 Immunization procedure of animal challenge. Groups
Primary immunizationa
Second immunizationb
Dose
Challengec
G1 G2 G3 G4 G5 G6 G7 G8 G9
recombinant EtSAG4 protein recombinant EtSAG4 protein PBS PBS pEGFP-N1-EtSAG4 plasmid pEGFP-N1-EtSAG4 plasmid empty pEGFP-N1 plasmid endotoxin-free elution buffer endotoxin-free elution buffer
recombinant EtSAG4 protein recombinant EtSAG4 protein PBS PBS pEGFP-N1-EtSAG4 plasmid pEGFP-N1-EtSAG4 plasmid empty pEGFP-N1 plasmid endotoxin-free elution buffer endotoxin-free elution buffer
50 μg 100 μg / / 50 μg 100 μg 100 μg / /
E. E. E. / E. E. E. E. /
tenella sporulated oocysts (5 × 104) tenella sporulated oocysts (5 × 104) tenella sporulated oocysts (5 × 104) tenella tenella tenella tenella
sporulated sporulated sporulated sporulated
oocysts oocysts oocysts oocysts
(5 (5 (5 (5
× × × ×
104) 104) 104) 104)
Note：a, Primary immunization was performed at 14 days of cobb broiler. b, A booster immunization was done at seven dpi. c, E. tenella sporulated oocysts (5.0 × 104) were inoculated at 14 dpi.
Fig. 1. 1 % agarose gel electrophoresis of EtSAG4 gene PCR product. A: EtSAG4 complete gene; B: EtSAG4 gene from pET28a vector; C: EtSAG4 gene from pEGFP-N1-SAG4 plasmid; Lane M, Trans2K PlusⅡ DNA Marker; Lane 1, EtSAG4 gene; Lane 2, negative control.
Waltham, MA, USA) for 24 h, and were observed under a fluorescence microscope (Olympus, Japan).
mouse monoclonal antibody (dilutions 1:2000) (Proteintech Group, Inc, Chicago, USA) as primary antibody and horseradish peroxidase (HRP)conjugated goat anti-mouse IgG (dilutions 1:2000) (Biyuntian Co., LTD Shanghai, China) as second antibody. Bound antibody was detected by the ECL kit (Juneng, Wuhan, China).
2.6. Detecting expression of pEGFP-N1-EtSAG4 plasmid in 293 T cells by RT-PCR and western blot
2.7. Animal experiment
After pEGFP-N1-EtSAG4 plasmids replicated in 293 T cells for 24 h, intact RNA was extracted from transfected 293 T cells and RT-PCR was performed according to method mentioned in 2.2. Besides, western blot was carried out as described previously in 2.4 with minor adjustments. Briefly, cell lysis buffer (P0013, Biyuntian, Shanghai, China) was added into transfected 293 T cells to extract proteins. SDS-PAGE was used to separate proteins. Obtained proteins were transferred to PVDF membranes subsequently. PVDF membranes were incubated with GFP tag
Seventy-two cobb broiler 14 days of age were weighed and divided into nine groups randomly as listed in Table 2. Chickens of G1-G4 groups were used to evaluate immunoprotective of rEtSAG4 protein while G5-G9 groups were for pEGFP-N1-EtSAG4 plasmid. Chickens were immunised with rEtSAG4 protein or pEGFP-N1-EtSAG4 plasmid by chest intramuscular injection with different doses (50 and 100 μg). 3
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Fig. 2. A: SDS-PAGE of purified rEtSAG4 protein. Lane 1, purified rEtSAG4 protein; B: Western blot of rEtSAG4 protein; Lane M, standard protein molecular weight marker. Lane 1, rEtSAG4 protein probed by His-tag as primary antibody; Lane 2, rEtSAG4 protein probed by serum from chickens experimentally infected with E. tenella as primary antibody; Lane 3, rEtSAG4 protein probed by serum of uninfected chickens as primary antibody.
Fig. 3. A: EtSAG4 gene expression in 293 T cells under fluorescence microscopy. a, cells with pEGFP-N1 plasmid; b, normal 293 T cells; c, 293 T cells with pEGFP-N1-SAG4 plasmid; B: RT-PCR assay of EtSAG4 gene expression in 293 T cells. Lane M, Trans2KⅡ DNA Marker; Lane 1: pEGFP-N1-EtSAG4 plasmid; Lane 2, empty pEGFP-N1 plasmid; Lane 3, negative control; C: Western blot analysis of EtSAG4 gene expression in 293 T cells. Lane M, standard protein molecular weight marker; Lane 1, 293 T cells transfected with pEGFP-N1-EtSAG4 plasmid; Lane 2. 293 T cells transfected with pEGFP-N1 plasmid；Lane 3, negative control.
2.8. Concentration of cytokines and serum antibody
Phosphate buffer saline (PBS) and endotoxin-free elution buffer (D6950, OMEGA, USA) for control groups (G3, G4, G8 and G9 groups) were inoculated according to the same method. Also, chickens of G7 group were immunized with empty pEGFP-N1 plasmids as plasmid control group. A booster immunisation was given at seven days post injection (7 dpi). All chickens except uninfected control groups (G4 and G9 groups) were challenged with E. tenella sporulated oocysts (5.0 × 104) by orally at 14 dpi.
Concentration of interleukin-17 (IL-17), interleukin-10 (IL-10), interleukin-4 (IL-4), interferon-γ (IFN-γ), and IgY antibody level in serum were detected by utilizing an indirect enzyme-linked immunosorbent assay (ELISA) commercial kits named "chick cytokine ELISA Quantitation Kits" (catalog numbers: CSB-E04607Ch, CSB-E12835C, CSB-E06756Ch, CSB-E08550Ch, and CSB-E11635Ch for IL-17, IL-10, IL4, IFN-γ, and IgY respectively; CUSABIO, Wuhan, China), according to manufacturer’s instructions. 4
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Fig. 4. The concentration of cytokines and IgY antibody level in chickens immunized rEtSAG4 protein. G3 and G4 groups were immunized with PBS intramuscularly. G1 and G2 groups were immunised intramuscularly with 50 μg or 100 μg rEtSAG4 protein, respectively. A booster immunisation was given at seven dpi according to the same method. Serum was collected from the wing to detect concentration of cytokines and IgY antibody level by ELISA at 14 dpi. A: IFN-γ concentration; B: IgY concentration; C: IL-4 concentration; D: IL-10 concentration; E: IL-17 concentration.
software (SPSS for windows 25.0, SPSS Inc., Chicago, USA) and Graphpad Prism 8.0 (software Inc., La Jolla, CA, USA) were used to analyze data with one-way ANOVA and Duncan’s multiple ranges (p < 0.05 was considered significantly different among groups).
2.9. Immunoprotective parameters in vivo In vivo immunoprotective parameters of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid were clinical (weight, survival rate and mortality), pathological (cecum lesion score) and parasitological (ACI and oocyst output) (Morehouse and Baron, 1970). Weight gain and survival rate were calculated directly. Cecum lesion score is a continuous number from 0 (none) to 4 (severe) representing different levels of cecum lesion, according to Johnson and Reid (Johnson and Reid, 1970), which is evaluated by three independent observers. Furthermore, cecal content was collected to calculate oocysts per gram (OPG) using McMaster’s counting technique (Long et al., 1976). ACI as a synthetic criterion, which responded to holistic health conditions of chickens represents various degrees of vaccine protection: ACI > 180 is good protection, 160 < ACI < 179 is moderate protection, 120 < ACI < 159 is limited protection, ACI < 120 was no protection (Chapman, 1998).
