Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella

ELSEVIER

Molecular

and Biochemical

Parasitology

79

(I 996) 195-206

Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella ’ Fiona

M. Tomley *, Janene Institute for

Received

M. Bumstead,

Karen

J. Billington,

Paul P.J. Dunn

Animal Health, Compton, Nrwbur~, Berkshire, RC20 7NN, UK

21 December

1995; revised 9 May

1996; accepted

I5 May

1996

Abstract A 50 kDa acidic protein, which is found within the microneme organelles of Eimeria tenella sporozoites and merozoites and called E. tenella mic-2, was cloned by immunoscreening of a cDNA expression library. The expression of the protein and its mRNA during the developmental cycle of the parasite was consistent with de novo formation of microneme organelles during both sporulation and schizogony. Although micronemal in origin, indirect immunofluorescent antibody labelling on gluraraldehyde fixed parasites, indicated that the protein was translocated to the sporozoite surface, and, during host cell invasion the protein was focussed at the point of parasite entry and secreted from the host-parasite interface. Either during or just after invasion, Etmic-2 protein became transiently dispersed over the entire surface of the infected cell. One hour after adding sporozoites to host cells, no detectable Etmic-2 protein remained on the host cell surface. A full length cDNA corresponding to Etmic-2 predicted a protein with a classical signal peptide that preceded the mature N-terminus of the protein as determined by direct microsequencing. Regions of the Etmic-2 protein have highly significant similarities to regions within Drosophila melanogaster tropomyosin II and within two known substrates of the cellular regulatory enzyme protein kinase C. Keywords:

Eirneria tenella: Microneme;

Protein; Sequence; Exocytosis; Invasion

1. Introduction Abbreviations: Etmic-I, Eimeria fenella mic-I protein; ErEimeria tenella mic-2 protein; recEtmic-2, recombinant Eimeria tenella mic-2 protein; TRAP/SSP-2, thrombospondin

mic-2,

related anonymous protein/sporozoite-surface protein-2. * Corresponding author. Tel.: + 44 1635 577276; fax: + 44 1635 577263; email: [email protected] ’ Note: Nucleotide sequence data reported in this paper are available in the EMBL, GenbankTM and DDJB databases under the accession number 271755 ‘ETMIC2’.

0166-6851/96/$15.00 PII S 166-685

0 1996 Elsevier

1(96)02662-X

Science B.V. All rights

reserved

Eimeriu tenella is an apicomplexan protozoan parasite that replicates within intestinal epithelial cells of the chicken causing the economically important disease coccidiosis. Like all other apicomplexans, invasive forms of E. tenella contain numerous small electron-dense organelles called micronemes which are located mainly at the apical end of the parasite and which, together with

196

F.M.

Tomley et al. / Molecular and Biochemical Parasitology 79 (1996) 195-106

other specialised organelles, are thought to be of fundamental importance in host-cell invasion. In malarial parasites, several protein ligands that interact with host cell molecules have been identified, initially by binding studies, and have been localised to the micronemes. These include the erythrocyte binding antigen EBA-175 of Plasmodium falciparum [1,2]; the duffy binding proteins of Plasmodium vivax and Plasmodium knowlesi [3,4]; and the sulphatide-binding circumsporozoite proteins and thrombospondin - related - anonymous - proteins/ sporozoite surface proteins 2 (TRAP/SSP-2) of several Plasmodium spp. [5-91. Proteins containing regions suggestive of probable adhesive functions have been localised to the micronemes of other parasites, including molecules homologous to TRAP/SSP-2 in E. tenella and Eimeria maxima [lo, 1l] and a cysteine-rich protein with homology to plasma prekallikrein in Sarcocystis muris [12]. To interact directly with the host cell membrane, organellar proteins must be expressed at least transiently at the surface of the invading parasite which is consistent with the long held belief that micronemes are secretory organelles. A formal demonstration of microneme secretion during host cell invasion was recently achieved in a microscopic study of S. muris cystozoites in cell culture [13]. It appears that only a proportion of the micronemes are exocytosed during invasion as newly invaded parasites of several genera can be seen to retain large numbers of micronemes within the body of the intracellular parasite. The polypeptide composition of micronemes purified directly from sporozoites of E. tenella by sucrose density gradient ultracentifugation is rather simple when analysed by SDS-PAGE [14]. One polypeptide, EtplOO [lo] (renamed now as E. tenella mic-1, Efmic-I), is the E. tenella homologue of TRAP/SSP-2, and a second polypeptide of 50 kDa called E. tenella mic-2 (Etmic-2) is described in this paper.

2. Materials and methods 2.1. Parasites

The Houghton strain of E. tenella was used throughout, except that the Wisconsin strain was used for infection of cultured Madin-Darby bovine kidney cells (NBL, Flow). Oocysts of E. tenella were propagated, isolated and sporulated using standard procedures [15] and sporozoites were purified by anion exchange chromatography [16]. Second generation merozoites were isolated from the caecal mucosa of chickens 96 h after oral inoculation with 5 x 10’ sporulated oocysts [17] and were also purified by anion-exchange chromatography. 2.2. Preparation

of native Etmic-2

antigen

Sonicates of sporozoites, prepared immediately after anion-exchange chromatography, were used to purify micronemes as previously described [14]. Micronemes from approximately 5 x lo8 sporozoites were fractionated by SDS-PAGE in the presence of p-mercaptoethanol, the gel stained with Coomassie Brilliant Blue and the polypeptide of approximately 50 kDa excised from each track. Gel slices were suspended in 2 ml of phosphate buffered saline (PBS, 0.8% w/v NaCl, 0.2% w/v KCl, 10 mM Na,HPO,, 2 mM KH,PO,, pH 7.4), mashed by syringing several times through a 19 G needle and frozen in aliquots. A specific antiserum (RaEtmic-2) against this antigen was raised in a rabbit using a course of immunisations as described [14]. 2.3. Western blotting, antibody

indirect jhorescent lab and immunoelectron microscopy

Rabbit antisera were used to probe Western blots of E. tenella sporozoite polypeptides as described [14]. Freshly excysted and purified sporozoites of E. tenella were used to infect near-confluent monolayers of NBL cells growing on glass coverslips within 24-well tissue culture plates. At various times post infection, glass coverslips were removed from the wells and the cells were fixed by immersion in either 10% methanol/

F.M.

