- Email: [email protected]
Endoderm-specific expression of the Drosophila mex1 gene
DEVELOPMENTAL
BIOLOGY
143,206211
(1991)
Endoderm-Specific Expression of the Drosophila mexl Gene ROBERTA. SCHULZ,*,' XIAOLING XIE,* ANDREWJ.ANDRES,~.~ANDSAMUELGALEWSKY* *Department
of Biochemistry
and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, TDepartment of Biology, Indiana University, Bloomington, Indiana 47405
Texas 77030; and
Accepted October 3, 1990 The Drosophila mexl gene is one of several genes clustered within a lo-kb interval of polytene region 71CD that includes the ecdysone-regulated Eip%+/29 gene. mexl is expressed in several developmental stages, with gene transcripts accumulating initially in 9- to 12-hr embryos. During embryogenesis, mexl exhibits an endoderm-specific pattern of expression. mexl transcripts are first detected in the anterior and posterior midgut primordia of stage 12 embryonic midgut. DNA sequence analyembryos; subsequently, mexl mRNA accumulates solely in the differentiating sis reveals that the mexl gene encodes an unusual cysteine-rich polypeptide. 8 1991 Academic press, IIK.
INTRODUCTION
rable and nonoverlapping with a sequence shown to be sufficient for the zygotic expression of the overlapping x600 gene (Schulz et ab, 1990b). Results described in Eickbush (198’7)suggest an even greater transcriptional complexity of the Eip28/29 gene region than that already demonstrated. SpecificaRy, this work identified as many as nine distinct transcripts expressed with varying developmental profiles in the -18 kb of DNA around the gene. In this report, we present an initial analysis of a gene located 3’ and adjacent to Eip28/29. Interestingly, this gene is expressed in cells of endoderm lineage in the embryo and encodes an unusual cysteine-rich polypeptide. The gene has been named mexl in accordance with its embryonic midgut expression.
For several years, we have investigated the organization, expression, and regulation of a cluster of genes mapping in polytene region ‘71CDof DrosophiEa chromosome 3. The interest in and access to this specific gene complex originate from the identification and characterization of the ecdysone-responsive Eip28/29 gene. Eip28/29 is regulated by ecdysone in Drosophila cell lines (Savakis et ah, 1984; Bieber, 1986) and in certain tissues during larval development (Andres, 1990). The nature of Eip28/29 regulation by ecdysone is currently under investigation; a goal of this work is to better understand the mechanisms of steroid hormone action in a genetically amenable system like DrosophiEa. The structure of the Eip28/29 gene and its transcripts has been described previously in some detail (Cherbas et MATERIALS AND METHODS al., 1986; Schulz et al, 1986). During the course of this work, it became obvious that the gene was part of a Flies were grown at 25°C on standard cornmeal-glutranscriptionally complex region (Schulz et al., 1989). At cose-yeast medium, containing Tegosept and suppleits 5’ end, Eip28/29 is overlapped by gonadal, a gene that mented with live yeast. Following two 1-hr prelays, emis differentially expressed in the male and female germ bryos were collected for Northern blot analysis over a lines due to alternative promoter usage (Schulz and 3-hr period from a large population of Oregon R flies. Butler, 1989; Schulz et al, 1990a). gonadal is overlapped The 0- to 3-hr embryos were extracted directly after at its 5’ end as well by x600, a gene that is expressed with collection, while later time intervals were obtained by characteristics comparable to certain zygotically exallowing the embryos to develop at 25°C prior to harpressed dorsal-ventral embryonic pattern genes (Schulz vesting. Unfertilized eggs were collected from -300 virand Miksch, 1989). All three genes are transcribed in the gin Oregon R flies over a period of 3 days. Total nucleic same direction and map within a 4.5kb DNA region. acid was isolated from the timed embryos using the Recently we have shown that the sequences required for SDS-proteinase K method and analyzed on a denaturgonadal male and female germ line expression are sepaing agarose gel as described previously (Schulz et al., 1989). The RNA blot was hybridized with 32P-labeled ‘To whom correspondence should be addressed. FAX (713) 791mexl or rp49 (O’Connell and Rosbash, 1984) cRNA 9478. probes followed by autoradiography. Embryos for in ’ Present address: Department of Human Genetics, University of situ hybridization analysis were obtained from y w67c23 Utah Medical Center, Salt Lake City, UT 84132.
0012-1606191 $3.00 Copyright All rights
0 1991 by Academic Press, Inc. of reproduction in any form reserved.
206
207
BRIEF NOTES
flies. Following two 1-hr prelays, embryos were collected over a 5-hr interval and aged for an additional 4 or 8 hr. Embryos were collected, embedded, and sectioned as described by Ingham et al. (1985). Hybridization of an 35S-labeled mexl cRNA probe to embryo sections was as described by Angerer et al. (1987). Embryos were staged using the convention of Campos-Ortega and Hartenstein (1985). rr~e,rl genomic DNA was obtained from pCglOl-I, a plasmid that contains 9 kb of the Eip28/2.9 gene region -including the entire gene, -2 kb of 5’-flanking sequence, and -5.5 kb of 3’-flanking sequence-inserted in pBR322 (Cherbas et al., 1986). DNAs subcloned into pBS (Stratagene) included a 3.0-kb BgZII fragment, a 0.9-kb &III fragment, and a 0.4-kb BgZII-Hind111 fragment, all of which represent 3’-flanking sequence relative to Eip2#/2S. Only the latter two fragments detected )ne.rl RNA on Northern blots when used as riboprobes; these two were then sequenced in their entirety using the dideoxy method (Sanger et (II., 1977). The orientation of the 0.9-kb BglII DNA relative to the direction of EipM/2Y transcription was initially based on sequence information provided by Lucy Cherbas (Indiana University); the orientation was subsequently confirmed through the sequencing of a ncexl cDNA. This cDNA was isolated from a male third instar larvae cDNA library constructed by Mitzi Kuroda and Steve Elledge (Baylor College of Medicine). Two mexl cDNAs were obtained in a screen of -120,000 phage using the 0.4-kb BglII-Hind111 genomic DNA as probe; one was sequenced using the dideoxy method. The cDNA was near full-length, missing 38 bp of 5’-nontranslated sequence. The structure of the mex15’ exon was determined in an RNase protection experiment (Melton et ul., 1984) using the 0.4-kb &III-Hind111 riboprobe and total RNA obtained from adult female flies. RESITLTS
AND