3. Results 3.1. Gene clone and plasmid construction EtSAG4 fragment was successfully amplificated from cDNA by PCR method (Fig. 1A). Partial sequence of EtSAG4 was obtained using primers shown in Table 1 (EtSAG4F-2 and EtSAG4R-2 primers), cloned into pET-28a or pEGFP-N1 vector (Fig. 1B and C), and was identical to E. tenella Houghton strain (AJ586535.1) through sequence analysis. 3.2. Expression and purification of rEtSAG4 protein rEtSAG4 protein was detected by SDS-PAGE and purified using sucrose concentration and glutathione renaturation in sediment. Molecular mass of rEtSAG4 protein was about 29 kDa (containing Histag) (Fig. 2A). Western blot experiment demonstrated successful expression of rEtSAG4 protein using anti-His-tag antibody and serum from chickens infected with E. tenella, respectively. Besides, there was no
2.10. Sequence and statistical analysis Online software SignalIP (http://www.cbs.dtu.dk/services/SignalP/ ) and big-PI predictor (http://mendel.imp.ac.at/gpi/gpi_server.html) were used to predict sequences of truncated EtSAG4. SPSS statistical 5
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Fig. 5. The concentration of cytokines and IgY antibody level in chickens immunized pEGFPN1-EtSAG4 plasmid. G8 and G9 groups were immunised intramuscularly with endotoxinfree elution buffer. Similarly, G7 group was immunized with empty pEGFP-N1 plasmid. G5 and G6 groups were immunized with 50 μg or 100 μg pEGFP-N1-EtSAG4 plasmid, respectively. A booster immunisation was given at seven dpi according to the same method. Serum was collected from the wing to detect concentration of cytokines and IgY antibody level by ELISA at 14 dpi. A: IFN-γ concentration; B: IgY concentration; C: IL-4 concentration; D: IL-10 concentration; E: IL-17 concentration.
Table 3 Effects of recombinant EtSAG4 protein against E. tenella challenge. Groups
Average body weight gains (g)
Relative body weight gain (%)
Oocyst output (105)
NC EtSAG4 PC EtSAG4 G1 G2
202.63 ± 43.60a 96.38 ± 33.29b 182.75 ± 29.54a 181.50 ± 21.29a
100.00 47.56 90.19 89.57
0f 1.47 ± 0.021c 0.9 ± 0.057d 0.36 ± 0.042e
Mean lesion scores 0i 3.55 ± 0.25g 1.93 ± 0.19h 1.88 ± 0.22h
Anti-coccidial index 200.00 72.06 155.89 163.77
Note: The diverse alphabetic symbol represented that mean was significantly different (p < 0.05) between two groups. NC: negative control; PC: positive control. Table 4 Effects of pEGFP-N1-EtSAG4 against E. tenella challenge. Groups NC pEGFP-N1-EtSAG4 PC pEGFP-N1-EtSAG4 G5 G6 G7
Average body weight gains (g) a
132.50 ± 23.18 71.00 ± 48.35b 135.50 ± 42.63 a 129.50 ± 21.97a 106.25 ± 28.90c
Relative body weight gain (%)
Oocyst output (105) h
100.00 53.58 102.26 97.74 80.19
0 1.79 ± 0.035d 1.12 ± 0.180 f 0.75 ± 0.035g 1.65 ± 0.050e
Mean lesion scores l
0 3.47 ± 0.19i 1.86 ± 0.14j 1.35 ± 0.29k 3.55 ± 0.14i
Anti-coccidial index 200.00 78.88 156.66 168.24 109.79
Note: The diverse alphabetic symbol represented that mean was significantly different (p < 0.05) between two groups. NC: negative control; PC: positive control.
plasmids showed green fluorescence under a fluorescence microscope on account of GFT tag. Meanwhile, there was no fluorescence in normal 293 T cells (Fig. 3A). RT-PCR showed that 293 T cells transfected with pEGFP-N1-EtSAG4 plasmid produced a band at 688 bp (containing homologous arm), which was absent in cells transfected with pEGFP-N1
reaction between rEtSAG4 protein and negative serum (Fig. 2B). 3.3. Expression of pEGFP-N1-EtSAG4 plasmids in 293 T cells 293 T cells transfected with empty pEGFP-N1 or pEGFP-N1-EtSAG4 6
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
All chickens survived from animal experiments. Average body weight gains of chickens immunised rEtSAG4 protein and pEGFP-N1EtSAG4 plasmid were both significantly higher than infection control groups (G3 and G8 groups). Likewise, chickens vaccinated with either rEtSAG4 protein or pEGFP-N1-EtSAG4 plasmid showed reduced oocyst output and lower lesion scores compared with positive control groups (G3 and G8 groups). ACI value of low dose groups (50 μg) of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid were more than 155, and high dose groups (100 μg) were more than 160 (Tables 3 and 4).
indicated differences of rEtSAG4 protein inducing immune response between in vivo and in vitro. However, antibody level of IgY was only increased in chickens immunised pEGFP-N1-EtSAG4 plasmid. There is no correlation between antibody titers of serum and immunoprotective against coccidiosis and humoral immunity is usually with a minor role in process of parasites infection (Lee et al., 2009; Wallach et al., 1992). In addition, empty pEGFP-N1 plasmids yet stimulated IgY antibody response indicating induction of non-specific humoral immunity. IL-17 cytokines were produced from Th17 cells involving elimination of pathogens (Korn et al., 2009). The pEGFP-N1-EtSAG4 plasmid with high IL-17 output might stimulate stronger immunity than rEtSAG4 protein. Proteins produced from DNA vaccine is more similar to natural protein conformation compared with recombinant protein expressed in exogenous vector (Zhao et al., 2013). Animal experiments showed that both rEtSAG4 protein and pEGFPN1-EtSAG4 plasmid could cause increased average body weight gain, decreased oocyst output, and lower mean lesion scores compared with infection control. The ACI value of rEtSAG4 protein 100 μg (G2 group) or pEGFP-N1-EtSAG4 plasmid 100 μg (G6 group) reached more than 160. In conclusion, we successfully obtained rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid according to truncated EtSAG4 gene without C-terminal hydrophobic GPI signal-anchor peptide and Nterminal hydrophobic signal peptide. Increased IFN-γ concentration occurred in both rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid declaring induction of cell-mediated immunity. Besides, pEGFP-N1EtSAG4 plasmid with increased concentration of IgY and IL-17 behaved better in immunity response than rEtSAG4 protein. Animal challenge experiment showed that rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid could protect chickens against E. tenella challenge. EtSAG4 might be a competent vaccine candidate gene against E. tenella.
4. Discussion
Declaration of Competing Interest
Eimeria tenella invaded intestinal epithelial cells of chickens and cause damaged intestinal hemorrhage, which is enormous economic losses for poultry industry (Wiedmer et al., 2017). Apicomplexa parasites secrete surface antigens with GPI-anchored during adhesion and invasion. At present, more than 20 Eimeria GPI-anchored surface antigens had been studied (Reid et al., 2014). Many antigen genes of Eimeria spp were used as candidates of subunit vaccine or DNA vaccine, such as MZ5-7 gene of E. tenella and cSZ-2 gene of E. acervulina (Geriletu et al., 2011; Hoan et al., 2015). Moreover, EtSAG4 gene of E. tenella had been found to induce inflammatory responses in avian macrophages (Yock-Ping et al., 2011). Therefore, we expressed EtSAG4 gene of E. tenella to obtain rEtSAG4 protein as subunit vaccine and constructed pEGFP-N1-EtSAG4 plasmid as DNA vaccine in this research. Subsequently, immunoprotective of recombinant protein and DNA vaccine of E. tenella surface antigen 4 were evaluated through animal challenge in vivo. Western blot and RT-PCR demonstrated successful acquisition of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid. rEtSAG4 protein was identified by chickens serum infected with E. tenella through western blot experiments according to similar methods described by Zhang et al. (2015). Cell-mediated immunity played an essential role in immune response of anticoccidial that was regulated by IFN-γ cytokines (Debock and Flamand, 2014; Rothwell et al., 2000). In this study, we found that both rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid enhanced release of IFN-γ, which indicated that EtSAG4 stimulated Th1 cell’s immune response. The chickens immunised with rEtSAG4 protein and pEGFPN1-EtSAG4 plasmid showed no rise in concentration of IL-4 and IL-10 that were known as Th2-type cytokine correlated with humoral immunity function (Yun et al., 2000). However, Yock-Ping et al. reported that recombinant SAG4 protein cause decreased expression of IL-12 and IFN-γ, and increased expression of IL-10 in chickens macrophage (YockPing et al., 2011). The diverse concentration variation of cytokines
There were no known competing financial interests or personal relationships to influence the work reported in this paper.