Tomley er al. / Molecular and Biochemical Parasitology 79 (1996) 195-206

5% acetone or in 2.5% phosphate-buffered glutaraldehyde. Fixed monolayers were incubated successively with PBS containing 1% bovine serum albumen (1 h), Ramic50 or Rabbit antiactin (Sigma, cat. no. A2668) (l:lOO, 1 h) and affinity-purified goat anti-rabbit immunoglobulin G (H and L chains) conjugated to fluoreceinisothiocyanate (1:20, 1 h) with several washings in between each incubation. Coverslips were mounted under polyvinyl alcohol and photographed under ultraviolet illumination. Approxand purified imately 1Ox freshly excysted sporozoites of E. tenelh were pelleted by centrifugation, fixed by immersion in 1.5% phosphate buffered glutaraldehyde, dehydrated in ethanol and embedded in LR White resin. After polymerisation, thin sections were prepared and incubated successively with normal goat serum (1:5, 15 min), Rrmic50 (1: 100, 2 h) and 10 nm gold particles coupled to purified goat anti-rabbit immunoglobulin antibodies (1:30, 30 min) with several washings in between each incubation. Sections were stained with lead citrate followed by uranyl acetate and examined using a Philips 300 transmission electron microscope at an accelerating voltage of 80 kV.

2.4. N-Terminal Etrnic-2

amino acid sequencing

of native

Polypeptides of purified second generation merozoites were fractionated by two dimensional PAGE [18], transferred by electro-blotting onto a polyvinylidenedifluoride membrane (Immobilon P, Millipore), in 7.5 mM Tris (pH 8.5), 1.2 mM sodium borate, 0.02% /3-mercaptoethanol, stained with aqueous Coomassie Brilliant Blue and the spot corresponding to native Etmic-2 antigen excised. Pooled spots from six transfers were subjected to N-terminal amino acid sequencing at the Microchemical Facility, Institute of Animal Physiology and Genetics Research, Babraham, Cambridge. 2.5. Construction cDNA library mRNA

and screening

was prepared

from

of a sporozoite

freshly

purified

191

sporozoites by detergent lysis, protein degradation and oligo(dT) cellulose chromatography (FastTrack, Invitrogen). Double-stranded cDNA was synthesised from 6pg of mRNA (ZAP-cDNA, Stratagene), portions ligated into Uni-ZAP XR vector and packaged into lphage (Gigapack Gold II, Stratagene). The primary library was amplified on E. coli SURE (Stratagene), and the amplified library immunoscreened with RaEtmic-2 serum on E. coli XL-l Blue (Stratagene). Plaques which reacted positively were re-screened at lower density and the process repeated until plaque-pure populations were obtained. 2.6. Analysis

of cDNA

inserts

pBluescript plasmids were rescued from high concentration phage stocks by in vivo excision into E. coli SOLR (Stratagene). Plasmid DNA was prepared by alkaline lysis mini-prep, analysed by digestion with restriction endonucleases and the ends of unique inserts cycle sequenced using T3 and T7 primers on an automated DNA sequencer (ABI Model 373A, Applied Biosystems). The entire sequences of inserts of pmic50.2 and pmic50.3 were obtained by cycle sequencing of shot-gun clones generated in SmaI -cut, dephosphorylated M 13 mpl0, using Staden software [ 191 to assemble and analyse the data. To obtain a cDNA clone containing sequences upstream of the S’end of pmic50.2, a primer was synthesised (5’AGGGAGACAATGAAGTCCCGTTCGC) which is complementary to nucleotides 55-79 of the sense strand of the cDNA insert of pmic50.2. This gene-specific primer was used with the T3 promoter primer in a polymerase chain reaction using alp1 sample of the sporozoite cDNA library as template. The product of around 400 bp was purified from a 1% low-melting-point agarose gel using gelase (Epicentre Technologies, distributed in UK by Cambio), ligated into pT7 Blue T-vector (Novagen) and transformed into E. coli Novablue (Novagen). Plasmid DNA was purifed using Qiaprep (Qiagen) and the inserts sequenced using plasmid specific primers (T7 and U-19mer, Novagen) and the gene-specific primer. DNA sequences were also obtained by direct sequencing

198

F.M. Tomley et al. 1 Molecular and Biochemical Parasitoi0g.v 79 (1996) 195-206

of the purified PCR product using the T3 and gene-specific primers. The contiguous sequence data were assembled and analysed using Staden [19] and Wisconsin [20] software and the predicted protein sequence was compared to the available databases using FASTA [21] and BLASTP [22] programmes.

ml immobilised nickel affinity column (Probond resin, Invitrogen). The protein was dialysed extensively against PBS and stored at - 20°C in aliquots. A specific antiserum (RctrecEtmic-2) against this antigen was raised in a rabbit using a course of immunisations as described [14].