To further characterize the gene(s) 3’ of EipZ8/2.9, we used subclones of the flanking sequence as more specific probes. Beginning with the sequences closest to the 3’end of the Eip28/29 gene, the subcloned DNAs included 3.0-kb BgZII, 0.9-kb BgZII, and 0.4-kb BgZII-Hind111 fragments (Cherbas et ah, 1986). Only the latter two sequences detected a 0.95-kb transcript in the embryonic and adult RNAs assayed (data not shown). As will be discussed below, this RNA represents the transcript of the rnexl gene and is transcribed toward the Eip28/2.9 gene. To better define the early expression of mexl, we monitored RNA accumulation during embryogenesis. RNAs from unfertilized eggs and staged embryos (3-hr intervals) were assayed by Northern blot analysis using a 0.9-kb &III riboprobe (Fig. 1). The mexl RNA was not detected in unfertilized eggs or in the early embryonic stages tested. The meal transcript first appeared at about 9 to 12 hr of embryogenesis and accumulated at a fairly constant level throughout the remainder of this developmental period. To address the spatial distribution of the mexl RNA, we determined t,he localization of gene transcripts in embryo sections. The mexl RNA was undetectable during early embryonic development through the completion of germ band elongation. The transcript was first detected in stage 12 embryos during the shortening of
hours after egg deposition
., II
/
s’
-mexl
DISClJSSION
Using contiguous DNA probes derived from CS500, a recombinant phage containing -18 kb of DNA including the Ei@8/r)9 gene, Eickbush (1987) identified nine distinct transcripts expressed with various developmental profiles in the Eip.&‘/2!~ gene region. Several of these RNAs represent transcripts of the overlapping x600, go~adal, and Eipzx/2*9 genes (Cherbas et al., 1986; Schulz et (II., 1986; Schulz and Butler, 1989). Two new transcripts of -0.8 kb and -1.0 kb were detected using a 6.0-kb EcoRI probe corresponding to 3’-flanking sequence of the Eip38/~9 gene. The smaller RNA was detected solely in early embryos, while the larger RNA accumulated during embryonic, larval, and adult development.
-rp49
FIG. 1. Northern blot analysis of v/c’.r’IRNA, Total nucleic acids were isolatd from unfertilized eggs (IJF) anti 0- to :I-hr, :3- to Ghr. (ito %hr, 9- to 1%.hr, 12- to 15hr. 15 to l%hr, 1X- to 21.hr, and 21- to 24.hr embryos. Approximately 4 pg of material from each time interval was fractionated on an agarose-formalduhytle gel, transferred to nitrocellulosr, and then hybridized with a “2P-laheletl n/c’.r’~ cRNA probe. Following autoradiography, a 0.95lib RNA was dt~tecteti in mid and lak embryonic samples. The filter ~vas rcprohed with a 32P-IsIwleti rpi!/ cRNA probe to control for RNA loading (bottom).
208
BRIEF NOTES
the germ band (Figs. 2A and 2B). Two distinct areas of RNA accumulation, corresponding to the anterior and posterior midgut primordia, were observed. These two cell groups represent derivatives of the two endodermal anlagen described by Poulson (1950). During stage 12, these primordia move toward each other and eventually fuse along either side of the yolk sac. mexl RNA accumulation in this lateral band was observed in the stage 13 embryo shown in Figs. 2C and 2D. Subsequently, during stage 14, the midgut differentiates and closes ventrally while progressing dorsally. The mexl transcript was detected in the midgut in a pattern consistent with these morphogenetic events (Figs. 2E and 2F). By stage 15, the midgut has completely engulfed the yolk sac; the mexl hybridization pattern outlines the dorsally closed midgut in the sagittal (Figs. 2G and 2H) and horizontal (Figs. 21 and 25) embryo sections shown. Expression of the meal gene was restricted to the embryonic midgut in more advanced stages as well (data not. shown). mexl expression in the differentiating midgut is further highlighted in the transverse sections of the increasingly aged embryos shown in Fig. 3. After germ band shortening, transcripts were detected in two cell populations flanking the yolk sac (Figs. 3A and 3B). At this point, the midgut consists of two groups of epithelial cells open both dorsally and ventrally (Campos-Ortega and Hartenstein, 1985). In a stage 14 embryo, mexl RNA was distributed in a U-shaped pattern as the midgut cells stretched dorsally and ventrally (Figs. 3C and 3D). In a stage 15 embryo, the midgut epithelium has completely surrounded the yolk sac and mexl transcripts exhibit a corresponding circular distribution pattern (Figs. 3E and 3F). While the resolution of these localization experiments is insufficient to exclude mexl expression in the visceral mesoderm surrounding the endoderm in the midgut, the detection of mexl RNA in the anterior and posterior midgut primordia of stage 12 embryos argues strongly that the gene is expressed in cells of endoderm lineage in the embryo. The sequence of the mexl gene and its predicted translation product are presented in Fig. 4; the structure of the gene is illustrated in Fig. 5. Since both the 0.9-kb &III and 0.4-kb BgZII-Hind111 fragments hybridized to rnexl RNA on Northern blots, the two genomic DNAs were sequenced and shown to contain the complete mexl gene. The Hind111 site resides at position -54 relative to the start of transcription, one BglII site is
FIG. 3. Distribution of the mexl transcript during midgut differentiation. The results of the hybridization of an 35S-labeled merl cRNA probe to RNA in transverse sections of embryos undergoing dorsal closure are shown. (A, C, E) Bright-field photomicrographs of stage 13,14, and 15 embryos, respectively. The sections are oriented so that dorsal is up. (B, D, F) Corresponding dark-field photomicrographs that indicate the changing pattern of mexl RNA localization in the differentiating midgut. A few morphogenetic markers are identified in the sections and abbreviated as follows: mg, midgut; vc, ventral cord; yk, yolk sac.
present within the single 216-bp intron of the gene, and the other BqZII site resides 3’ of the site of RNA polyadenylation. The sequencing of a near full-length mexl cDNA indicated that the gene contained two exons and
FIG. 2. Distribution of the mexl transcript during mid embryogenesis. The results of the hybridization of an ““S-labeled cRNA probe to RNA in sections of -S- to 13-hr old embryos are shown. (A, C, E, G) Bright-field photomicrographs of sagittal sections through stage l&13,14, and 15 embryos, respectively. These sections are oriented so that anterior is to the left and dorsal is up. (I) Bright-field photomicrograph of a horizontal section through a stage 15 embryo, oriented so that anterior is to the left. (B, D, F, H, J) Corresponding dark-field photomicrographs that identify the midgut-restricted localization of the mexl transcript. Certain morphogenetic markers are identified in the sections and abbreviated as follows: am, anterior midgut primordia; fg, foregut; hg, hindgut; mg, midgut; ph, pharynx; pm, posterior midgut primordia.
