- Email: [email protected]
Endolymphatic sac tumor (aggressive papillary tumor of middle ear and temporal bone)
ARTICLE IN PRESS
Pathology – Research and Practice 204 (2008) 599–606 www.elsevier.de/prp
TEACHING CASE
Endolymphatic sac tumor (aggressive papillary tumor of middle ear and temporal bone) Report of two cases with analysis of the VHL gene$ A. Skalovaa,, R. Sˇı´ mab, P. Bohusˇ c, R. Cˇurˇ ı´ kd, J. Luka´sˇ e, M. Michala a
Department of Pathology, Medical Faculty of Charles University, Pilsen, Czech Republic Molecular Genetic Laboratory, Department of Pathology, Medical Faculty Hospital, Pilsen, Czech Republic c Department of Pathology, Medical Faculty of Luis Pasteur, Kosˇice, Slovakia d Biopticka Laborator, Pilsen, Czech Republic e Department of Otorhinolaryngology and Head and Neck Surgery, Hospital Na Homolce, Prague, Czech Republic b
Received 25 September 2007; accepted 31 January 2008
Abstract Endolymphatic sac tumor (Heffner tumor) (ELST) is a very rare nonmetastasizing, locally aggressive low-grade adenocarcinoma of endolymphatic sac origin, which is linked to von-Hippel–Lindau disease (VHLD). VHLD is an autosomal dominant disorder characterized by an inherited genetic abnormality of the VHL gene located on the short arm of chromosome 3 (3p26-p25). VHL gene mutations have been shown both in ELSTs associated with VHLD and in sporadic cases. Because of the rarity of ELST, only a small number of cases have been subjected to molecular genetic analysis. We have encountered two patients with ELST, one of whom presented with a medical and family history of VHLD. The second was a sporadic case, the patient having no symptoms of VHLD. The tissues obtained from Heffner tumor and cerebellar hemangioblastoma from the patient with inherited VHLD possess a point mutation in exon 1 of VHL gene. This mutation is a C to T exchange at position 194, resulting in amino acid exchange S65L. No mutation was found in any of the three exons analyzed and in the exon–intron junctions of the VHL gene in the sporadic case. r 2008 Elsevier GmbH. All rights reserved. Keywords: von Hippel–Lindau disease; Aggressive papillary middle ear tumor; Endolymphatic sac tumor; Heffner tumor; VHL gene analysis
Introduction
$ Case 1 was presented (AS) at the Slide Seminar of the Working Group of Head and Neck Pathology at the Congress of the European Society of Pathology, in Paris, France, 2005. Corresponding author. Tel.: +420 377 402 545; mobile: +420 603886638; fax: +420 377 421 561. E-mail address: [email protected] (A. Skalova).
0344-0338/$ - see front matter r 2008 Elsevier GmbH. All rights reserved. doi:10.1016/j.prp.2008.01.016
Primary adenomatous tumors of the middle ear/ mastoid and endolymphatic sac are rare neoplasms that are difficult to diagnose and classify [5,6]. They represent only a small portion of all primary neoplasms of the ear, which, as a whole, are unusual and derived mostly from neuroectoderm, such as paragangliomas, meningiomas, and neurinomas [6]. Although the majority of adenomatous tumors of temporal bone are benign
ARTICLE IN PRESS 600
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
lesions arising from the mucosa of the middle ear, an infrequent occurrence of aggressive and locally destructive tumors has been reported. In 1988, Gaffey et al. [8] reported a series of 10 cases of an aggressive papillary middle ear tumor (APMET) characterized by a locally aggressive papillary growth pattern, bone destruction, and frequent endolymphatic sac invasion, establishing them as an entity separate from middle ear adenoma [22]. In 1989, Heffner reported 20 cases of an identical tumor entity, and proposed an endolymphatic sac origin for these tumors [11]. The origin of APMET in endolymphatic sac was based on a histological similarity between the tumor and normal endolymphatic sac epithelium, and a clinical manifestation of hearing loss, tinnitus, and vertigo [11,24]. According to the recently published WHO tumor classification, endolymphatic sac tumor (ELST) is synonymous with Heffner tumor and APMET [2]. At an early stage of growth, the neoplasm is located within the endolymphatic sac. At a later stage, it destroys much of the petrous bone, including the middle ear, and extends to the posterior fossa, reaching into the cerebellopontine angle. Despite the controversy about the origin of the so-called APMET, current evidence suggests that it is ELST with extension to the middle ear [2,3,15,17]. Subsequently, it was found that ELST is a biologically unique entity often associated with von Hippel–Lindau disease (VHLD), with 10–15% of patients with ELST harboring the symptoms of VHLD [3]. VHLD is an autosomal dominant disorder characterized by clear cell neoplasms of various organs, such as the central nervous system, kidney, pancreas, adrenals, and epididymis [9,18]. VHLD is an inherited genetic abnormality of the VHL gene located on the short arm of chromosome 3 (3p26-p25). There is inactivation or deletion of the other copy of VHL gene in all the tumors associated with VHLD, including cerebellar, spinal, and retinal Table 1.