2.7. Northern

3. Results

blotting

Sporozoite mRNA was denatured, electrophoresed and transferred to Hybond Nylon membrane as described [23] except that the transfer was achieved by capillary blotting. Following transfer, the membrane was baked for 2 h at 80°C and probed with the excised insert from plasmid pmic50.2, radiolabelled by random hexanucleotide priming to incorporate [3’P]dCTP (Prime-it, Stratagene), using conditions of pre-hybridisation, hybridisation and washing as described [23]. 2.8. Over-expression

of recombinant

Etmic-2

The cDNA insert from plasmid pmic50.2 was released by digestion with BumHl and Xho 1, purifed from a 1% agarose gel using Gene Clean (Stratatech Scientific) and cloned into BamHI and Xho I digested, dephosphorylated plasmid pRSETB (Invitrogen) After transformation into E. coli HMS174, recombinants were selected as white colonies on plates containing 100 pg ml ~ ’ ampicillin, 20 mM IPTG and 0.2 mM X-Gal and plasmid DNA was analysed by restriction endonuclease digestion. Five millilitres of an overnight culture of recombinant clone pRSETBmic50 were diluted to 500 ml in L-broth containing 100 pg ml --I ampicillin and 5 mM MgClz and grown with shaking until the absorbance at 600 nm reached 0.4. IPTG was added to 1 mM and the culture shaken for a further 5 h. Cells were pelleted, resuspended in 6 M guanidine-HCl, 20 mM sodium phosphate (pH 7.8) and sonicated at 10 pm amplitude for four bursts of 45 s in an MSE soniprep 150. The sonicate was centrifuged at 10000 x g for 10 min and the soluble recombinant protein (recEtmic-2) purified from the supernatant under denaturing conditions using a 10

3.1. Isolation Etmic-2

of cDNA

clones corresponding

to

Micronemes prepared by sucrose gradient ultracentrifugation and separated by SDS-PAGE apcontain around 10 discernible pear to polypeptides [14]. On reducing SDS-PAGE, Etmic-2 migrates as a 50 kDa band which is well separated from other microneme polypeptides. A rabbit antiserum raised against this protein (RaEtmic-2 serum) recognised an apparent doublet band of 50 kDa (data not shown) on Western blots of both sporozoites and merozoites of E. tenella. Approximately 10 000 plaques of a sporozoite expression library in /iZAP were screened with RaEtmic-2 serum and approximately 50 of these (1 in 200) stained positively. Seven clones (pmic50.1 to pmic50.7) were taken through three rounds of purification and re-screening. One clone (pmic50.6) failed to excise into pBluescript and a second (pmic50.1) was abandoned because of altered sequences within the pBluescript multiple cloning site. The remaining five clones all overlapped, with their 3’ ends terminating at slightly different points along the map of the gene. Each sequence ended with a stretch of A nucleotides which was of variable length and which for three of the clones contained a small number of other nucleotides (between 1 and 3). The reason for heterogeneity at the 3’ ends of the clones was not investigated but could be due either to multiple transcription termination sites in the gene or to internal priming with oligo(dT) during the cDNA cloning. A third possibility, that Etmic-2 is encoded by a member of a multi-gene family, was excluded since Southern blots of E. tenellu genomic DNA digested with a variety of restriction endonucleases were consistent with Etmic-2 being

F.M.

Ton&y

et al. / Mokculur

and Biochemical

present in a single copy within the genome (data not shown). None of the five clones appeared to be full length, clone pmic50.2 extending furthest at the 5’ end. This clone was over-expressed in E. coli using the vector pRSET and the recombinant product used to raise an additional antiserum (RarecEtmic-2 serum) which behaved in an identical manner to antiserum raised against the native Etmic-2 polypeptide in all of our studies, confirming that the cDNA insert of clone pmic50.2 did code for Etmic-2. An oligonucleotide complementary to a region near the 5’ end of pmic50.2 was used together with the T3 promoter primer to generate and clone an amplified DNA product from the library corresponding to the upstream region of the cDNA. 3.2. Location and developmental expression of Etmic2 Western blots of oocysts taken during a time course of sporulation indicated that Etmic-2 is expressed towards the end of the sporulation process (data not shown) and blots of other developmental stages showed that the protein is also present in merozoites of E. tenella (data not shown). Two dimensional electrophoresis of total polypeptides from second generation merozoites (Fig. 1) showed Etmic-2 to be a clearly visible, highly abundant spot that migrated at around 48 kDa with a p1 of around 4.3. The identity of this spot as Etmic-2 was confirmed by its Western blot reactivity with both RaEtmic-2 and RarecEtmic2 antisera (data not shown). Pooled replica spots of Etmic-2 were subjected to N-terminal microsequencing and yielded the amino acid sequence Val-Pro-Gly-Glu-Asp-Ser-Phe-Ser-Pro-Glu-SerGly-Val-Leu-Ser-Gly-Ala-Asp-Ala-Pro-Glu which presumably represents the N-terminus of the mature polypeptide. Northern blots of mRNA extracted from various developmental stages confirmed that Etmic-2 message was not present in the unsporulated oocyst but was present as a band of approximately 1.9 kDa in sporulated oocysts as well as in sporozoites and second generation merozoites (Fig. 2). The expression of protein and mRNA are consistent with the micronemal location of Etmic-

Parusitolog~

79 (1996) 195-206

199

2 and indicate that microneme organelles mature late during the process of sporulation. The location of Etmic-2 within micronemes was confirmed by immunogold electron microscopy of freshly excysted, fixed sporozoites (Fig. 3). Gold particles were bound on and around the micronemes, with no staining of the cell surface or of other internal structures. Indirect immunofluorescent labelling (Figs. 4 and 5) was used to examine expression and localisation of the protein during host cell invasion and schizont development. On preparations fixed with methanol/acetone (Fig. 4A-E), which permeabilises cells and allows binding of antibody to internal antigen, newly excysted sporozoites stained most strongly within the apical tip (Fig. 4A). Five minutes after parasites were added to cells the pattern of staining extended throughout the length of the extracellular sporozoites (Fig. 4B) and as invasion occurred this became concentrated as a tight band of staining at the junction between the parasite and host cell (Fig. 4C). After invasion there was continued staining of the intracellular sporozoite and also reactivity with material that appeared to surround the parasite within the vacuole (Fig. 4D). At later time points, trophozoites and immature schizonts continued to react weakly with the RcrEtmic-2

Acidic

4

Basic

t Fig. 1. Two-dimensional gel electrophoresis of total polypeptides from E. tenella second generation merozoites. Etmic-2 is the acidic spot (p1 4.3) that migrates at around 48 kDa. position indicated on the X-axis by an arrow.