210
DEVELOPMENTAL Hind III AAGCTTTCAATACC AGTTAATATTTTGTGTTGGT TCTATCTATAATAGAATAAC
VOLUME
BIOLOGY
TGTAGACCCCAAAATGCGGT CAACCACGCATCGGGAATCG CCAAAACCGTCATCACCATG M
CCTCAAATGTCCCGGCAAAG L K C P G TCATCATATACAAATATATA TCTGGATAAAGCCAATTTGG
TGGTTTGCTGGTAAGTTTCC K
ATTCAACCTGATTGAAATGA TTGCAGCTGCTGTTCCTGCG ]cQScA GATGGTCGTGGTGATCGGCT MVVVIGL CACGGATGAGGTGCAGAAGC TDEVQKQ CGACTACTTCAACAAGGAGT D Y F N K E ATAATAACTCCGTCGAAATC GACTTAATCTAATCGCGTCG GGGACTCAATTGAATGGGCA CAAAAAATGTGACTCACTGT ATTCACAATATATATTTAAT ATTGTACTGGATGACACACT AAAGTGGAAATAAAAGTAAG ****** AAATTTTTATATCTGAAATA TTCGTTATTGAAGTGTGAGA TTTTTTAAGATGAGGTTTAC TTCCTAGTTTTATGTACACC Bql GAAAAGTGTCCAAGATCT
V
v c CL CTATATATATATAAATTATA GAAATTTAGAAATGGGTATC
ACTAATTGAACTGATCTGAC CCTGCAAGATGCTCCTGAGC CKMLLS TGATTGTCTACTTCACGGTC IVY F T AGGTCGCCCAACTGACGCCC L T V A Q ACTGATCTGAGGACATGAAT Y END GAAATTGAAACGAACTAACA GATGCTCGTTATGGGATTTT ATTTGTGCGTTCTTTAGAAA ATACCTTACAATACATTTTG GTATAATATGTATGAATGTA ATAAACAAGACAATAAAACT TGTATCATGACTTAATAGCA ATCAAATTTTTTTTAGCTTG TATTCACTAATAAATATTTG CAGCAGGAAACCCCTCATTA ATTGTTTGGGATCAGGTAGC
V P
143,199l
CGATGACAGTTACCCGCTTC GAAATATACTGTACAGTATA TGCAACGCTCTCTGTGAATG QNALCEC ATCGGTTTCTGACTCACTAA
-1 +60 +120
TGTGAGAGCTCTTGACCAGC TTCAGTTATTCATATTCGGG Bql II AACAAGATCTTTCCATATCC ATCGTGTTTTCTGCGCTCCT IVFSALL TTCTATCACAAGGATAAGAA K D K F Y H ATTGTGAAGCGCAGCATACG IVKRSIR TTATACTATAGGCCATATTA
+240 +300
+180
+360 +420 +480 N +540 f600
ACCAAAGCCGTTCAGTGCAT TTCTTATCTATAGATAGTTT GGTAGATAATGTTGGAGCGG AACTCGAAACCCAGTAAAGC AGGCAGATTAAAAAAGTTAT AAAATATCTATAGAAAATTG TCTCTACATACTGGCTTTTA
+660 +720 +780 +840 +900 +960 +1020
(A) n GGGGAAAGAAATTAGAAAAC AGCTAGGGAAGTTCAAATAT CCACAGTCCTTCCAGCTGTT CTAGAACACCGTCGAGGGTT
+1080 +1140 +1200 +1260
II
FIG. 4. Nucleotide sequence of the werl gene. The figure was compiled hased on the sequencing of 1332 hp of genomic DNA and 752 bp of cDNA; the relevant restriction enzyme cleavage sites are indicated above the genomic sequence. Several features are highlighted throughout the sequence: Drosophiln cap site consensus sequence (underlined); meal intron sequences (closed brackets); putative polgadenylation signal (asterisks); RNA polyadenylation site ((Am). The predicted amino acid sequence of the merl gene product is given helow the DNA; the 10 cysteine residues in the N-terminal portion of the polypeptide are underlined.
placed the polyadenylation site at +1006 of the sequence. An RNase protection experiment (Fig. 5) placed the start of transcription within a consensus sequence shown to be present at or near the cap sites of several Drosoph!iZa, genes (Cherbas et al., 1986). These studies indicated that the mexl transcription unit was 1006 nt in length, 790 nt of which was present in the mature mRNA, and its 3’-end was located -4 kb downstream from that of the Eip%?/29 gene, with the two genes convergently transcribed. The mexl RNA contained a short open reading frame of 83 codons. Three comments can be made about the predicted mexl gene product. First, the N-terminal portion of the polypeptide was very rich in cysteine residues; 10 of the first 24 codons (42%) code for this amino acid. Second, a Kyte-Doolittle hydropathy plot (Kyte and Doolittle, 1982) revealed a strongly hydrophobic central domain of the protein (residues 26 through 51), while the C-terminal part was strongly hydrophilic, containing most of the predicted charged amino acid residues of the polypeptide. Third, we have been unable to detect any significant homologies between the mexl
sequence and proteins present in the available data banks. Thus the gene may encode a novel type of cysteine-rich protein. Future experiments on mexl will address the mechanisms controlling its endoderm-specific expression and its function in the midgut. Interestingly, mexl was first expressed at about 9 hr into development, just after ecdysone titers have peaked in the embryo (Maroy et al., 1988). Considering as well the presence of a known ecdysone-responsive gene in the region (Eip%3/29) and the mapping of two ecdysone-response elements within the 4 kb of sequence separating the Eip28/29 and mexl genes (L. Cherbas, K. Lee, and P. Cherbas, 1991), the direct or indirect regulation of mexl by ecdysone remains an intriguing possibility. Alternatively, mexl expression may be regulated by a segmentation and/or homeotic gene network (see Akam, 1987) required for the establishment of midgut cell identity, Recently, Immergliick and colleagues (Immergliick et al., 1990) described a genetic hierarchy controlling the regionalized expression of the labial gene in the endoderm. Regulation of mexl expression in the endoderm by this homeo-
BRIEF NOTES
FIG. 5. Structure of the rmxl gene. The two meal exons are illustrated as boxes while the shaded sequence corresponds to the 83 codon open reading frame of the mRNA; the arrow above the first exon denotes the direction of transcription. H and B are abbreviations for the Hi?/dIII and Bq111 restriction enzyme cleavage sites, respectively. A 403-nt Hi?~dIII~BglII riboprobe was used to map the n,~.r1 5’ exon and transcription start site in an RNase protection experiment. The probe was hybridized with either 20 bg of tRNA (insert, lane 1) or 20 pg of total RNA from adult female flies (insert, lane 2). A predominant RNase-resistant fragment of -150 nt was detected using the adult female RNA.