plasmid and normal cells (Fig. 3B). Western blotting analysis exhibited that cells transfected pEGFP-N1-EtSAG4 plasmid exposed a band of about 53 kDa (containing GFP tag). Cells transfected pEGFP-N1 plasmid generated a band of about 27 kDa (GFP tag) without specific bands in normal 293 T cells (Fig. 3C). RT-PCR and western blot both demonstrated that pEGFP-N1-EtSAG4 plasmid expressed in 293 T cells successfully. 3.4. Cytokine concentration and serum antibody level IFN-γ concentration of serum from chickens immunised with rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid was significantly higher compared with control groups (p < 0.05) (Figs. 4A and 5A). Similarly, increased IgY antibody titer and IL-17 concentration only occurred in chickens immunised with the pEGFP-N1-EtSAG4 plasmid (p < 0.05) (Fig. 5B and E). However, both rEtSAG4 protein and pEGFPN1-EtSAG4 plasmid did not motivate production of IL-4 and IL-10 (Figs. 4 and 5). 3.5. Immunoprotective of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmids in vivo
Acknowledgments We would like to thank professor Shijun Li for providing space for animal experiments and guidance from professor Rui Fang, Junlong Zhao, Yanqin Zhou. This study was supported by the national key research and development program (2016YFD0501303) and the Fundamental Research Funds for the Central Universities (Grant No. 2662015PY048). References Blake, D.P., Tomley, F.M., 2013. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 30, 12–19. Blake, D.P., Clark, E.L., Macdonald, S.E., Thenmozhi, V., Tomley, F.M., 2015. Population, genetic, and antigenic diversity of the apicomplexan Eimeria tenella and their relevance to vaccine development. Proc. Natl. Acad. Sci. U. S. A. 112. Bussière, F.I., Niepceron, A., Sausset, A., Esnault, E., Silvestre, A., Walker, R.A., Smith, N.C., Quéré, P., Laurent, F., 2018. Establishment of an in vitro chicken epithelial cell line model to investigate Eimeria tenella gamete development. Parasit. Vectors 11, 44. Chapman, H.D., 1975. Eimeria tenella in chickens: development of resistance to quinolone anticoccidial drugs. Parasitology 71, 41–49. Chapman, H.D., 1998. Evaluation of the efficacy of anticoccidial drugs against Eimeria species in the fowl. Int. J. Parasitol. 28, 1141–1144. Chapman, H.D., Jeffers, T.K., 2014. Vaccination of chickens against coccidiosis ameliorates drug resistance in commercial poultry production. Int. J. Parasitol. Drugs Drug Resist. 4, 214–217. Clark, E.L., Macdonald, S.E., Thenmozhi, V., Kundu, K., Garg, R., Kumar, S., Ayoade, S., Fornace, K.M., Jatau, I.D., Moftah, A., 2016. Cryptic Eimeria genotypes are common across the southern but not northern hemisphere ⋆. Int. J. Parasitol. 46, 537–544. Debock, I., Flamand, V., 2014. Unbalanced neonatal CD4+ T-Cell immunity. Front. Immunol. 5. Dimier, I.H., Bout, D.T., 1997. Inhibition of Toxoplasma gondii replication in IFN-γ-activated human intestinal epithelial cells. Immunol. Cell Biol. 75, 511–514.
7
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Ramly, N.Z., Rouzheinikov, S.N., Sedelnikova, S.E., Baker, P.J., Chow, Y.P., Wan, K.L., Nathan, S., Rice, D.W., 2013. Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella. Acta Crystallogr. 69. Reid, A., Blake, D., Ansari, H., Billington, K., Browne, H., Bryant, J.M., Dunn, M., Hung, S., Kawahara, F., Miranda-Saavedra, D., Malas, T., Mourier, T., Naghra, H., Nair, M., Otto, T., Rawlings, N., Rivailler, P., Sanchez-Flores, A., Sanders, M., Pain, A., 2014. Genomic analysis of the causative agents of coccidiosis in domestic chickens. Genome Res. 24, 1676–1685. Rothwell, L., Muir, W., Kaiser, P., 2000. Interferon-?? is expressed in both gut and spleen during Eimeria tenella infection. Avian Pathol. 29, 333–342. Shirley, M.W., Smith, A.L., Tomley, F.M., 2005. The biology of avian eimeria with an emphasis on their control by vaccination. Adv. Parasitol. 60, 285–330. Shirley, M.W., Smith, A.L., Blake, D.P., 2007. Challenges in the successful control of the avian coccidia. Vaccine 25, 0–5547. Smith, R.R., Ruff, M.D., 1975. A rapid technique for the cleaning and concentration of eimeria oocysts. Poult. Sci. 54, 2081–2086. Tabarés, E., Ferguson, D., Clark, J., Soon, P.-E., Wan, K.-L., Tomley, F., 2004. Eimeria tenella sporozoites and merozoites differentially express glycosylphosphatidylinositol-anchored variant surface proteins. Mol. Biochem. Parasitol. 135, 123–132. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 102, 459–471. Wallach, M., Halabi, A., Pillemer, G., Sar-Shalom, O., Augustine, P.C., 1992. Maternal immunization with gametocyte antigens as a means of providing protective immunity against Eimeria maxima in chickens. Infect. Immun. 60, 2036–2039. Wiedmer, S., Erdbeer, A., Volke, B., Randel, S., Kapplusch, F., Hanig, S., Kurth, M., 2017. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa). Parasite 24. Yock-Ping, C., Kiew-Lian, W., P., B.D, Fiona, T., Sheila, N., Martins, B.E., 2011. Immunogenic eimeria tenella glycosylphosphatidylinositol-anchored surface antigens (SAGs) induce inflammatory responses in avian macrophages. PLoS One 6, e25233. Yun, C.H., Lillehoj, H.S., Lillehoj, E.P., 2000. Intestinal immune responses to coccidiosis. Dev. Comp. Immunol. 24, 0–324. Zhang, Z.C., JingWei, H., MengHui, L., YuXia, S., Shuai, W., LianRui, L., LiXin, X., RuoFeng, Y., XiaoKai, S., XiangRui, L., 2014. Identification and molecular characterization of microneme 5 of eimeria acervulina. PLoS One 9, e115411. Zhang, Z.C., Liu, L.R., Huang, J.W., Wang, S., Li, X.R., 2015. The molecular characterization and immune protection of microneme 2 of Eimeria acervulina. Vet. Parasitol. 215, 96–105. Zhao, G., Zhou, A., Lu, G., Meng, M., Sun, M., Bai…, Y., 2013. Identification and characterization ofToxoplasma gondiiaspartic protease 1 as a novel vaccine candidate against toxoplasmosis. Parasit. Vectors 6, 175.
Dimier, I.H., Quere, P., Naciri, M., Bout, D.T., 1998. Inhibition of Eimeria tenella development in vitro mediated by chicken macrophages and fibroblasts treated with chicken cell supernatants with IFN-g activity. Avian Dis. 42, 239. Ding, X., Lillehoj, H.S., Dalloul, R.A., Min, W., Sato, T., Yasuda, A., Lillehoj, E.P., 2005. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 23, 0–3740. Geriletu, Xu, L., Xurihua, Li, X., 2011. Vaccination of chickens with DNA vaccine expressing Eimeria tenella MZ5-7 against coccidiosis. Vet. Parasitol. 177, 6–12. Hoan, T.D., Thao, D.T., Gadahia, J.A., Song, X., Xu, L., Yan, R., XiangRui, L., 2015. Analysis of humoral immune response and cytokines in chickens vaccinated with Eimeria brunetti apical membrane antigen-1(EbAMA1) DNA vaccine. The 13th Symposium of Veterinary Parasitology Branch of Chinese Animal Husbandry and Veterinary Association. Hoan, T.D., Zhang, Z., Huang, J., Yan, R., Song, X., Xu, L., Li, X., 2016. Identification and immunogenicity of microneme protein 2 (EbMIC2) of Eimeria brunetti. Exp. Parasitol. 162, 7–17. Jahn, D., Matros, A., Bakulina, A.Y., Tiedemann, J., Schubert, U., Giersberg, M., Haehnel, S., Zoufal, K., Mock, H.-P., Kipriyanov, S.M., 2009. Model structure of the immunodominant surface antigen ofEimeria tenellaidentified as a target for sporozoiteneutralizing monoclonal antibody. Parasitol Res. 105, 655–668. Johnson, J., Reid, W.M., 1970. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 28 0-36. Korn, T., Bettelli, E., Oukka, M., Kuchroo, V.K., 2009. IL-17 and Th17 cells. Annu. Rev. Immunol. 8, 485–517. Lee, S.H., Lillehoj, H.S., Park, D.W., Jang, S.I., Lillehoj, E.P., 2009. Protective effect of hyperimmune egg yolk IgY antibodies against Eimeria tenella and Eimeria maxima infections. Vet. Parasitol. 163, 123–126. Lekutis, C., Ferguson, D.J.P., Grigg, M.E., Camps, M., Boothroyd, J.C., 2001. Surface antigens of Toxoplasma gondii: variations on a theme. Int. J. Parasitol. 31, 1285–1292. Lillehoj, H.S., 1987. Effects of immunosuppression on avian coccidiosis: cyclosporin A but not hormonal bursectomy abrogates host protective immunity. Infect. Immun. 55, 1616. Liu, Y., Zheng, J., Li, J., Gong, P., Zhang, X., 2013. Protective immunity induced by a DNA vaccine encodingEimeria tenellarhomboid against homologous challenge. Parasitol. Res. 112, 251–257. Long, P.L., Millard, B.J., Joyner, L.P., Norton, C.C., 1976. A guide to laboratory techniques used in the study and diagnosis of avian coccidia. Folia Vet. Lat. 6, 201–217. Morehouse, N.F., Baron, R.R., 1970. Coccidiosis: evaluation of coccidiostats by mortality, weight gains, and fecal scores. Exp. Parasitol. 28, 0–29. Nielsen, H.V., Lauemøller, S.L., Christiansen, L., Buus, S., Petersen, E., 2000. Complete protection against lethal toxoplasma gondii infection in mice immunized with a plasmid encoding the SAG1 gene. Infect. Immun. 67, 6358–6363. Ovington, K.S., Alleva, L.M., Kerr, E.A., 1995. Cytokines and immunological control of Eimeria spp. Int. J. Parasitol. 25, 1331–1351.