F.M.

200

Tom&v et al. / Molecular and Biochemical Parasitolo~qy 79 (1996) 1955206

uo so sz Mz

2322 2027

1353 1078 872 -

anti-actin serum. This serum bound to cytoplasmic actin of host cells and intracellular sporozoites following fixation with methanol/acetone, but failed to bind after glutaraldehyde fixation, indicating that the cells were not permeable to antibody (results not shown). With the R&tmic2 serum, both extracellular sporozoites (Fig. 5A) and infected host cells (Fig. 5E) showed patchy surface staining, indicating that the protein is translocated from the microneme to the sporozoite surface and onto the surface of the host cell. As with the methanol/acetone fixation, staining during invasion was most concentrated around the point of parasite entry (Fig. .5B,C) but reactive material, which appeared to be secreted in discrete patches or vesicles, was also clearly visible (Fig. 5B,D). After invasion, cells containing parasites

Fig. 2. Northern blot of mRNA extracted from unsporulated oocysts (UO), sporulated oocysts (SO), sporozoites (Sz) or second generation merozoites (Mz) probed with 3’P-labelled insert cDNA from clone pmic50-2.

serum, with faint hazy fluorescence throughout the cytoplasm, and this signal was dramatically increased as the schizont matured, with concentration of the stain into the apical tips of newly formed first generation merozoites within the schizont (Fig. 4E). After schizont rupture, staining remained concentrated within the merozoite tips although there was faint staining around the ruptured cell indicating that microneme material may be lost during cell bursting. Further information about the localisation of Etmic-2 during invasion was gained by indirect immunofluorescent labelling following fixation of infected NBL cells with glutaraldehyde, which cross-links cell membranes and allows binding of antibody only to surface exposed epitopes. To confirm that the glutaraldhyde fixation procedure was rigorous in preventing antibodies from binding to internal antigens, monolayers of parasiteinfected NBL cells fixed either with our standard methanol/acetone or standard glutaraldehyde procedures were stained with a polyclonal rabbit

Fig. 3. Immunogold electron micrograph of the apical end of a newly excysted sporozoite using RaEtmic-2 serum localises the protein to the micronemes (bar = 0.2 pm). C, conoid; Rh. rhoptry; Mi, microneme; RB, refractile body.

F.ILf. Tomlq, rt al. / Molecular and Biochemical Parasitology 79 (1996) 195-206

201

ity to sporozoites, did not stain (Fig. 5A). The dispersal of Etmic-2 antigen over the entire surface of infected cells occurred rapidly and we saw no transitional state where dispersal was over part of the cell surface. Although most of the cells with surface staining had intracellular parasites within them (Fig. 5E), we saw a smaller number where the parasite was partially invaded yet the entire surface of the cell was reactive (Fig. 5D) which suggests that antigen dispersal is triggered at some point during the invasion process. One hour after parasites were added to the cells, virtually all were intracellular and on glutaraldehyde fixed cells no specific staining with RctEtmic-2 could be detected which indicated that all of the dispersed Etmic-2 protein was rapidly lost from the infected cell membrane. 3.3. Predicted primary structure of Etmic-2 The nucleotide sequences of clones pmic50.2, pmic50.3 and the upstream extension clones pmic50exl and pmic50ex2 are shown as a contiguous sequence in Fig. 6 together with the predicted amino acid translation. The total length of 1936 bp for the cDNA is in good agreement with the mRNA size on Northern blots and indicates that the sequence is probably full-length. The nucleotide sequence predicts an open reading frame (ORF) starting at position 1 and reading through to position 1104. The first ATG occurs some 27 triplets downstream from the beginning of the ORF with no intervening in-frame termination codons. The surrounding nucleotide sequence

had patchy surface staining that extended over the entire cell and the stained material could be seen to slough off into the extracellular medium. In contrast, uninfected cells, even if in close proxim-

Fig. 4. Indirect fluorescent antibody labelling with Rctmic50 serum following fixation with methanol and acetone. Panels are orientated so that the apical ends of sporozoites are pointing downwards and all panels are photographed at 800 x magnification. (A) A freshly excysted sporozoite showing mainly tip-specific fluorescence. (B) An extracellular sporozoite, 5 min after addition to NBL cells with heavy staining throughout the length of the parasite. (C) Two sporozoites in the process of invasion, 5 min after addition to NBL cells showing that fluorescence is concentrated mainly at the junction between parasite and cell. (D) An intracellular sporozoite, 7 min after addition to NBL cells showing fluorescence both within the body of the parasite and in material that surrounds the parasite within the vacuole. (E) A mature first generation schizont 44 h post infection which contains numerous daughter merozoites. each of which shows strong tip-specific fluorescence.