tic gene remains to be investigated. As for functional analysis, an extensive screen for lethal mutations mapping in the ‘71CD region has been completed (H. Irick, personal communication). Transformation rescue experiments using mexl sequences may allow the identification of a mexl mutant complementation group. Subsequent phenotype analysis should provide insight into mexl function in Drosophila morphogenesis and development. We are grateful to Jennifer Miksch for technical assistance, Lucy Cherbas for sharing preliminary nae~l genomic sequence information, Teresa Joseph for preparing embryo sections, and Mitzi Kuroda for providing the Drosophila male third instar larvae cDNA library. This research was supported by a grant to R.A.S. from the National Science Foundation (DCB:87-09846); S.G. was supported ny a National Institutes of Health postdoctoral training grant (HD-07325).
REFERENCES AKAM, M. (1987). The molecular basis for metameric pattern in the Drosoph il(r embryo. Derdopme~~t 101, I-22. ANDRE& A. J. (1990). An analysis of the temporal and spatial patterns of expression of the ecdysone-inducible genes E~@x/~Y and Eip& during development of Droso$!i/o meltrnqqustPr. Ph.D. thesis, Indiana University. ANGERER, L. M., Cox, K. H., and ANGERER, R. C. (1987). Demonstration of tissue-specific gene expression by in situ hybridization. hr “Methods in Enzymology” (S. P. Colowick rt (rl. Eds.), Vol. 152, pp. 649-661. Academic Press, San Diego. BIEBER, A. J. (1986). Ecdgsteroid inducible polypeptides in Droso$iltr
211
Kc cells: Kinetics of mRNA induction and aspects of protein structure. Ph.D. thesis, Harvard University. CAMPOS-ORTEGA, J. A., and HARTENSTEIN, V. (1985). “The Embryonic Development of Drosophilu rnelunoguster.” Springer-Verlag, Berlin. CHERBAS, L., LEE, K., and CHERBAS, P. (1991). Identification of ecdysone response elements by analysis of the Drosophila Eip?#/~!, gene. Gerles Dep., in press. CHERBAS, L., SCHULZ, R. A., KOEHLER, M. M. D., SAVAKIS, C., and CHERBAS, P. (1986). Structure of the EipZX/dS gene, an ecdysone-inducible gene from Drosophila J. Mol. Bid. 189, 617-631. EICKBUSH, D. (1987). Molecular characterization of the 71CE region of Drosophilu wzkmogtr.ster. Ph.D. thesis, Harvard University. IMMERGL~CK, K., LAWRENCE, P. A., and BIENZ, M. (1990). Induction across germ layers in Drosophila mediated by a genetic cascade. O# 62,261-268. INGHAM, P., HOWARD, K. R., and ISH-HOROWITZ, D. (1985). Transcription pattern of the L)rosoplriltr segmentation gene Irctir’y. Ncrfurc, (Lonth) 318, 439-445. KYTE, J., and DOOLITTLE, R. (1982). A simple method for displaying the hydropathic character of a protein. J. B&l. C/let/l. 157, 105-132. MAROY, P., KAUFMANN, G., and DUBENDORFER, A. (1988). Embryonic ecdysteroids of Drosoph ilrr ,,r(~la,/(?(~(~stf’r..I. Z?/wcf Phqsiol. 34, 633637. MELTON, D. A., KRIEG, P. A., REBAGLIATI, M. R., MANIATIS, T., ZINN, K., and GREEN, M. R. (19843. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SPti promoter. h’lcclric ;Icitls &s. 12, 70357056. O’CONNELL, P., and ROSBASH, M. (1984). Sequence, structure, and codon preference of the Drosophilu ribosomal protein 49 gene. X;rrc/c,ic Acids Rrs., 12, 5495-5511. ..11 POULSON, D. F. (1950). Histogenesis, organogenesis, and differentiation in the embryo of Drosophiltr n,c,lrr?rcyclsfrr (Meigen). ZI( “Biology of Drosophila” (M. Demerec, Ed.), pp. 168-274. Wiley, New York. SANGER, F., NICKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Z’roc. Not/. ilcutl. Sci. GSA 74, 5461-5467. < c SAVAKIS, C., KOEHLER, M. M. D., and CHERBAS, P. (1984). cDNA clones for the ecdysone-inducible polypeptides (EIP) mRNAs of Uroso& i/u Kc cells. fi;lvBO ,I. 3, 235243. SCHULZ, R. A., and BUTLER, 8. A. (1989). Overlapping genes of Drtwphiltr r,cr/tr?/c?cltr.s~~,~,: Organization of the 2600-!lol/(Idu(~EiJ/IR/,,!, pene cluster. C;c~nc+s Upl? 3, 2X-242. SCHULZ, R. A., CHERBAS, L., and CHERBAS, P. (1986). Alternative splicing generates two distinct Eil)&/d!/ gent transcripts in ZIrosophiln Kc cells. Z-‘roc,. A’uftrtl.Acud. Sri. UX4 83, 9428-9432. SCHULZ, R. A., and MIKSCH, J. L. (1989). Dorsal expression of the Drrp .sol,hilu z(iliO gene during early embryogenesis. Lkc Bid. 136, 211221. SCHULZ, R. A., MIKSCH, J. L., XIE, X., CORNISH, J. A., and GALEWSKY, S. (1990a). Expression of the Z1rosol/hlltr gmrtrrln[ gene: Alternative promoters control the germ-line expression of monocistronic and bicistronic gene transcripts. Dnvlopwrnf 108, 613-622. SCHULZ, R. A., SHLOMCHIK, W., CHERBAS, L., and CHERBAS, P. (1989). Diverse expression of overlapping genes: The Drosophilu Eip#/l’!/ gene and its upstream neighbors. ZX>c,.Biol. 131, 515-523. SCHULZ, R. A., XIE, X., and MIKSCH, J. L. (1990b). cis-Acting sequences required for the germ line expression of the ZJrosoph iln got/c&/ gene. L)cJI,.Biol. 140, 455-458.