8
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
In vivo immunoprotective comparison between recombinant protein and DNA vaccine of Eimeria tenella surface antigen 4
T
Pengfei Zhaoa, Yuncan Lib, Yanqin Zhoua, Junlong Zhaoa, Rui Fanga,* a b
State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China College of Animal Science and Technology, Tibet Agriculture & Animal Husbandry Univerity, Nyingchi, 860000, Tibet, People’s Republic of China
A R T I C LE I N FO
A B S T R A C T
Keywords: E. tenella Recombinant EtSAG4 protein pEGFP-N1-EtSAG4 plasmid Immunoprotective
Eimeria tenella, belonging to protozoon, is the causative agent of cecal coccidiosis in chicken and causes enormous impacts for poultry industry. The surface antigens of apicomplexan parasites function as attachment and invasion in host-parasite interaction. Meanwhile, host immune response is triggered as a result of parasitic invasion. Immunogenicity and potency as a vaccinal candidate antigen of E. tenella surface antigen 4 (EtSAG4) have been unknown. Therefore, a gene segment of E. tenella EtSAG4 was amplified and transplanted to pET28a prokaryotic vector for recombinant protein expression. Similarly, pEGFP-N1 eukaryotic vectors with EtSAG4 gene segment (pEGFP-N1-EtSAG4) amplified in 293 T cells as DNA vaccines. Reverse transcription-polymerase chain reaction (RT-PCR) assay and western blot analysis were used to demonstrate successful expressions of EtSAG4 in Escherichia coli or 293 T cells. Subsequently, animal experiments (72 cobb broilers) were performed to evaluate immunoprotective between recombinant protein and DNA vaccine of E. tenella EtSAG4 using different immunizing doses (50 or 100 μg), respectively. Serum from chickens infected with E. tenella identified recombinant EtSAG4 (rEtSAG4) protein. Chickens vaccinated with either rEtSAG4 protein or pEGFP-N1-EtSAG4 plasmids both shown a significant increase in concentration of IFN-γ (p < 0.05) compared with control groups indicating production of cell-mediated immunity. Besides, pEGFP-N1-EtSAG4 plasmids motivated more intense immune responses for immunoglobulin Y (IgY) and interleukin 17 (IL-17) (p < 0.05) contrast to control groups. However, there was no increase in concentration of interleukin 10 (IL-10) and interleukin 4 (IL-4) for both rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmids. Chickens vaccinated with rEtSAG4 protein or pEGFP-N1EtSAG4 plasmids both show higher weight, lower oocyst output and mean lesion scores compared with infection control groups. The highest anticoccidial index (ACI) value of immunized groups was 168.24 from EGFP-N1EtSAG4 plasmids (100 μg) group. Generally, EGFP-N1-EtSAG4 plasmids as DNA vaccines provided a more effective immunoprotective for chickens against E. tenalla than that of rEtSAG4 protein as subunit vaccines. EtSAG4 is a promising candidate antigen gene for development of coccidiosis vaccine.
1. Introduction Coccidiosis is a protozoal intestinal disease in chicken caused by Eimeria spp. E. tenella, the causative agent of cecal coccidiosis, is considered the most virulent among Eimeria spp and resulted in devasting losses in poultry industry (Blake et al., 2015; Blake and Tomley, 2013). The main pathological alterations of coccidiosis contain cecal damage, low feed conversion ratios and high mortality (Bussière et al., 2018; Clark et al., 2016). Anticoccidial drug was used to control Eimeria infection predominantly. However, misuse of anticoccidials resulted in the emergence of drug resistance among Eimeria spp (Chapman, 1975; Shirley et al., 2007). Vaccination against Eimeria spp is considered an
important prophylaxis approach in controlling coccidiosis (Shirley et al., 2005). Although live oocyst vaccines had been used commercially in some regions, high cost of vaccine production and virulence variation had been main barriers for large-scale use of live vaccines (Chapman and Jeffers, 2014). Recently, many researchers paid attention to recombinant protein subunit vaccine and DNA vaccine as novel strategies for coccidiosis. Microneme 5 gene of E. acervulina is cloned into pET32a vector to express recombinant proteins, which protects chickens against E. acervulina homologous challenge (Zhang et al., 2014). 80 %–100 % animals immunized with p1tpA-SAG1 plasmid survive from infection of Toxoplasma gondii RH strain (Nielsen et al., 2000). Microneme recombinant gene (MIC2) DNA of E. tenella was inoculated in ovo
⁎
Corresponding author. E-mail addresses: [email protected] (P. Zhao), [email protected] (Y. Li), [email protected] (Y. Zhou), [email protected] (J. Zhao), [email protected] (R. Fang). https://doi.org/10.1016/j.vetpar.2020.109032 Received 13 October 2019; Received in revised form 14 January 2020; Accepted 16 January 2020 0304-4017/ © 2020 Published by Elsevier B.V.
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
competent cells to induce expression of rEtSAG4 protein. 1.0 mM isopropyl β-D-thiogalactoside (IPTG, BS044B, Biosharp, Hefei, China) was added into DE3 cells at log-phase cultures (OD600 of 0.5). Bacterial cells were collected by centrifugation at 8000 rpm for 10 min after cultivating for 10 h. Soluble portion and insoluble portion were suspended with buffer A (Tris-HCl 50 mmol/L, EDTA 0.5 mmol/L, NaCl 50 mmol/ L, 5 % glycerol, and DTT 0.5 mmol/L), and fragmented by ultrasonic crusher. Degeneration and renaturation of rEtSAG4 protein from insoluble portion were performed by adding oxidative (50 mmol/L) and reductive glutathione (100 mmol/L). Dialysis buffer (Tris-HCl 50 mmol/L, EDTA 0.5 mmol/L, NaCl 50 mmol/L, 5 % glycerol) and sucrose were utilized to purify proteins. Protein purity and concentration were assayed by 12 % (w/v) sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and BCA protein assay Kit (P0012, Biyuntian, Shanghai, China), respectively. Purified protein was stored at −80 °C until use.
stimulating protective immunity and resisting infection of E. tenella and E. acervuline simultaneously (Ding et al., 2005). Recombinant subunit vaccine and DAN vaccine are promising for development of coccidiosis vaccine. Surface antigens of apicomplexan parasites play an essential role in host-parasite interaction involving attachment and invasion. Furthermore, homologous surface antigens gene of E. tenella with glycosylphosphatidylinositol (GPI) anchoring to cell membranes were classified as multi-gene families A and B based on six conserved cysteines (Lekutis et al., 2001; Ramly et al., 2013; Tabarés et al., 2004). Meanwhile, immunodominance of E. tenella surface antigens has been identified (Jahn et al., 2009). EtSAG4 gene belonging to multi-gene family A (containing EtSAG1-12), expressed in the second-generation merozoites stage of E. tenella specifically (Tabarés et al., 2004). Cellmediated immunity is considered as predominant sponsors against coccidiosis with Th1 cell responses mediated by cytokines (Lillehoj, 1987). Interferon-γ (IFN-γ) correlated with CD4+ cells had been demonstrated primary cytokines to survive mice from E. falciformis, and inhibit replication of Toxoplasma gondii in vivo and E. tenella in embryo fibroblast (Dimier and Bout, 1997; Dimier et al., 1998; Ovington et al., 1995). However, potency and immunogenicity of E. tenella EtSAG4 as recombinant subunit vaccine and DNA vaccine keep unknown in vivo until now. Therefore, EtSAG4 gene of E. tenella had been translated into the prokaryotic expression vector to express rEtSAG4 protein. Moreover, pEGFP-N1-EtSAG4 plasmid was successfully constructed as a DNA vaccine. Subsequently, animal experiments were used to evaluate immunoprotective activity of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmids in vivo using different immunizing doses (50 or 100 μg).