202

F.M. Tomley et al. / Molecular and Biochemical Parasitology 79 (1996) 195-206

Fig. 5. Indirect fluorescent antibody labelling with Rrmic 50 serum following fixation with glutaraldehyde, 5 min after the addition of sporozoites to NBL cells. Top. UV illumination; bottom. bright field illumination. (A) An extracellular sporozoite in contact with an adjacent NBL cell. There is patchy surface staining of the parasite and no discernible staining of the host cell. (B-D) Partially invaded sporozoites which are fixed in various planes and which demonstrate some of the features of the typical staining patterns seen on invading parasites with this antibody. Sporozoites B and C show irregular surface staining and a concentration of label at the parasite/host junction with a few small patches of stained material appearing to slough off from the point of invasion. Sporozoite D, which is also partially invaded, has a quite different appearance with no visible concentration of label at the parasite/host junction and with an abundance of patches of stained material covering both the extracellular portion of the parasite and the entire surface of the NBL cell. (E) An NBL cell containing an intracellular sporozoite. Again there is patchy labelling of the cell surface and the stained material appears to be released from the surface into the extracellular medium.

puts this ATG into a good translational context with A at - 3 and G at + 4 [24] and we believe that it encodes the initiating methionine for two additional reasons. Firstly, analysis of codon usage throughout the cDNA shows that the first 26 codons, if they were used, would not conform to the usage pattern for the rest of the predicted sequence. Secondly, the 25 codons that start at the proposed initiating methionine and which precede the mature N-terminus of the protein, as deduced by direct amino acid sequencing, have features typical of a signal peptide sequence including a run of hydrophobic residues with a basic residue close to the methionine and at positions - 1 and - 3 relative to the determined cleavage site [25]. Signal sequences are predicted for all microneme proteins that have been sequenced to date suggesting that the biogenesis of these organelles is routed via the secretory pathway. Sequencing of the N-terminus of the mature native Etmic-2 protein has confirmed that for this microneme protein the signal peptide is cleaved, presumably as it enters the ER lumen. The predicted sequence of the N-terminal region has one difference to the directly determined sequence, a threonine (ACA) instead of an alanine (GCN). This is most likely to be because of a G to A nucleotide substitution at position 1 of the codon which may have arisen during the cloning of the 5’ region of the cDNA but careful scrutiny of the sequences of the two independent PCR products and of the two PCR-derived subclones, showed that an A was present in all four copies. The identified ORF predicts a mature polypeptide (minus the signal peptide) of just over 32 kDa, which is considerably smaller than the observed molecular mass of around 48-50 kDa seen on reducing polyacrylamide gels. Expression of the cDNA insert from pmic50.2 in E. coli also yielded a protein that migrated at a higher molecular mass than predicted (46 kDa was observed on SDS-PAGE compared to the prediction of 31 kDa for the fused bacterial product) so the aberrant mobility is unlikely to be due to eukaryotic specific post-translational modification such as glycosylation. The large number of termination codons in the 3’ sequence coupled with analysis of potential codon usage indicates that the given

4

”

E

D

s

E

E'A

ND

P

960

YGSASADLVTVKE GMCEADDPEL IALTRPHTSAAS P L TATGGCTCGGCATCAGCTGACCTTGTAACTGTCAAGGAGGAGGGCATGTGTGAGGCAGACGACCCAGAGTTGATCGCGCTGACTCGGCCTCATACATCGGCAGCTTCTCCGCTGCCTGCAGAG

1320 1440 1560 1680

1800

ACGARTGCATGCATTATTTTGGCATTTTCCCATTCGCGGAGCAGCGGCTTACAGGAGGATGACACGGCTTTCATTGTGCTTCATGACGCCCACTGTTACACACCTTCGCCATTGCTCTTT

TTGGAATTTGGGTGTCCGGCATTTTTTTGGCCACAC~CGCACTTCCTCACATCCACCCAGCCACATGTACACATGTACAC~CACATGC~CAC~CGTGCATTCACTGTG~GTT

GCCGTGTGGCAGCGCTCACGGGGGGAAGGTAGCGGGGGAAAGGCAGGCAGGTCCCCCGCAGCGGTAGATGCAGGTTTATTCTACGGCAGGTAGAGGTTGCAGCG~TGGGGGATTCGTTTGCTG

AGTAAATTTCATGCAGGTCAGTGCCTTACTAGAACATGAACCATATTTGGTGCCGGGTTGCGCATTTT

ACTTCGTGTTGCCAATGTTGCTTCCACATGGGTAACCTGGTTTGATGGGCATTTGAGTGGAATTGTTGCTACGCGTCGGTTCTTGTAGATGGCGCAGTTGCGTCTCGC~GCAGACTAT &fmc50.2 ACTTTAGGCTGCTGACCAGTTCGTGCAGTCCTGTAGATTTGTAGCTGTC~TAGTTCTTG~TCATGTAGCTTTG~CATCCCGCTCAGCCTCTTGC~GAGGGAT~GGGTTTGGCTGA

Fig. 6. Contiguous nucleotide sequence and ends of each clone are indicated by upward of the mature polypeptide is overlined. the residue is predicted to be a threonine from

1200

ESDTQQSS GAGAGTGACACTCAACAGTCATCCTGAAGGACTGCTTAAAGACGTGTCGCTTGCTTTGATGTTGGCTTCCGGAG

predicted ammo acid sequence of Elmic-L 7 derived from cDNA clones pmic50.2, pmic50.3, pmic50ex 1 and pmic50ex2. The arrowheads and the sequence complementary to the gene-specitic primer is boxed. The N-terminal amino acid sequence predicted signal peptide highlighted and the signal peptide cleavage site indicated by a downward arrow. The encircled the nucleotide sequence but was directly determined as an alanine.