hemangioblastomas, clear cell renal carcinoma, clear cell papillary cystadenoma of the epididymis, etc. [14,23]. VHL gene mutations have been shown both in ELST associated with VHLD [19] and in sporadic cases [10]. Because of the rarity of ELST, only a small number of cases have been subjected to molecular genetic analysis. We have encountered two patients with ELST. Herein, we describe the clinical and histopathological features of these cases, along with the results of molecular genetic analysis of the VHL gene in the available tissue samples.
Materials and methods VHL gene analysis We examined the tissues of ELST and cerebellar hemangioblastoma for the presence of VHL mutation by direct sequencing of the coding region. Molecular genetic analysis of the coding sequence of the VHL gene (accession number AF010238) was carried out. Five 10 mm thick sections were cut from each formalin-fixed, paraffin-embedded block, and DNA was isolated by the DNeasy Tissue Kit (QIAgen, Hilden, Germany), according to the manufacturer’s protocol. PCR was carried out using the primers displayed in Table 1. The reaction conditions were as follows: 12.5 ml of HotStart Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer, 100 ng of template DNA, and distilled water up to 25 ml. The amplification program for all fragments consisted of denaturation at 95 1C for 15 min, followed by 40 cycles of denaturation at 95 1C for 1 min, annealing at 55 1C for 1 min, and extension at 72 1C for 1 min. The program was terminated by 72 1C incubation for 7 min. Success-
Sequences of primers used in the study
Exon
Name
Sequence 50 -30
Reference
Exon 1
VHL e1-1
cgcgaagactacggaggt
New primers
Exon 2
VHL VHL VHL VHL VHL VHL VHL VHL
e1-2 e1-3 e1-4 e1-5 e1-6 e1-7 e1-8 e2-1
GTCTTCTTCAGGGCCGTA GAGGCAGGCGTCGAAGAG GCGATTGCAGAAGATGACCT GCCGAGGAGGAGATGGAG cccgtacCTCGGTAGCTGT CCGTATGGCTCAACTTCGAC gcttcagaccgtgctatcgt accggtgtggctctttaaca
New primers
VHL VHL VHL VHL VHL
e2-2 e3-1 e3-2 e3-3 e3-4c
tcctgtacttaccacaacaacctt GATTTGGTTTTTGCCCTTCC ACATTTGGGTGGTCTTCCAG CGTCAGGTCGCTCTACGAA CCATCAAAAGCTGAGATGAAAC
Exon 3
Ref. [16]
ARTICLE IN PRESS A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
fully amplified PCR products were purified with Montage PCR Centrifugal Filter Devices (Millipore, Billerica, USA) and sequenced using Big Dye Terminator Sequencing kit (PE/Applied Biosystems, Foster City, USA). Samples were run on automated sequencer ABI Prism 310 (PE/Applied Biosystems) at a constant voltage of 11.3 kV for 20 min.
Immunohistochemistry Formalin-fixed, paraffin-embedded tissues from the ELST and the cerebellar hemangioblastoma were available. These were routinely processed and stained with hematoxylin and eosin. For immunohistochemical studies, 4-mm-thick sections were cut from paraffin blocks, mounted on slides coated with 3-aminopropyltriethoxy-silane (Sigma, St. Louis, USA), deparaffinized in xylene, and rehydrated in descending grades (100–70%) of ethanol. Sections were then subjected to heat-induced epitope retrieval by immersion in a 0.01 mol/l concentration of citrate buffer (pH 6.0) in microwave oven Micromed TTmega for 40 min. Endogenous peroxidase was blocked by a 5-min treatment with 3% hydrogen peroxidase in absolute methanol. The slides were incubated in an autostainer LabVision for 60 min at room temperature with the primary antibodies (Table 2). The bound antibodies were visualized using the supersensitive streptavidin–biotin– peroxidase complex (Novocastra, Newcastle upon Tyne, UK) and 3-30 -diaminobenzidine (Sigma) as chromogen. The slides were counterstained with Mayer’s hematoxylin.