2.4. Preparation of anti-rEtSAG4 serum and verification of rEtSAG4 recombinant protein Twenty cobb broiler chickens (14 days of age) were purchased from ZhengKang livestock and poultry Co., Ltd (Jingzhou, China), reared under the same condition described in 2.1 and divided to two groups averagely. Chickens of experimental groups were infected with E. tenella sporulated oocysts (5.0 × 104). Blood was collected from wings and stored at 4℃ overnight 15 days later (Hoan et al., 2016), centrifuged by 4500 rpm for 3 min and stored at -20℃ until use. Western blots were performed to verify expression of rEtSAG4 protein. Briefly, a wet transfer method was used to move SDS-PAGE to Polyvinylidene Fluoride (PVDF) membranes (Merck, Millipore Ltd., Tullagreen, Carrigtwohill, Co. Cork, IRL) after separated. Western blots were performed according to standard method described as follow (Towbin et al., 1979): (i) PVDF membranes were blocked by 1 % (w/v) albumin from bovine serum in Tween 20 (TBST) and Tris-buffered saline at 4 °C; (ii) Two hours later, the membranes were washed by TBST three times, then incubated with Anti-E. tenella polyclonal antibody serum (dilutions 1:300), noninfectious Eimeria serum (dilutions 1:300) and His-tag monoclonal antibody (dilutions 1:2000) (Biyuntian Co., LTD Shanghai, China) as primary antibody at 4℃ overnight, respectively; (iii) following day, primary antibody was removed and TBST was added to wash five times. Also, membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-chicken IgG (dilutions 1:2000) (Biosynthesis Co., LTD, Beijing, China) or goat anti-mouse IgG (dilutions 1:2000) (Biyuntian Co., LTD Shanghai, China) as secondary antibody at 37 °C, respectively; (iv) After incubating two hours, secondary antibody was discarded and adding TBST to rewash five times. Finally, the membranes were examined antibody band by Electro-Chemi-Luminescence (ECL) kit (Juneng, Wuhan, China), according to the manufacturer’s instructions.
2. Materials and methods 2.1. Animals and parasite material One-day-old cobb broilers (numbers = 72) were purchased from ZhengKang livestock and poultry Co., Ltd (Jingzhou, China). Chickens were reared under coccidian-free conditions and fed with food and water ad libitum. E. tenella oocysts were propagated with SPF chickens and preserved with 2.5 % potassium dichromate at 4℃ in the parasite laboratory of Huazhong Agricultural University, referring to standard procedures (Smith and Ruff, 1975). Animal experiments were all implemented following the instruction of Huazhong Agricultural University ethical committee and Hubei province laboratory animal center and the regulations on care and use of laboratory animals in China. 2.2. Cloning EtSAG4 gene and constructing plasmids RNA was extracted from E. tenella sporozoites (5.0 × 104) using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) by manufacturer’s instructions. Complementary DNA (cDNA) was obtained by RT-PCR using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Normal PCR was used to amplify complete sequences of E. tenella EtSAG4 from cDNA. Then, truncated EtSAG4 gene without C-terminal hydrophobic GPI signal-anchor peptide and Nterminal hydrophobic signal peptide was obtained according to similar methods. Next, EtSAG4 gene was inserted into the pET28a vector and reproduced in DH5α competent cells. Simultaneously, EtSAG4 gene was also cloned into the pEGFP-N1 vector to construct pEGFP-N1-EtSAG4 plasmid. Electrophoretic separation of all PCR products was performed on 1 % agarose gels and sequenced by Tianyi Huiyuan Biotechnology Co., Ltd (Wuhan, China). Primers used for PCR or RT-PCR reaction were listed in Table 1.
2.5. Transfecting pEGFP-N1-EtSAG4 plasmid into 293 T cells Transfection of pEGFP-N1-EtSAG4 plasmid into 293 T cells was performed according to standard method (Liu et al., 2013). Briefly, DNA plasmids (1 μg) and lipofectamine 2000 (2 μl) (Thermo Fisher Scientific, Waltham, MA, USA) were diluted into 50 μl serum-free and antibiotic-free medium (Thermo Fisher Scientific, Waltham, MA, USA) at room temperature for 5 min, separately. Subsequently, medium of 293 T cells was discarded and 293 T cells were washed two times with 200 μl serum-free and antibiotic-free medium. Meanwhile, diluted plasmid and lipofectamine were mixed at room temperature for 20 min. 100 μl mixture and 500 μl medium (free serum and antibiotic) were added into 293 T cells to culture at 37 °C with 5 % CO2. Removing medium from 293 T cells six hours later. Then, 293 T cells were cultured in 1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) containing 10 % fetal bovine serum (Thermo Fisher Scientific,
2.3. Expression and purification of rEtSAG4 protein The pET28a-EtSAG4 plasmids extracted from DH5α were transformed into Transetta (DE3) (Quanshijin, Beijing, China) chemical 2
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Table 1 Primers of PCR amplification. Primer name a
EtSAG4F-1 EtSAG4R-1 EtSAG4F-2b EtSAG4R-2 EtSAG4-pET28aFc EtSAG4-pET28aR EtSAG4-pEGFP-N1Fd EtSAG4-pEGFP-N1R
Primer sequence 5′→3′ ATGGCTCGCGTCGCTTTCTT CTAGAAAAGAGCGAAAACGG CAACAAGCTGCTACTCCAGA AGGGCCCACTGGGGAAACTT TGACTGGTGGACAGCAAATGCAACAAGCTGCTACTCCAGA TTGTTAGCAGCCGGATCTCATCAAGGGCCCACTGGGGAAACTT CGGACTCAGATCTCGAGCTCATGCAACAAGCTGCTACTCC ATGGTGGCGACCGGTGGATCAGGGCCCACTGGGGAAACTT
Note：a, primers for complete EtSAG4 gene; b, primers for truncated EtSAG4 gene; c, primers for prokaryotic expression; d, primers for eukaryotic expression; Table 2 Immunization procedure of animal challenge. Groups
Primary immunizationa
Second immunizationb
Dose
Challengec
G1 G2 G3 G4 G5 G6 G7 G8 G9
recombinant EtSAG4 protein recombinant EtSAG4 protein PBS PBS pEGFP-N1-EtSAG4 plasmid pEGFP-N1-EtSAG4 plasmid empty pEGFP-N1 plasmid endotoxin-free elution buffer endotoxin-free elution buffer
recombinant EtSAG4 protein recombinant EtSAG4 protein PBS PBS pEGFP-N1-EtSAG4 plasmid pEGFP-N1-EtSAG4 plasmid empty pEGFP-N1 plasmid endotoxin-free elution buffer endotoxin-free elution buffer
50 μg 100 μg / / 50 μg 100 μg 100 μg / /
E. E. E. / E. E. E. E. /
tenella sporulated oocysts (5 × 104) tenella sporulated oocysts (5 × 104) tenella sporulated oocysts (5 × 104) tenella tenella tenella tenella
sporulated sporulated sporulated sporulated
oocysts oocysts oocysts oocysts
(5 (5 (5 (5
× × × ×
104) 104) 104) 104)
Note：a, Primary immunization was performed at 14 days of cobb broiler. b, A booster immunization was done at seven dpi. c, E. tenella sporulated oocysts (5.0 × 104) were inoculated at 14 dpi.
Fig. 1. 1 % agarose gel electrophoresis of EtSAG4 gene PCR product. A: EtSAG4 complete gene; B: EtSAG4 gene from pET28a vector; C: EtSAG4 gene from pEGFP-N1-SAG4 plasmid; Lane M, Trans2K PlusⅡ DNA Marker; Lane 1, EtSAG4 gene; Lane 2, negative control.