1936

+.3'pflNCSO.3

1920

1080

EGDVAQDAQQS AGAQQEAEAQEVGEPQQEAAAAEQGSSAA GAAGGAGACGTAGCGCAGGACGCCCAGCAGAGCGCAGGAGCCCAGCAGG~GCAG~GCCCAGGAGGTTGGAG~CCCCAGCAGG~GCAGCTGCTGCAGAGC~GG~GCAGCGCTGCA

E

840

TDATTGKGSWKENSVVVGSS LSGRDLTVNLSDCGPSSLRV ACGGACGCTACAACTGGAAAGGGCTCTTGG~G~TTCCGTGGTCGTTGGCAGCTCCTTGAGCGGGCGCGACCTTACCGTG~CTTGAGCGACTGTGGACC~GCTCCCTCAGGGTT PA

720

ESEPTEVPLETAAG PTTPLMVL GAAAGCGAGCCTACGGAGGTTCCCCTAGAAACAGCAGCTGGTCCGTGTTCTTGCTTGGATATCT VRVLAWIS

600

KGEGGQE KPSVPL I A V R IHGSGG D KG ESAPQSAVLL Y G AAAGGGGAAGGTGGACAGGAGAAGCCGTCTGTACCGTCTGTACCCTTGATTGCTGTTCGCATCCATGGATCTGGCGGCGAC~GGGGAGAGCGCTCCGCAGTCGGCTGTTCTGCTTTACGG~TGAT ITQQNPKEVE

480

SAGWTKS CGGCCTGAGCGTGGATGAGACCATCAAAGTGACCAGCGCTGAGC SmicS0 2 mida 4b DETRKVVQLREs GASGPG E GAS PAPAEKPPSGQGS GACGAAACGCGCAAAGTTGTTCAGCTGAGAGAATCAGAAG~GGTGCATCCGGCGCCAGTGGCCCTGGACCCGCGCCAGCTG~GCCTCC~GTGGCC~GG~GCGCTGA~AGGCTCCT A

360

G

240

p

DEGNCGRLTVRNGLSVDETIKVT GATGAAGGTAACTGCGGCAGGCTGACGGTTCGT

... <*, I,.>::!.~

F S P E SGVLSGBDAPER RPIVPGL TCCCTTCCTCCMGCTCAGCCGTTAGGACGAGAGTCCCAGGCG~GATAGCTTCTCTCCTG~TCTGGCGTTCTCAGTGGGACAGATGCGCCGG~CGACGTCCCATCGTGCCTGGACTA

.. “‘.~~~~..~___,,.~_‘-.~~

:~~~~~~~~~~~~~~~~~~:~:l~~~~~~~~~~~~~~,:~

...........

_~,~,~~~~~~~:ls:~~~~~~~?~:~:.:.~~~~~~~~~~~~~.~~~ F L F V F T F K ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ IVWLLKSI FFPLLHCITS ATTGTTTGGCTTTTAAAAAGTATATTTTTTCCTTTGTTGCATTGCAT~CCTCATTTCTCTTTGTATTCACATTC~TGGCTCGAGCGTTGTCGCTGGTCGCTCTGGGCTTGCTTTTT 120

F.M.

204

Ehnic-2

Tm II

Tomley et al. 1 Molecular and Biochemical Parasitology 79 (1996) 195-206

PGEDSFSPESGVLSGTDAPERIVP 52 +EGV+ PER P P PGE 348 PGEPGAATEPGVEAPPAEPERIPI'PP 373 27

Etmic-2 106 SEGASGASGPGPAPAEKPPSGQGSAEEAPKGEG 138 P G +AE AP EG +EGA A G A Tm II 411 AEGAPPAEGAPAAEGAAPAEGAPAAEGAPPAEG 443 Ehnic-2

Tm II hnic-2 Tm II

175 ESEPTEVPLETAAGPTTP 192 E P PE AP P 442 EGAPAPAPAEGEAAPPAP 459 287 AASPLPAEEGDVAQDAQQSAGAQQEAEAQEVGE 319 +AA GE AA P PA EGD A 454 AAPPAPAAEGDAAAAPPPPPAEGEAAPAPAEGE 486

Fig. 7. Comparison of Etmic-2 with D. melanogaster tropomyosin II (Tm II). The four highest scoring regions from BLASTP alignments are given (identical residues are marked, similar residues denoted by a cross).

p1 of 4.2 for the mature polypeptide which is in good agreement with the observed p1 on two dimensional gels of 4.3. The protein is also rich in ORF is correct so the aberrant mobility is most likely to be due to inherent structural properties of the polypeptide. Apart from the signal peptide, there are no other strongly hydrophobic regions within the sequence suggestive of a classical transmembrane domain. This is in contrast to other microneme proteins which possess either a single membrane-spanning region or, in the case of malarial CSP, a covalently linked glycolipid anchor. The predicted protein is highly charged having almost 33% (by weight) charged residues and an overall predicted proline, alanine, glycine and serine and database searches revealed low level matches with a number of acidic, proline and alanine rich proteins and a series of four highly significant local similarities with a proline and alanine rich C-terminal domain found

in one of the spliced isoforms of tropomyosin II from Drosophila melanogaster [26]. The four blocks of homology are maintained in the same order along the gene maps but the spacing between blocks is different (Fig. 7). Of additional interest is the observation that two of the same blocks (residues 106-138 and 287-319) are contained within stretches of sequence that also have highly significant local similarities to regions of two proteins that are known substrates of the cellular regulatory enzyme protein kinase C (PKC) [27] (Fig. 8). These are a recently described rat neuronal axonal membrane protein NAP-22 [28] and the chicken sequence of myristolated, alanine-rich C kinase substrate (MARCKS) [29]. All of the local similarities were found using the local alignment algorithm of BLASTP version 1.3.11 [22].

4. Discussion

Etmic-2 is the second microneme protein of E. It is an acidic protein which migrated on reducing polyacrylamide gels at around 50 kDa although the predicted size of the polypeptide encoded by the cDNA was only around 32 kDa. The mRNA of around 1.9 kB was well represented in the sporozoite cDNA library, approximately 1 in 200 clones reacted with the raEtmic-2 serum and all of the clones that were followed up encoded the same cDNA. Although micronemal in origin, the protein was clearly translocated to the surface of the sporozoite and during invasion of host cells the protein was concentrated around the point of tenella to be cloned and characterized.