Table 2.
601
Results Case 1: Clinical history A 25-year-old woman presented with a 1-year history of slowly progressive and gradual decrease in hearing. Two years previously, the patient had undergone brain surgery because of hemangioblastoma of the cerebellum. Gene analysis performed at that time showed mutation in VHL gene in exon 1 TCG(Ser65)-TTG(Leu). On physical examination, she was found to have a middle ear mass that protruded into the external auditory canal. Bone destruction was found radiographically. At surgery, vascular tumor tissue and cysts were seen permeating and destroying the adjacent petrous portion of the temporal bone with invasion of the mastoid and the semicircular canal. The patient underwent a complete removal of the tumor from the middle ear, mastoid, and petrous bone. However, recurrent destructive tumor of the middle ear appeared after 26 months.
Family history The family medical history disclosed the presence of symptoms of VHLD in the patient’s grandfather, uncle, and father. In particular, the patient’s father presented with multi-tumor syndrome and evidence of genetic VHLD due to causal mutation in VHL gene in exon 1 TCG(Ser65)-TTG(Leu). At the age of 30, he was operated on for cerebellar hemangioblastoma, and died of disseminated bilateral renal cell carcinoma of kidneys with multi-organ distant metastases 13 years later at the age of 43.
Antibodies used for immunohistochemical study
Antibody specificity
Clone
Dilution
Source
Ki-67 CK 1–8, 10, 14–16, 19 CK Cytokeratin 5/6 Cytokeratin 18 Cytokeratin 19 Cytokeratin 7 Cytokeratin 20 Cytokeratin 14 EMA Thyreoglobulin TTF1 S-100 protein NSE chromogranin Synaptophysin
MIB1 AE 1–3 CAM 5.2 D5/16B4 DC10 RCK 108 OV-TL12/30 IT-Ks 20.8 LL002 E29 DAK-Tg6 8G7G3/1 Polyclonal BBS/NC/IV-H14 DAK-A3 SP11
1:1000 1:1000 1:200 1:150 1:100 1:100 1:200 1:100 1:1000 1:1000 1:400 1:100 1:10000 1:3000 1:300 1:400
DakoCytomation, Glostrup, Denmark LabVision/NeoMarkers Becton-Dickinson, Mountain View DakoCytomation Biogenex, San Ramon, CA DakoCytomation DakoCytomation DakoCytomation LabVision/NeoMarkers DakoCytomation DakoCytomation LabVision/NeoMarkers DakoCytomation DakoCytomation DakoCytomation LabVision/NeoMarkers
EMA, epithelial membrane antigen; NSE, neurone-specific enolase; TTF1, tumor transcription factor 1.
ARTICLE IN PRESS 602
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
Case 2: Clinical history The patient was a 66-year-old woman with a long history of vertigo and slowly progressing unilateral hearing loss. On admission, a tumor of the left petrous temporal bone was found. On the basis of an intraoperative frozen-section-based diagnosis of a tumor of uncertain biological behavior, probably aggressive meningioma, the intracranial portion of the tumor was resected. The final diagnosis of endolymphatic sac tumor was followed by examination for von Hippel– Lindau syndrome. Neither the symptoms nor a family history of VHLD were found in the patient.
Microscopical and immunohistochemical findings Both tumors of the ear were identical microscopically. The tumors were removed in fragments, the largest of which measured 6 mm in diameter (Case 1) and 4 7 mm (Case 2). Histologically, the tumors consisted of complex papillary structures embedded in a dense fibrous stroma (Fig. 1). The papillae were covered by a single layer of low cuboidal cells that frequently became flattened. The stroma of the papillary fronds was richly vascularized. In places, the neoplastic cells were taller, with deeply eosinophilic finely granular cytoplasm (Fig. 2). Focally, the cytoplasm was clear, with sharply delineated cell membranes (Fig. 3). Occasional cells were completely vacuolated, while the others displayed prominent, multiple, small, optically clear, perinuclear vacuoles. There was slight nuclear polymorphism, but mitotic figures were not seen. The growth pattern was invasive, with destruction of the petrous bone (Fig. 4).