Waltham, MA, USA) for 24 h, and were observed under a fluorescence microscope (Olympus, Japan).
mouse monoclonal antibody (dilutions 1:2000) (Proteintech Group, Inc, Chicago, USA) as primary antibody and horseradish peroxidase (HRP)conjugated goat anti-mouse IgG (dilutions 1:2000) (Biyuntian Co., LTD Shanghai, China) as second antibody. Bound antibody was detected by the ECL kit (Juneng, Wuhan, China).
2.6. Detecting expression of pEGFP-N1-EtSAG4 plasmid in 293 T cells by RT-PCR and western blot
2.7. Animal experiment
After pEGFP-N1-EtSAG4 plasmids replicated in 293 T cells for 24 h, intact RNA was extracted from transfected 293 T cells and RT-PCR was performed according to method mentioned in 2.2. Besides, western blot was carried out as described previously in 2.4 with minor adjustments. Briefly, cell lysis buffer (P0013, Biyuntian, Shanghai, China) was added into transfected 293 T cells to extract proteins. SDS-PAGE was used to separate proteins. Obtained proteins were transferred to PVDF membranes subsequently. PVDF membranes were incubated with GFP tag
Seventy-two cobb broiler 14 days of age were weighed and divided into nine groups randomly as listed in Table 2. Chickens of G1-G4 groups were used to evaluate immunoprotective of rEtSAG4 protein while G5-G9 groups were for pEGFP-N1-EtSAG4 plasmid. Chickens were immunised with rEtSAG4 protein or pEGFP-N1-EtSAG4 plasmid by chest intramuscular injection with different doses (50 and 100 μg). 3
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Fig. 2. A: SDS-PAGE of purified rEtSAG4 protein. Lane 1, purified rEtSAG4 protein; B: Western blot of rEtSAG4 protein; Lane M, standard protein molecular weight marker. Lane 1, rEtSAG4 protein probed by His-tag as primary antibody; Lane 2, rEtSAG4 protein probed by serum from chickens experimentally infected with E. tenella as primary antibody; Lane 3, rEtSAG4 protein probed by serum of uninfected chickens as primary antibody.
Fig. 3. A: EtSAG4 gene expression in 293 T cells under fluorescence microscopy. a, cells with pEGFP-N1 plasmid; b, normal 293 T cells; c, 293 T cells with pEGFP-N1-SAG4 plasmid; B: RT-PCR assay of EtSAG4 gene expression in 293 T cells. Lane M, Trans2KⅡ DNA Marker; Lane 1: pEGFP-N1-EtSAG4 plasmid; Lane 2, empty pEGFP-N1 plasmid; Lane 3, negative control; C: Western blot analysis of EtSAG4 gene expression in 293 T cells. Lane M, standard protein molecular weight marker; Lane 1, 293 T cells transfected with pEGFP-N1-EtSAG4 plasmid; Lane 2. 293 T cells transfected with pEGFP-N1 plasmid；Lane 3, negative control.
2.8. Concentration of cytokines and serum antibody
Phosphate buffer saline (PBS) and endotoxin-free elution buffer (D6950, OMEGA, USA) for control groups (G3, G4, G8 and G9 groups) were inoculated according to the same method. Also, chickens of G7 group were immunized with empty pEGFP-N1 plasmids as plasmid control group. A booster immunisation was given at seven days post injection (7 dpi). All chickens except uninfected control groups (G4 and G9 groups) were challenged with E. tenella sporulated oocysts (5.0 × 104) by orally at 14 dpi.
Concentration of interleukin-17 (IL-17), interleukin-10 (IL-10), interleukin-4 (IL-4), interferon-γ (IFN-γ), and IgY antibody level in serum were detected by utilizing an indirect enzyme-linked immunosorbent assay (ELISA) commercial kits named "chick cytokine ELISA Quantitation Kits" (catalog numbers: CSB-E04607Ch, CSB-E12835C, CSB-E06756Ch, CSB-E08550Ch, and CSB-E11635Ch for IL-17, IL-10, IL4, IFN-γ, and IgY respectively; CUSABIO, Wuhan, China), according to manufacturer’s instructions. 4
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Fig. 4. The concentration of cytokines and IgY antibody level in chickens immunized rEtSAG4 protein. G3 and G4 groups were immunized with PBS intramuscularly. G1 and G2 groups were immunised intramuscularly with 50 μg or 100 μg rEtSAG4 protein, respectively. A booster immunisation was given at seven dpi according to the same method. Serum was collected from the wing to detect concentration of cytokines and IgY antibody level by ELISA at 14 dpi. A: IFN-γ concentration; B: IgY concentration; C: IL-4 concentration; D: IL-10 concentration; E: IL-17 concentration.
software (SPSS for windows 25.0, SPSS Inc., Chicago, USA) and Graphpad Prism 8.0 (software Inc., La Jolla, CA, USA) were used to analyze data with one-way ANOVA and Duncan’s multiple ranges (p < 0.05 was considered significantly different among groups).
2.9. Immunoprotective parameters in vivo In vivo immunoprotective parameters of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid were clinical (weight, survival rate and mortality), pathological (cecum lesion score) and parasitological (ACI and oocyst output) (Morehouse and Baron, 1970). Weight gain and survival rate were calculated directly. Cecum lesion score is a continuous number from 0 (none) to 4 (severe) representing different levels of cecum lesion, according to Johnson and Reid (Johnson and Reid, 1970), which is evaluated by three independent observers. Furthermore, cecal content was collected to calculate oocysts per gram (OPG) using McMaster’s counting technique (Long et al., 1976). ACI as a synthetic criterion, which responded to holistic health conditions of chickens represents various degrees of vaccine protection: ACI > 180 is good protection, 160 < ACI < 179 is moderate protection, 120 < ACI < 159 is limited protection, ACI < 120 was no protection (Chapman, 1998).
3. Results 3.1. Gene clone and plasmid construction EtSAG4 fragment was successfully amplificated from cDNA by PCR method (Fig. 1A). Partial sequence of EtSAG4 was obtained using primers shown in Table 1 (EtSAG4F-2 and EtSAG4R-2 primers), cloned into pET-28a or pEGFP-N1 vector (Fig. 1B and C), and was identical to E. tenella Houghton strain (AJ586535.1) through sequence analysis. 3.2. Expression and purification of rEtSAG4 protein rEtSAG4 protein was detected by SDS-PAGE and purified using sucrose concentration and glutathione renaturation in sediment. Molecular mass of rEtSAG4 protein was about 29 kDa (containing Histag) (Fig. 2A). Western blot experiment demonstrated successful expression of rEtSAG4 protein using anti-His-tag antibody and serum from chickens infected with E. tenella, respectively. Besides, there was no
2.10. Sequence and statistical analysis Online software SignalIP (http://www.cbs.dtu.dk/services/SignalP/ ) and big-PI predictor (http://mendel.imp.ac.at/gpi/gpi_server.html) were used to predict sequences of truncated EtSAG4. SPSS statistical 5
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Fig. 5. The concentration of cytokines and IgY antibody level in chickens immunized pEGFPN1-EtSAG4 plasmid. G8 and G9 groups were immunised intramuscularly with endotoxinfree elution buffer. Similarly, G7 group was immunized with empty pEGFP-N1 plasmid. G5 and G6 groups were immunized with 50 μg or 100 μg pEGFP-N1-EtSAG4 plasmid, respectively. A booster immunisation was given at seven dpi according to the same method. Serum was collected from the wing to detect concentration of cytokines and IgY antibody level by ELISA at 14 dpi. A: IFN-γ concentration; B: IgY concentration; C: IL-4 concentration; D: IL-10 concentration; E: IL-17 concentration.