Marcks

139 KKEAGEGAESEGGAAAAAEGGKEEAAAAAPEAAGGEE 175 +E GA GAA + +A AP+ GG+E Efmic-2 105 ESEGASGASGPGPAPAEKPPSGQGSAEEAPKGEGGQE 141 EfA A+ AP +P +G+AEE P+ E NAP-2 269 EEKEADKAAAKEEAPKAEPEKSEGAAEEQPEPAPAPE 99

165 AAAPEAAGGEEGKAAAEEASAAAAGSREAAKEEAGDSQEAGDSQ~KSD~PE~TGEEAP~EEQQQQQQQE~E~G~TSE +A+ + + +EG A++ A +A+A ++ ++E A+E + QQ+ AAE+ Efmic-2 257 SASADLVTVXEGMCEADDPELIALTRPHTSAASPLPAEEGDVAQDAQQSAGAQQEAEAQEVGEPQQE~EQGSS~ESD TAA P EEG+ + +AG + +++A NAP-22 130 TGAADGAPQEEGEAKKTEAPAAGPEAXSDAAP

245

Mucks

Fig. 8. Comparison of the two myristolyated acidic rich C-kinase

highest scoring regions substrate. MARCKS.

of Etmic-2

with

the rat

neuronal

protein

NAP-22

+AA S+ 337 159

and

the chicken

F.M. Tomley et al. / Molecular and Biochemical Parasitology 79 (1996) 195-206

parasite entry, secreted into the extracellular milieu and transferred to the surface of the infected host cell where it stained in uneven patches. This association over the entire surface of the host cell occurred rapidly implying either that the protein is carried by the membrane flow as suggested for a secreted antigen of S. nzuris [13], or that the protein binds to some component of the host cell that is itself rapidly re-distributed over the entire surface. The association is transient, since by one hour post infection Etmic-2 could no longer be detected on the surface. The protein has a classical hydrophobic signal sequence which is cleaved, presumably within the ER, to yield a mature N-terminus which begins Val-Pro-Gly. How the protein is attached to the sporozoite surface and to the infected host cell surface is not clear since there is no classical hydrophobic transmembrane region and although there are some regions of the sequence which could possibly function as amphiphilic helices, these are not strongly predicted [30]. Short regions within Etmic-2 have highly significant local sequence similarities to a C-terminal domain of one of the isoforms of tropomyosin II from D. nzelanogaster. Four different isoforms of tropomyosin II are produced by use of tissue-specific promoters and alternative splicing and two of these isoforms (fusion proteins 33 and 34) have extended C-terminal domains which are acidic and rich in proline and alanine [26] and which are as yet of unknown function. Two of these short regions within Etmic-2 also have good local sequence similarities to two proteins, NAP-22 and MARCKS, that are known to be substrates of PKC. Both of these are acidic proteins which show aberrant mobility on SDS-PAGE gels and in common with Etmic-2 they both lack transmembrane regions yet can become transiently associated with cell membranes. MARCKS has a punctate distribution, co-localising with vinculin and talin on the adherent surface of macrophage pseudopodia and filopodia [31] and on phosphorylation with PKC, it is immediately lost from the membrane to the cytosol. Since phosphorylation also modulates the binding of MARCKS to calmodulin [32], it is proposed that phosphorylation-dependent regulation of MAR-

x5

CKS might locally modify the connection between cytoskeleton and membrane. Although there are significant differences between NAP-22, MARCKS and Etmic-2, including the lack of an N-terminal glycine available for myristoylation, the sequence and localisation similarities of the proteins suggest that phosphorylation should be investigated as a potential regulator for Etmic-2 localisation. The functional role of Etmic-2 is not known and, unlike the previously described E.tenella microneme protein Etmic-1 (EtplOO) [lo], it has no distinctive sequence motifs suggestive of potential ligand-binding interactions. However, the protein is abundant within the microneme and at the time of host cell invasion it is rapidly and copiously secreted onto the host cell surface which is strongly suggestive that it is important in the interaction between parasite and host.

Acknowledgements We thank Tricia Bland and Kate Powell for the electron micrograph and Pat Barker for the N-terminal amino acid sequencing.

References D. and Hadley, T.J. (1985) A Plasmodium jalciparum antigen that binds to host erythrocytes and merozoites. Science 230, 553-556. 121Sim, B.K.L.. Toyoshima. T., Haynes, J.D. and Aikawa. M. (1992) Localization of the 175-kilodalton erythrocyte binding antigen in micronemes of Plasmodium j&ipartrm merozoites. Mol. Biochem. Parasitol. 5 1, 157- 160. J.U.. Hudson, D.E.. Torii, M., Ward, G.E.. [31Adams, Wellems, T.E., Aikawa, M. and Miller, L.H. (1990) The Duffy receptor family of Plasmodium knowlesi is located within the micronemes of invasive malaria merozoites. Cell 63, 141-153. [41 Fang, X., Kaslow, D.C.. Adams, J.H. and Miller, L.H. (1991) Cloning of the Plasmodium viraz Duffy receptor. Mol. Biochem. Parasitol. 44, 1255132. J.L.. McCutchan, T.F.. Weber, [51Dame, J.B., Williams, J.L., Wirtz, R.A., Hockmeyer, W.T., Malay, W.L., Haynes. J.D., Schneider, 1.. Roberts. D.. Sanders. C.S., Reddy, E.P., Diggs. C.L. and Miller. L.H. (1984) Structure of the gene encoding the immunodominant surface antigen on the sporozoite of the human malaria parasite Plasmodium ,firlciparum. Science 225, 593 599.

111Camus,

206

Fl Fine, E., Aikawa,

FM.