BIOLOGY
143,206211
(1991)
Endoderm-Specific Expression of the Drosophila mexl Gene ROBERTA. SCHULZ,*,' XIAOLING XIE,* ANDREWJ.ANDRES,~.~ANDSAMUELGALEWSKY* *Department
of Biochemistry
and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, TDepartment of Biology, Indiana University, Bloomington, Indiana 47405
Texas 77030; and
Accepted October 3, 1990 The Drosophila mexl gene is one of several genes clustered within a lo-kb interval of polytene region 71CD that includes the ecdysone-regulated Eip%+/29 gene. mexl is expressed in several developmental stages, with gene transcripts accumulating initially in 9- to 12-hr embryos. During embryogenesis, mexl exhibits an endoderm-specific pattern of expression. mexl transcripts are first detected in the anterior and posterior midgut primordia of stage 12 embryonic midgut. DNA sequence analyembryos; subsequently, mexl mRNA accumulates solely in the differentiating sis reveals that the mexl gene encodes an unusual cysteine-rich polypeptide. 8 1991 Academic press, IIK.
INTRODUCTION
rable and nonoverlapping with a sequence shown to be sufficient for the zygotic expression of the overlapping x600 gene (Schulz et ab, 1990b). Results described in Eickbush (198’7)suggest an even greater transcriptional complexity of the Eip28/29 gene region than that already demonstrated. SpecificaRy, this work identified as many as nine distinct transcripts expressed with varying developmental profiles in the -18 kb of DNA around the gene. In this report, we present an initial analysis of a gene located 3’ and adjacent to Eip28/29. Interestingly, this gene is expressed in cells of endoderm lineage in the embryo and encodes an unusual cysteine-rich polypeptide. The gene has been named mexl in accordance with its embryonic midgut expression.
For several years, we have investigated the organization, expression, and regulation of a cluster of genes mapping in polytene region ‘71CDof DrosophiEa chromosome 3. The interest in and access to this specific gene complex originate from the identification and characterization of the ecdysone-responsive Eip28/29 gene. Eip28/29 is regulated by ecdysone in Drosophila cell lines (Savakis et ah, 1984; Bieber, 1986) and in certain tissues during larval development (Andres, 1990). The nature of Eip28/29 regulation by ecdysone is currently under investigation; a goal of this work is to better understand the mechanisms of steroid hormone action in a genetically amenable system like DrosophiEa. The structure of the Eip28/29 gene and its transcripts has been described previously in some detail (Cherbas et MATERIALS AND METHODS al., 1986; Schulz et al, 1986). During the course of this work, it became obvious that the gene was part of a Flies were grown at 25°C on standard cornmeal-glutranscriptionally complex region (Schulz et al., 1989). At cose-yeast medium, containing Tegosept and suppleits 5’ end, Eip28/29 is overlapped by gonadal, a gene that mented with live yeast. Following two 1-hr prelays, emis differentially expressed in the male and female germ bryos were collected for Northern blot analysis over a lines due to alternative promoter usage (Schulz and 3-hr period from a large population of Oregon R flies. Butler, 1989; Schulz et al, 1990a). gonadal is overlapped The 0- to 3-hr embryos were extracted directly after at its 5’ end as well by x600, a gene that is expressed with collection, while later time intervals were obtained by characteristics comparable to certain zygotically exallowing the embryos to develop at 25°C prior to harpressed dorsal-ventral embryonic pattern genes (Schulz vesting. Unfertilized eggs were collected from -300 virand Miksch, 1989). All three genes are transcribed in the gin Oregon R flies over a period of 3 days. Total nucleic same direction and map within a 4.5kb DNA region. acid was isolated from the timed embryos using the Recently we have shown that the sequences required for SDS-proteinase K method and analyzed on a denaturgonadal male and female germ line expression are sepaing agarose gel as described previously (Schulz et al., 1989). The RNA blot was hybridized with 32P-labeled ‘To whom correspondence should be addressed. FAX (713) 791mexl or rp49 (O’Connell and Rosbash, 1984) cRNA 9478. probes followed by autoradiography. Embryos for in ’ Present address: Department of Human Genetics, University of situ hybridization analysis were obtained from y w67c23 Utah Medical Center, Salt Lake City, UT 84132.
0012-1606191 $3.00 Copyright All rights
0 1991 by Academic Press, Inc. of reproduction in any form reserved.
206
207
BRIEF NOTES
flies. Following two 1-hr prelays, embryos were collected over a 5-hr interval and aged for an additional 4 or 8 hr. Embryos were collected, embedded, and sectioned as described by Ingham et al. (1985). Hybridization of an 35S-labeled mexl cRNA probe to embryo sections was as described by Angerer et al. (1987). Embryos were staged using the convention of Campos-Ortega and Hartenstein (1985). rr~e,rl genomic DNA was obtained from pCglOl-I, a plasmid that contains 9 kb of the Eip28/2.9 gene region -including the entire gene, -2 kb of 5’-flanking sequence, and -5.5 kb of 3’-flanking sequence-inserted in pBR322 (Cherbas et al., 1986). DNAs subcloned into pBS (Stratagene) included a 3.0-kb BgZII fragment, a 0.9-kb &III fragment, and a 0.4-kb BgZII-Hind111 fragment, all of which represent 3’-flanking sequence relative to Eip2#/2S. Only the latter two fragments detected )ne.rl RNA on Northern blots when used as riboprobes; these two were then sequenced in their entirety using the dideoxy method (Sanger et (II., 1977). The orientation of the 0.9-kb BglII DNA relative to the direction of EipM/2Y transcription was initially based on sequence information provided by Lucy Cherbas (Indiana University); the orientation was subsequently confirmed through the sequencing of a ncexl cDNA. This cDNA was isolated from a male third instar larvae cDNA library constructed by Mitzi Kuroda and Steve Elledge (Baylor College of Medicine). Two mexl cDNAs were obtained in a screen of -120,000 phage using the 0.4-kb BglII-Hind111 genomic DNA as probe; one was sequenced using the dideoxy method. The cDNA was near full-length, missing 38 bp of 5’-nontranslated sequence. The structure of the mex15’ exon was determined in an RNase protection experiment (Melton et ul., 1984) using the 0.4-kb &III-Hind111 riboprobe and total RNA obtained from adult female flies. RESITLTS
AND