Table 3 Effects of recombinant EtSAG4 protein against E. tenella challenge. Groups
Average body weight gains (g)
Relative body weight gain (%)
Oocyst output (105)
NC EtSAG4 PC EtSAG4 G1 G2
202.63 ± 43.60a 96.38 ± 33.29b 182.75 ± 29.54a 181.50 ± 21.29a
100.00 47.56 90.19 89.57
0f 1.47 ± 0.021c 0.9 ± 0.057d 0.36 ± 0.042e
Mean lesion scores 0i 3.55 ± 0.25g 1.93 ± 0.19h 1.88 ± 0.22h
Anti-coccidial index 200.00 72.06 155.89 163.77
Note: The diverse alphabetic symbol represented that mean was significantly different (p < 0.05) between two groups. NC: negative control; PC: positive control. Table 4 Effects of pEGFP-N1-EtSAG4 against E. tenella challenge. Groups NC pEGFP-N1-EtSAG4 PC pEGFP-N1-EtSAG4 G5 G6 G7
Average body weight gains (g) a
132.50 ± 23.18 71.00 ± 48.35b 135.50 ± 42.63 a 129.50 ± 21.97a 106.25 ± 28.90c
Relative body weight gain (%)
Oocyst output (105) h
100.00 53.58 102.26 97.74 80.19
0 1.79 ± 0.035d 1.12 ± 0.180 f 0.75 ± 0.035g 1.65 ± 0.050e
Mean lesion scores l
0 3.47 ± 0.19i 1.86 ± 0.14j 1.35 ± 0.29k 3.55 ± 0.14i
Anti-coccidial index 200.00 78.88 156.66 168.24 109.79
Note: The diverse alphabetic symbol represented that mean was significantly different (p < 0.05) between two groups. NC: negative control; PC: positive control.
plasmids showed green fluorescence under a fluorescence microscope on account of GFT tag. Meanwhile, there was no fluorescence in normal 293 T cells (Fig. 3A). RT-PCR showed that 293 T cells transfected with pEGFP-N1-EtSAG4 plasmid produced a band at 688 bp (containing homologous arm), which was absent in cells transfected with pEGFP-N1
reaction between rEtSAG4 protein and negative serum (Fig. 2B). 3.3. Expression of pEGFP-N1-EtSAG4 plasmids in 293 T cells 293 T cells transfected with empty pEGFP-N1 or pEGFP-N1-EtSAG4 6
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
All chickens survived from animal experiments. Average body weight gains of chickens immunised rEtSAG4 protein and pEGFP-N1EtSAG4 plasmid were both significantly higher than infection control groups (G3 and G8 groups). Likewise, chickens vaccinated with either rEtSAG4 protein or pEGFP-N1-EtSAG4 plasmid showed reduced oocyst output and lower lesion scores compared with positive control groups (G3 and G8 groups). ACI value of low dose groups (50 μg) of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid were more than 155, and high dose groups (100 μg) were more than 160 (Tables 3 and 4).
indicated differences of rEtSAG4 protein inducing immune response between in vivo and in vitro. However, antibody level of IgY was only increased in chickens immunised pEGFP-N1-EtSAG4 plasmid. There is no correlation between antibody titers of serum and immunoprotective against coccidiosis and humoral immunity is usually with a minor role in process of parasites infection (Lee et al., 2009; Wallach et al., 1992). In addition, empty pEGFP-N1 plasmids yet stimulated IgY antibody response indicating induction of non-specific humoral immunity. IL-17 cytokines were produced from Th17 cells involving elimination of pathogens (Korn et al., 2009). The pEGFP-N1-EtSAG4 plasmid with high IL-17 output might stimulate stronger immunity than rEtSAG4 protein. Proteins produced from DNA vaccine is more similar to natural protein conformation compared with recombinant protein expressed in exogenous vector (Zhao et al., 2013). Animal experiments showed that both rEtSAG4 protein and pEGFPN1-EtSAG4 plasmid could cause increased average body weight gain, decreased oocyst output, and lower mean lesion scores compared with infection control. The ACI value of rEtSAG4 protein 100 μg (G2 group) or pEGFP-N1-EtSAG4 plasmid 100 μg (G6 group) reached more than 160. In conclusion, we successfully obtained rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid according to truncated EtSAG4 gene without C-terminal hydrophobic GPI signal-anchor peptide and Nterminal hydrophobic signal peptide. Increased IFN-γ concentration occurred in both rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid declaring induction of cell-mediated immunity. Besides, pEGFP-N1EtSAG4 plasmid with increased concentration of IgY and IL-17 behaved better in immunity response than rEtSAG4 protein. Animal challenge experiment showed that rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid could protect chickens against E. tenella challenge. EtSAG4 might be a competent vaccine candidate gene against E. tenella.
4. Discussion
Declaration of Competing Interest
Eimeria tenella invaded intestinal epithelial cells of chickens and cause damaged intestinal hemorrhage, which is enormous economic losses for poultry industry (Wiedmer et al., 2017). Apicomplexa parasites secrete surface antigens with GPI-anchored during adhesion and invasion. At present, more than 20 Eimeria GPI-anchored surface antigens had been studied (Reid et al., 2014). Many antigen genes of Eimeria spp were used as candidates of subunit vaccine or DNA vaccine, such as MZ5-7 gene of E. tenella and cSZ-2 gene of E. acervulina (Geriletu et al., 2011; Hoan et al., 2015). Moreover, EtSAG4 gene of E. tenella had been found to induce inflammatory responses in avian macrophages (Yock-Ping et al., 2011). Therefore, we expressed EtSAG4 gene of E. tenella to obtain rEtSAG4 protein as subunit vaccine and constructed pEGFP-N1-EtSAG4 plasmid as DNA vaccine in this research. Subsequently, immunoprotective of recombinant protein and DNA vaccine of E. tenella surface antigen 4 were evaluated through animal challenge in vivo. Western blot and RT-PCR demonstrated successful acquisition of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid. rEtSAG4 protein was identified by chickens serum infected with E. tenella through western blot experiments according to similar methods described by Zhang et al. (2015). Cell-mediated immunity played an essential role in immune response of anticoccidial that was regulated by IFN-γ cytokines (Debock and Flamand, 2014; Rothwell et al., 2000). In this study, we found that both rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid enhanced release of IFN-γ, which indicated that EtSAG4 stimulated Th1 cell’s immune response. The chickens immunised with rEtSAG4 protein and pEGFPN1-EtSAG4 plasmid showed no rise in concentration of IL-4 and IL-10 that were known as Th2-type cytokine correlated with humoral immunity function (Yun et al., 2000). However, Yock-Ping et al. reported that recombinant SAG4 protein cause decreased expression of IL-12 and IFN-γ, and increased expression of IL-10 in chickens macrophage (YockPing et al., 2011). The diverse concentration variation of cytokines
There were no known competing financial interests or personal relationships to influence the work reported in this paper.
plasmid and normal cells (Fig. 3B). Western blotting analysis exhibited that cells transfected pEGFP-N1-EtSAG4 plasmid exposed a band of about 53 kDa (containing GFP tag). Cells transfected pEGFP-N1 plasmid generated a band of about 27 kDa (GFP tag) without specific bands in normal 293 T cells (Fig. 3C). RT-PCR and western blot both demonstrated that pEGFP-N1-EtSAG4 plasmid expressed in 293 T cells successfully. 3.4. Cytokine concentration and serum antibody level IFN-γ concentration of serum from chickens immunised with rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmid was significantly higher compared with control groups (p < 0.05) (Figs. 4A and 5A). Similarly, increased IgY antibody titer and IL-17 concentration only occurred in chickens immunised with the pEGFP-N1-EtSAG4 plasmid (p < 0.05) (Fig. 5B and E). However, both rEtSAG4 protein and pEGFPN1-EtSAG4 plasmid did not motivate production of IL-4 and IL-10 (Figs. 4 and 5). 3.5. Immunoprotective of rEtSAG4 protein and pEGFP-N1-EtSAG4 plasmids in vivo
Acknowledgments We would like to thank professor Shijun Li for providing space for animal experiments and guidance from professor Rui Fang, Junlong Zhao, Yanqin Zhou. This study was supported by the national key research and development program (2016YFD0501303) and the Fundamental Research Funds for the Central Universities (Grant No. 2662015PY048). References Blake, D.P., Tomley, F.M., 2013. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 30, 12–19. Blake, D.P., Clark, E.L., Macdonald, S.E., Thenmozhi, V., Tomley, F.M., 2015. Population, genetic, and antigenic diversity of the apicomplexan Eimeria tenella and their relevance to vaccine development. Proc. Natl. Acad. Sci. U. S. A. 112. Bussière, F.I., Niepceron, A., Sausset, A., Esnault, E., Silvestre, A., Walker, R.A., Smith, N.C., Quéré, P., Laurent, F., 2018. Establishment of an in vitro chicken epithelial cell line model to investigate Eimeria tenella gamete development. Parasit. Vectors 11, 44. Chapman, H.D., 1975. Eimeria tenella in chickens: development of resistance to quinolone anticoccidial drugs. Parasitology 71, 41–49. Chapman, H.D., 1998. Evaluation of the efficacy of anticoccidial drugs against Eimeria species in the fowl. Int. J. Parasitol. 28, 1141–1144. Chapman, H.D., Jeffers, T.K., 2014. Vaccination of chickens against coccidiosis ameliorates drug resistance in commercial poultry production. Int. J. Parasitol. Drugs Drug Resist. 4, 214–217. Clark, E.L., Macdonald, S.E., Thenmozhi, V., Kundu, K., Garg, R., Kumar, S., Ayoade, S., Fornace, K.M., Jatau, I.D., Moftah, A., 2016. Cryptic Eimeria genotypes are common across the southern but not northern hemisphere ⋆. Int. J. Parasitol. 46, 537–544. Debock, I., Flamand, V., 2014. Unbalanced neonatal CD4+ T-Cell immunity. Front. Immunol. 5. Dimier, I.H., Bout, D.T., 1997. Inhibition of Toxoplasma gondii replication in IFN-γ-activated human intestinal epithelial cells. Immunol. Cell Biol. 75, 511–514.