Tomley

et al. / Molecular

and Biochemical

M., Cochrane, A.H. and Nussenzweig. RX (1984) Immuno-electron microscopic observations on Plasmodium knowlesi sporozoites: localisation of protective antigen and its precursors. Am. J. Trop. Med. Hyg. 33. 220-226. [71 Robson, K.J.H., Hall, J.R.S., Jennings, M.W.. Harris, T.J.R., Marsh, K.. Newbold, C.I., Tate, V.E. and Weatheral, D.J. (1988) A highly conserved amino-acid sequence in thrombospondin, properdin and in proteins from sporozoites and blood stages of a human malaria parasite. Nature 335, 79982. PI Hedstrom. R.C., Campbell, J.R., Leef, M.L., Charoenvit. Y., Carter, M., Sedegah. M., Beaudoin, R.L. and Hoffman, S.L. (1990) A malaria sporozoite surface antigen distinct from the circumsporozoite protein. Bull. WHO 68 (SuppI.), 1522157. K., [91 Rogers, W.O., Malik, A., Mellouk, S.. Nakamurd, Rogers, M.D., Szarfman, A.. Gordon, D.M.. Nussler, A.K., Aikawa, M. and Hoffman, S.L. (1992) Characterisation of Plasmodium ftilcipartrm sporozoite surface protein 2. Proc. Natl. Acad. Sci. USA 89, 91769180. UOI Tomley, F.M., Clarke, L.E.. Kawazoe, U.. Dijkema, R. and Kok, J.J. (1991) Sequence of the gene encoding an immunodominant microneme protein of Eimeriu tenella. Mol. Biochem. Parasitol. 49. 2777288. L.. Hug, D.. Humbelin, M. and Weber, G. [I’1 Pasamontes, (1993) Sequence of a major Eimeria maxima antigen homologous to the Eimeria tenella microneme protein EtplOO. Mol. Biochem. Parasitol. 57, 171~174. K.-H.. Klein, H.. Sommer, I., Meyer. [I21 Eschenbacher, H.E., Entzeroth, R., Mehlhorn. H. and Ruger, W. (1993) Characterization of cDNA clones encoding a major microneme antigen of Sarr~ocystis murk (Apicomplexa) cyst merozoites. Mol. Biochem. Parasitol. 62, 27-36. R.. Konig. A. and Dubremetz, J.F. (1992) [I31 Entzeroth, Microneme secretion in Coccidia: confocal laser scanning and electron microscopy of Sarcocystis murk Eur. J. Cell Biol. 59, 4055413. [I41 Kawazoe, U., Tomley, F.M. and Frazier J.A. (1992) Fractionation and antigenic characterization of organelles of Eimeria tenelk sporozoites. Parasitology 104. I-9. [I51 Long, P.L., Joyner. L.N., Millard, B.J. and Norton, C.C. (I 976) A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis Fol. Vet. Lat. 6, 201~ 217. [16] Schmatz, D.M., Crane. M. St. J. and Murray P.K. (1984) Purification of Eimeria sporozoites by DE-52 anion exchange chromatography. J. Protozool. 3 I, 181- 183. [17] McDonald, V., Rose, M.E. and Jeffers, T.K. (1986) Eimeria tenellu: immunogenicity of the first generation of schizogony. Parasitology 93, I-7. [IQ O’Farrell. P.H. (1975) High-resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250, 4007-

Parasitologql

79 (1996) 195-206

4021. of the computer handling ]191 Staden, R. (1982) Automation of gel reading data produced by the shotgun method of DNA sequencing. Nucleic Acids Res. 10, 473 l-475 I. [201 Jameson, B.A. and Wolf. H. (1988) The antigenic index: a novel algorithm for predicting antigenic determinants. CABBIES 4, 181-186. PII Pe, W.R. and Lipman, D.J. (1988) Improved tools for biological sequence comparison. Proc. Nat]. Acad. Sci. USA 85, 244442448. [12] Altschul, S.F., Gish, W., Miller. W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 4033410. W.. Gehring, M.R. and Fey, t231 Shiels, B.R., Northemann. G.H., (1987) Modified nuclear processing of alpha 1 acid glycoprotein RNA during inflammation. J. Biol. Chem. 262. 12826612831. v41 Kozak, M. (1987) An analysis of 5’-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 812558132. P51 von Heijne, G. (1986) A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14, 46834690. P6 Hanke. P.D. and Storti, R.V. (1988) The Drosophib melanogaster tropomyosin II gene produces multiple proteins by use of alternative tissue-specific promoters and alternative splicing. Mol. Cell. Biol. 8, 3581-3602. P71 Nishizuka, Y. (1984) Turnover of inositol phospholipids and signal transduction. Science 225. 136% 1370. VI Maekawa, S., Maekawa, M., Hattori, S. and Nakamura. S., (1993). Purification and molecular cloning of a novel acidic calmodulin-binding protein from rat brain. J. Biol. Chem. 268. 137033 13709. P. v91 Stumpo, D.J., Graff, J.M., Albert, K.A.. Greengard, and Blackshear. P.J. (1989). Molecular cloning, characterization and expression of a cDNA encoding the 80 kDa87 kDa myristoylated alanine-rich C-kinase substrate — a major cellular substrate for Protein kinase-C. Proc. Nat]. Acad. Sci. USA 86, 4012~4016. M. and Wall, R. [301 Eisenberg, D., Schwarz, E., Komaromy, (1984) Analysis of membrane and surface protein sequences with the hydrophobic moment plot. J. Mol. Biol. 179. 125-142. [311 Rosen, A., Keenan, K.F., Thelen, M., Nairn, A.C. and Aderem. A. (1990) Activation of protein kinase C results in the displacement of its myristoylated, alanine-rich substrate from punctate structures in macrophage filopodia. J. Exp. Med. 172, 1211-1215. [32j Graff, J.M., Young, T.M., Johnson, J.D. and Blackshear, P.J. (1989) Phosphorylation-regulated cdlmoduhn binding to a prominent cellular substrate for protein kinase C. J. Biol. Chem. 264, 21818&21823.