To further characterize the gene(s) 3’ of EipZ8/2.9, we used subclones of the flanking sequence as more specific probes. Beginning with the sequences closest to the 3’end of the Eip28/29 gene, the subcloned DNAs included 3.0-kb BgZII, 0.9-kb BgZII, and 0.4-kb BgZII-Hind111 fragments (Cherbas et ah, 1986). Only the latter two sequences detected a 0.95-kb transcript in the embryonic and adult RNAs assayed (data not shown). As will be discussed below, this RNA represents the transcript of the rnexl gene and is transcribed toward the Eip28/2.9 gene. To better define the early expression of mexl, we monitored RNA accumulation during embryogenesis. RNAs from unfertilized eggs and staged embryos (3-hr intervals) were assayed by Northern blot analysis using a 0.9-kb &III riboprobe (Fig. 1). The mexl RNA was not detected in unfertilized eggs or in the early embryonic stages tested. The meal transcript first appeared at about 9 to 12 hr of embryogenesis and accumulated at a fairly constant level throughout the remainder of this developmental period. To address the spatial distribution of the mexl RNA, we determined t,he localization of gene transcripts in embryo sections. The mexl RNA was undetectable during early embryonic development through the completion of germ band elongation. The transcript was first detected in stage 12 embryos during the shortening of
hours after egg deposition
., II
/
s’
-mexl
DISClJSSION
Using contiguous DNA probes derived from CS500, a recombinant phage containing -18 kb of DNA including the Ei@8/r)9 gene, Eickbush (1987) identified nine distinct transcripts expressed with various developmental profiles in the Eip.&‘/2!~ gene region. Several of these RNAs represent transcripts of the overlapping x600, go~adal, and Eipzx/2*9 genes (Cherbas et al., 1986; Schulz et (II., 1986; Schulz and Butler, 1989). Two new transcripts of -0.8 kb and -1.0 kb were detected using a 6.0-kb EcoRI probe corresponding to 3’-flanking sequence of the Eip38/~9 gene. The smaller RNA was detected solely in early embryos, while the larger RNA accumulated during embryonic, larval, and adult development.
-rp49
FIG. 1. Northern blot analysis of v/c’.r’IRNA, Total nucleic acids were isolatd from unfertilized eggs (IJF) anti 0- to :I-hr, :3- to Ghr. (ito %hr, 9- to 1%.hr, 12- to 15hr. 15 to l%hr, 1X- to 21.hr, and 21- to 24.hr embryos. Approximately 4 pg of material from each time interval was fractionated on an agarose-formalduhytle gel, transferred to nitrocellulosr, and then hybridized with a “2P-laheletl n/c’.r’~ cRNA probe. Following autoradiography, a 0.95lib RNA was dt~tecteti in mid and lak embryonic samples. The filter ~vas rcprohed with a 32P-IsIwleti rpi!/ cRNA probe to control for RNA loading (bottom).
208
BRIEF NOTES
the germ band (Figs. 2A and 2B). Two distinct areas of RNA accumulation, corresponding to the anterior and posterior midgut primordia, were observed. These two cell groups represent derivatives of the two endodermal anlagen described by Poulson (1950). During stage 12, these primordia move toward each other and eventually fuse along either side of the yolk sac. mexl RNA accumulation in this lateral band was observed in the stage 13 embryo shown in Figs. 2C and 2D. Subsequently, during stage 14, the midgut differentiates and closes ventrally while progressing dorsally. The mexl transcript was detected in the midgut in a pattern consistent with these morphogenetic events (Figs. 2E and 2F). By stage 15, the midgut has completely engulfed the yolk sac; the mexl hybridization pattern outlines the dorsally closed midgut in the sagittal (Figs. 2G and 2H) and horizontal (Figs. 21 and 25) embryo sections shown. Expression of the meal gene was restricted to the embryonic midgut in more advanced stages as well (data not. shown). mexl expression in the differentiating midgut is further highlighted in the transverse sections of the increasingly aged embryos shown in Fig. 3. After germ band shortening, transcripts were detected in two cell populations flanking the yolk sac (Figs. 3A and 3B). At this point, the midgut consists of two groups of epithelial cells open both dorsally and ventrally (Campos-Ortega and Hartenstein, 1985). In a stage 14 embryo, mexl RNA was distributed in a U-shaped pattern as the midgut cells stretched dorsally and ventrally (Figs. 3C and 3D). In a stage 15 embryo, the midgut epithelium has completely surrounded the yolk sac and mexl transcripts exhibit a corresponding circular distribution pattern (Figs. 3E and 3F). While the resolution of these localization experiments is insufficient to exclude mexl expression in the visceral mesoderm surrounding the endoderm in the midgut, the detection of mexl RNA in the anterior and posterior midgut primordia of stage 12 embryos argues strongly that the gene is expressed in cells of endoderm lineage in the embryo. The sequence of the mexl gene and its predicted translation product are presented in Fig. 4; the structure of the gene is illustrated in Fig. 5. Since both the 0.9-kb &III and 0.4-kb BgZII-Hind111 fragments hybridized to rnexl RNA on Northern blots, the two genomic DNAs were sequenced and shown to contain the complete mexl gene. The Hind111 site resides at position -54 relative to the start of transcription, one BglII site is
FIG. 3. Distribution of the mexl transcript during midgut differentiation. The results of the hybridization of an 35S-labeled merl cRNA probe to RNA in transverse sections of embryos undergoing dorsal closure are shown. (A, C, E) Bright-field photomicrographs of stage 13,14, and 15 embryos, respectively. The sections are oriented so that dorsal is up. (B, D, F) Corresponding dark-field photomicrographs that indicate the changing pattern of mexl RNA localization in the differentiating midgut. A few morphogenetic markers are identified in the sections and abbreviated as follows: mg, midgut; vc, ventral cord; yk, yolk sac.
present within the single 216-bp intron of the gene, and the other BqZII site resides 3’ of the site of RNA polyadenylation. The sequencing of a near full-length mexl cDNA indicated that the gene contained two exons and
FIG. 2. Distribution of the mexl transcript during mid embryogenesis. The results of the hybridization of an ““S-labeled cRNA probe to RNA in sections of -S- to 13-hr old embryos are shown. (A, C, E, G) Bright-field photomicrographs of sagittal sections through stage l&13,14, and 15 embryos, respectively. These sections are oriented so that anterior is to the left and dorsal is up. (I) Bright-field photomicrograph of a horizontal section through a stage 15 embryo, oriented so that anterior is to the left. (B, D, F, H, J) Corresponding dark-field photomicrographs that identify the midgut-restricted localization of the mexl transcript. Certain morphogenetic markers are identified in the sections and abbreviated as follows: am, anterior midgut primordia; fg, foregut; hg, hindgut; mg, midgut; ph, pharynx; pm, posterior midgut primordia.