7
Veterinary Parasitology 278 (2020) 109032
P. Zhao, et al.
Ramly, N.Z., Rouzheinikov, S.N., Sedelnikova, S.E., Baker, P.J., Chow, Y.P., Wan, K.L., Nathan, S., Rice, D.W., 2013. Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella. Acta Crystallogr. 69. Reid, A., Blake, D., Ansari, H., Billington, K., Browne, H., Bryant, J.M., Dunn, M., Hung, S., Kawahara, F., Miranda-Saavedra, D., Malas, T., Mourier, T., Naghra, H., Nair, M., Otto, T., Rawlings, N., Rivailler, P., Sanchez-Flores, A., Sanders, M., Pain, A., 2014. Genomic analysis of the causative agents of coccidiosis in domestic chickens. Genome Res. 24, 1676–1685. Rothwell, L., Muir, W., Kaiser, P., 2000. Interferon-?? is expressed in both gut and spleen during Eimeria tenella infection. Avian Pathol. 29, 333–342. Shirley, M.W., Smith, A.L., Tomley, F.M., 2005. The biology of avian eimeria with an emphasis on their control by vaccination. Adv. Parasitol. 60, 285–330. Shirley, M.W., Smith, A.L., Blake, D.P., 2007. Challenges in the successful control of the avian coccidia. Vaccine 25, 0–5547. Smith, R.R., Ruff, M.D., 1975. A rapid technique for the cleaning and concentration of eimeria oocysts. Poult. Sci. 54, 2081–2086. Tabarés, E., Ferguson, D., Clark, J., Soon, P.-E., Wan, K.-L., Tomley, F., 2004. Eimeria tenella sporozoites and merozoites differentially express glycosylphosphatidylinositol-anchored variant surface proteins. Mol. Biochem. Parasitol. 135, 123–132. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 102, 459–471. Wallach, M., Halabi, A., Pillemer, G., Sar-Shalom, O., Augustine, P.C., 1992. Maternal immunization with gametocyte antigens as a means of providing protective immunity against Eimeria maxima in chickens. Infect. Immun. 60, 2036–2039. Wiedmer, S., Erdbeer, A., Volke, B., Randel, S., Kapplusch, F., Hanig, S., Kurth, M., 2017. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa). Parasite 24. Yock-Ping, C., Kiew-Lian, W., P., B.D, Fiona, T., Sheila, N., Martins, B.E., 2011. Immunogenic eimeria tenella glycosylphosphatidylinositol-anchored surface antigens (SAGs) induce inflammatory responses in avian macrophages. PLoS One 6, e25233. Yun, C.H., Lillehoj, H.S., Lillehoj, E.P., 2000. Intestinal immune responses to coccidiosis. Dev. Comp. Immunol. 24, 0–324. Zhang, Z.C., JingWei, H., MengHui, L., YuXia, S., Shuai, W., LianRui, L., LiXin, X., RuoFeng, Y., XiaoKai, S., XiangRui, L., 2014. Identification and molecular characterization of microneme 5 of eimeria acervulina. PLoS One 9, e115411. Zhang, Z.C., Liu, L.R., Huang, J.W., Wang, S., Li, X.R., 2015. The molecular characterization and immune protection of microneme 2 of Eimeria acervulina. Vet. Parasitol. 215, 96–105. Zhao, G., Zhou, A., Lu, G., Meng, M., Sun, M., Bai…, Y., 2013. Identification and characterization ofToxoplasma gondiiaspartic protease 1 as a novel vaccine candidate against toxoplasmosis. Parasit. Vectors 6, 175.
Dimier, I.H., Quere, P., Naciri, M., Bout, D.T., 1998. Inhibition of Eimeria tenella development in vitro mediated by chicken macrophages and fibroblasts treated with chicken cell supernatants with IFN-g activity. Avian Dis. 42, 239. Ding, X., Lillehoj, H.S., Dalloul, R.A., Min, W., Sato, T., Yasuda, A., Lillehoj, E.P., 2005. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis. Vaccine 23, 0–3740. Geriletu, Xu, L., Xurihua, Li, X., 2011. Vaccination of chickens with DNA vaccine expressing Eimeria tenella MZ5-7 against coccidiosis. Vet. Parasitol. 177, 6–12. Hoan, T.D., Thao, D.T., Gadahia, J.A., Song, X., Xu, L., Yan, R., XiangRui, L., 2015. Analysis of humoral immune response and cytokines in chickens vaccinated with Eimeria brunetti apical membrane antigen-1(EbAMA1) DNA vaccine. The 13th Symposium of Veterinary Parasitology Branch of Chinese Animal Husbandry and Veterinary Association. Hoan, T.D., Zhang, Z., Huang, J., Yan, R., Song, X., Xu, L., Li, X., 2016. Identification and immunogenicity of microneme protein 2 (EbMIC2) of Eimeria brunetti. Exp. Parasitol. 162, 7–17. Jahn, D., Matros, A., Bakulina, A.Y., Tiedemann, J., Schubert, U., Giersberg, M., Haehnel, S., Zoufal, K., Mock, H.-P., Kipriyanov, S.M., 2009. Model structure of the immunodominant surface antigen ofEimeria tenellaidentified as a target for sporozoiteneutralizing monoclonal antibody. Parasitol Res. 105, 655–668. Johnson, J., Reid, W.M., 1970. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 28 0-36. Korn, T., Bettelli, E., Oukka, M., Kuchroo, V.K., 2009. IL-17 and Th17 cells. Annu. Rev. Immunol. 8, 485–517. Lee, S.H., Lillehoj, H.S., Park, D.W., Jang, S.I., Lillehoj, E.P., 2009. Protective effect of hyperimmune egg yolk IgY antibodies against Eimeria tenella and Eimeria maxima infections. Vet. Parasitol. 163, 123–126. Lekutis, C., Ferguson, D.J.P., Grigg, M.E., Camps, M., Boothroyd, J.C., 2001. Surface antigens of Toxoplasma gondii: variations on a theme. Int. J. Parasitol. 31, 1285–1292. Lillehoj, H.S., 1987. Effects of immunosuppression on avian coccidiosis: cyclosporin A but not hormonal bursectomy abrogates host protective immunity. Infect. Immun. 55, 1616. Liu, Y., Zheng, J., Li, J., Gong, P., Zhang, X., 2013. Protective immunity induced by a DNA vaccine encodingEimeria tenellarhomboid against homologous challenge. Parasitol. Res. 112, 251–257. Long, P.L., Millard, B.J., Joyner, L.P., Norton, C.C., 1976. A guide to laboratory techniques used in the study and diagnosis of avian coccidia. Folia Vet. Lat. 6, 201–217. Morehouse, N.F., Baron, R.R., 1970. Coccidiosis: evaluation of coccidiostats by mortality, weight gains, and fecal scores. Exp. Parasitol. 28, 0–29. Nielsen, H.V., Lauemøller, S.L., Christiansen, L., Buus, S., Petersen, E., 2000. Complete protection against lethal toxoplasma gondii infection in mice immunized with a plasmid encoding the SAG1 gene. Infect. Immun. 67, 6358–6363. Ovington, K.S., Alleva, L.M., Kerr, E.A., 1995. Cytokines and immunological control of Eimeria spp. Int. J. Parasitol. 25, 1331–1351.
8