210
DEVELOPMENTAL Hind III AAGCTTTCAATACC AGTTAATATTTTGTGTTGGT TCTATCTATAATAGAATAAC
VOLUME
BIOLOGY
TGTAGACCCCAAAATGCGGT CAACCACGCATCGGGAATCG CCAAAACCGTCATCACCATG M
CCTCAAATGTCCCGGCAAAG L K C P G TCATCATATACAAATATATA TCTGGATAAAGCCAATTTGG
TGGTTTGCTGGTAAGTTTCC K
ATTCAACCTGATTGAAATGA TTGCAGCTGCTGTTCCTGCG ]cQScA GATGGTCGTGGTGATCGGCT MVVVIGL CACGGATGAGGTGCAGAAGC TDEVQKQ CGACTACTTCAACAAGGAGT D Y F N K E ATAATAACTCCGTCGAAATC GACTTAATCTAATCGCGTCG GGGACTCAATTGAATGGGCA CAAAAAATGTGACTCACTGT ATTCACAATATATATTTAAT ATTGTACTGGATGACACACT AAAGTGGAAATAAAAGTAAG ****** AAATTTTTATATCTGAAATA TTCGTTATTGAAGTGTGAGA TTTTTTAAGATGAGGTTTAC TTCCTAGTTTTATGTACACC Bql GAAAAGTGTCCAAGATCT
V
v c CL CTATATATATATAAATTATA GAAATTTAGAAATGGGTATC
ACTAATTGAACTGATCTGAC CCTGCAAGATGCTCCTGAGC CKMLLS TGATTGTCTACTTCACGGTC IVY F T AGGTCGCCCAACTGACGCCC L T V A Q ACTGATCTGAGGACATGAAT Y END GAAATTGAAACGAACTAACA GATGCTCGTTATGGGATTTT ATTTGTGCGTTCTTTAGAAA ATACCTTACAATACATTTTG GTATAATATGTATGAATGTA ATAAACAAGACAATAAAACT TGTATCATGACTTAATAGCA ATCAAATTTTTTTTAGCTTG TATTCACTAATAAATATTTG CAGCAGGAAACCCCTCATTA ATTGTTTGGGATCAGGTAGC
V P
143,199l
CGATGACAGTTACCCGCTTC GAAATATACTGTACAGTATA TGCAACGCTCTCTGTGAATG QNALCEC ATCGGTTTCTGACTCACTAA
-1 +60 +120
TGTGAGAGCTCTTGACCAGC TTCAGTTATTCATATTCGGG Bql II AACAAGATCTTTCCATATCC ATCGTGTTTTCTGCGCTCCT IVFSALL TTCTATCACAAGGATAAGAA K D K F Y H ATTGTGAAGCGCAGCATACG IVKRSIR TTATACTATAGGCCATATTA
+240 +300
+180
+360 +420 +480 N +540 f600
ACCAAAGCCGTTCAGTGCAT TTCTTATCTATAGATAGTTT GGTAGATAATGTTGGAGCGG AACTCGAAACCCAGTAAAGC AGGCAGATTAAAAAAGTTAT AAAATATCTATAGAAAATTG TCTCTACATACTGGCTTTTA
+660 +720 +780 +840 +900 +960 +1020
(A) n GGGGAAAGAAATTAGAAAAC AGCTAGGGAAGTTCAAATAT CCACAGTCCTTCCAGCTGTT CTAGAACACCGTCGAGGGTT
+1080 +1140 +1200 +1260
II
FIG. 4. Nucleotide sequence of the werl gene. The figure was compiled hased on the sequencing of 1332 hp of genomic DNA and 752 bp of cDNA; the relevant restriction enzyme cleavage sites are indicated above the genomic sequence. Several features are highlighted throughout the sequence: Drosophiln cap site consensus sequence (underlined); meal intron sequences (closed brackets); putative polgadenylation signal (asterisks); RNA polyadenylation site ((Am). The predicted amino acid sequence of the merl gene product is given helow the DNA; the 10 cysteine residues in the N-terminal portion of the polypeptide are underlined.
placed the polyadenylation site at +1006 of the sequence. An RNase protection experiment (Fig. 5) placed the start of transcription within a consensus sequence shown to be present at or near the cap sites of several Drosoph!iZa, genes (Cherbas et al., 1986). These studies indicated that the mexl transcription unit was 1006 nt in length, 790 nt of which was present in the mature mRNA, and its 3’-end was located -4 kb downstream from that of the Eip%?/29 gene, with the two genes convergently transcribed. The mexl RNA contained a short open reading frame of 83 codons. Three comments can be made about the predicted mexl gene product. First, the N-terminal portion of the polypeptide was very rich in cysteine residues; 10 of the first 24 codons (42%) code for this amino acid. Second, a Kyte-Doolittle hydropathy plot (Kyte and Doolittle, 1982) revealed a strongly hydrophobic central domain of the protein (residues 26 through 51), while the C-terminal part was strongly hydrophilic, containing most of the predicted charged amino acid residues of the polypeptide. Third, we have been unable to detect any significant homologies between the mexl
sequence and proteins present in the available data banks. Thus the gene may encode a novel type of cysteine-rich protein. Future experiments on mexl will address the mechanisms controlling its endoderm-specific expression and its function in the midgut. Interestingly, mexl was first expressed at about 9 hr into development, just after ecdysone titers have peaked in the embryo (Maroy et al., 1988). Considering as well the presence of a known ecdysone-responsive gene in the region (Eip%3/29) and the mapping of two ecdysone-response elements within the 4 kb of sequence separating the Eip28/29 and mexl genes (L. Cherbas, K. Lee, and P. Cherbas, 1991), the direct or indirect regulation of mexl by ecdysone remains an intriguing possibility. Alternatively, mexl expression may be regulated by a segmentation and/or homeotic gene network (see Akam, 1987) required for the establishment of midgut cell identity, Recently, Immergliick and colleagues (Immergliick et al., 1990) described a genetic hierarchy controlling the regionalized expression of the labial gene in the endoderm. Regulation of mexl expression in the endoderm by this homeo-
BRIEF NOTES
FIG. 5. Structure of the rmxl gene. The two meal exons are illustrated as boxes while the shaded sequence corresponds to the 83 codon open reading frame of the mRNA; the arrow above the first exon denotes the direction of transcription. H and B are abbreviations for the Hi?/dIII and Bq111 restriction enzyme cleavage sites, respectively. A 403-nt Hi?~dIII~BglII riboprobe was used to map the n,~.r1 5’ exon and transcription start site in an RNase protection experiment. The probe was hybridized with either 20 bg of tRNA (insert, lane 1) or 20 pg of total RNA from adult female flies (insert, lane 2). A predominant RNase-resistant fragment of -150 nt was detected using the adult female RNA.
tic gene remains to be investigated. As for functional analysis, an extensive screen for lethal mutations mapping in the ‘71CD region has been completed (H. Irick, personal communication). Transformation rescue experiments using mexl sequences may allow the identification of a mexl mutant complementation group. Subsequent phenotype analysis should provide insight into mexl function in Drosophila morphogenesis and development. We are grateful to Jennifer Miksch for technical assistance, Lucy Cherbas for sharing preliminary nae~l genomic sequence information, Teresa Joseph for preparing embryo sections, and Mitzi Kuroda for providing the Drosophila male third instar larvae cDNA library. This research was supported by a grant to R.A.S. from the National Science Foundation (DCB:87-09846); S.G. was supported ny a National Institutes of Health postdoctoral training grant (HD-07325).
REFERENCES AKAM, M. (1987). The molecular basis for metameric pattern in the Drosoph il(r embryo. Derdopme~~t 101, I-22. ANDRE& A. J. (1990). An analysis of the temporal and spatial patterns of expression of the ecdysone-inducible genes E~@x/~Y and Eip& during development of Droso$!i/o meltrnqqustPr. Ph.D. thesis, Indiana University. ANGERER, L. M., Cox, K. H., and ANGERER, R. C. (1987). Demonstration of tissue-specific gene expression by in situ hybridization. hr “Methods in Enzymology” (S. P. Colowick rt (rl. Eds.), Vol. 152, pp. 649-661. Academic Press, San Diego. BIEBER, A. J. (1986). Ecdgsteroid inducible polypeptides in Droso$iltr
211
Kc cells: Kinetics of mRNA induction and aspects of protein structure. Ph.D. thesis, Harvard University. CAMPOS-ORTEGA, J. A., and HARTENSTEIN, V. (1985). “The Embryonic Development of Drosophilu rnelunoguster.” Springer-Verlag, Berlin. CHERBAS, L., LEE, K., and CHERBAS, P. (1991). Identification of ecdysone response elements by analysis of the Drosophila Eip?#/~!, gene. Gerles Dep., in press. CHERBAS, L., SCHULZ, R. A., KOEHLER, M. M. D., SAVAKIS, C., and CHERBAS, P. (1986). Structure of the EipZX/dS gene, an ecdysone-inducible gene from Drosophila J. Mol. Bid. 189, 617-631. EICKBUSH, D. (1987). Molecular characterization of the 71CE region of Drosophilu wzkmogtr.ster. Ph.D. thesis, Harvard University. IMMERGL~CK, K., LAWRENCE, P. A., and BIENZ, M. (1990). Induction across germ layers in Drosophila mediated by a genetic cascade. O# 62,261-268. INGHAM, P., HOWARD, K. R., and ISH-HOROWITZ, D. (1985). Transcription pattern of the L)rosoplriltr segmentation gene Irctir’y. Ncrfurc, (Lonth) 318, 439-445. KYTE, J., and DOOLITTLE, R. (1982). A simple method for displaying the hydropathic character of a protein. J. B&l. C/let/l. 157, 105-132. MAROY, P., KAUFMANN, G., and DUBENDORFER, A. (1988). Embryonic ecdysteroids of Drosoph ilrr ,,r(~la,/(?(~(~stf’r..I. Z?/wcf Phqsiol. 34, 633637. MELTON, D. A., KRIEG, P. A., REBAGLIATI, M. R., MANIATIS, T., ZINN, K., and GREEN, M. R. (19843. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SPti promoter. h’lcclric ;Icitls &s. 12, 70357056. O’CONNELL, P., and ROSBASH, M. (1984). Sequence, structure, and codon preference of the Drosophilu ribosomal protein 49 gene. X;rrc/c,ic Acids Rrs., 12, 5495-5511. ..11 POULSON, D. F. (1950). Histogenesis, organogenesis, and differentiation in the embryo of Drosophiltr n,c,lrr?rcyclsfrr (Meigen). ZI( “Biology of Drosophila” (M. Demerec, Ed.), pp. 168-274. Wiley, New York. SANGER, F., NICKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Z’roc. Not/. ilcutl. Sci. GSA 74, 5461-5467. < c SAVAKIS, C., KOEHLER, M. M. D., and CHERBAS, P. (1984). cDNA clones for the ecdysone-inducible polypeptides (EIP) mRNAs of Uroso& i/u Kc cells. fi;lvBO ,I. 3, 235243. SCHULZ, R. A., and BUTLER, 8. A. (1989). Overlapping genes of Drtwphiltr r,cr/tr?/c?cltr.s~~,~,: Organization of the 2600-!lol/(Idu(~EiJ/IR/,,!, pene cluster. C;c~nc+s Upl? 3, 2X-242. SCHULZ, R. A., CHERBAS, L., and CHERBAS, P. (1986). Alternative splicing generates two distinct Eil)&/d!/ gent transcripts in ZIrosophiln Kc cells. Z-‘roc,. A’uftrtl.Acud. Sri. UX4 83, 9428-9432. SCHULZ, R. A., and MIKSCH, J. L. (1989). Dorsal expression of the Drrp .sol,hilu z(iliO gene during early embryogenesis. Lkc Bid. 136, 211221. SCHULZ, R. A., MIKSCH, J. L., XIE, X., CORNISH, J. A., and GALEWSKY, S. (1990a). Expression of the Z1rosol/hlltr gmrtrrln[ gene: Alternative promoters control the germ-line expression of monocistronic and bicistronic gene transcripts. Dnvlopwrnf 108, 613-622. SCHULZ, R. A., SHLOMCHIK, W., CHERBAS, L., and CHERBAS, P. (1989). Diverse expression of overlapping genes: The Drosophilu Eip#/l’!/ gene and its upstream neighbors. ZX>c,.Biol. 131, 515-523. SCHULZ, R. A., XIE, X., and MIKSCH, J. L. (1990b). cis-Acting sequences required for the germ line expression of the ZJrosoph iln got/c&/ gene. L)cJI,.Biol. 140, 455-458.