Immunohistochemistry showed strong staining with cytokeratin antibodies AE1-3 and CAM 5.2 and EMA (epithelial membrane antigen), and focal staining with S100 protein. The tumor cells expressed strong reactivity for cytokeratins CK5/6, CK7, CK8, CK18, and CK19, but not for CK14 and CK20. The cells were negative for synaptophysin, chromogranin, thyroglobulin, CEA, and TTF1. Proliferative activity was low, with few MIB 1-positive nuclei.
Gene analysis In Case 1, the ELST and cerebellar hemangioblastoma possess a point mutation in exon 1. This mutation is a C to T exchange at position 194, resulting in amino acid exchange S65L (Fig. 5). No mutation was found in all three exons analyzed and in exon–intron junctions of the VHL gene in Case 2.
Discussion VHLD is a rare autosomal dominant disorder due to deletions or mutations in a tumor suppressor gene located on short arm of chromosome 3 (3p25-p26) [7]. The disease is characterized by the asynchronous and synchronous development of various clear cell tumors in different organs [4,12,18]. The affected individuals are at risk of developing various vascularized benign and malignant tumors of the central nervous system, kidneys, adrenals, pancreas, and reproductive adnexal organs. The diagnosis of VHLD is often based on clinical criteria. At present, it is accepted that the
Fig. 1. Histologically, both tumors consist of complex papillary structures embedded in dense fibrous stroma.
ARTICLE IN PRESS A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
603
Fig. 2. The stroma of papillary fronds is richly vascularized. There is only mild nuclear polymorphism, and no mitotic figures are seen.
Fig. 3. The neoplastic cells reveal clear cytoplasm, and they are sharply delineated by cell membranes. Occasional cells were completely vacuolated, the others displayed prominent, multiple, small, optically clear, perinuclear vacuoles.
diagnosis of VHLD may be made using the following criteria: two or more hemangioblastomas or a single hemangioblastoma in association with other visceral manifestations, or a single hemangioblastoma in a patient with a family history of VHLD [19]. The median age at death of a patient with VHLD is 49 years, and the most common cause of death is the occurrence of
neurological complications of hemangioblastoma or metastatic clear cell renal carcinoma [12]. Most commonly, the tumors associated with VHLD include retinal, cerebellar, medullary, and spinal cord hemangioblastomas, renal cell carcinomas, and pheochromocytomas. The cell phenotype of these tumors varies according to the site; some tumors are epithelial,
ARTICLE IN PRESS 604
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
Fig. 4. The growth pattern is invasive, with destruction of petrous bone.
Fig. 5. VHL gene analysis of hemangioblastoma of Case 1. The arrow indicates a point mutation C to T, resulting in amino acid exchange S65L.
the others show an endocrine phenotype. Although most likely mesenchymal, the phenotype of hemangioblastomas has not been clearly defined yet. Histologically, most VHLD linked tumors share a number of features, including clear cell change, papillary cystic structures, and highly vascularized stroma. A possible explanation for the histological similarity between VHLD-associated tumors may lie in the abnormal function of the VHL gene. It is thought that the rich blood vessel supply in VHLD-related tumors may result from an abnormal or absent VHL-protein function, which may cause hypoxia-inducible factor (HIF) stimulation of angiogenesis. The VHL gene normally regulates vascular endothelial growth factor (VEGF), and there is evidence that inactivation of the VHL gene promotes VEGF overexpression and angiogenesis in VHL-associated tumors [12]. This link may explain the highly vascularized nature of all tumors associated with VHLD [1]. The histopathological differential diagnosis of ELST includes middle ear adenoma, paraganglioma, chorioid plexus papilloma, and metastatic carcinoma of the thyroid, kidney, prostate, lung, and breast. Middle ear adenoma is a rare tumor displaying mucinous and neuroendocrine differentiation without formation of
papillae. Adenomas form an avascular mass limited to the middle ear without bone destruction. Paragangliomas of the middle ear are cytologically benign and may demonstrate papillary structures and cuboidal cells with eosinophilic cytoplasm. However, paraganglioma cells are positive for chromogranin and synaptophysin, and at least focally they are arranged in characteristic nests. Chorioid plexus papilloma may be histologically similar to ELST, but it originates in the ventricle and does not invade bone. Currently, considerations of metastases from thyroid, breast, and prostate can be eliminated by immunohistochemistry. Positive staining for thyroglobulin, GCDFP-15 protein, estrogen and progesterone receptors, and prostatic-specific antigen, respectively, can help in this differential diagnosis. Differentiation of ELST from metastatic renal carcinoma can be more difficult, both tumors may occur in patients with VHLD, and immunohistochemistry does not help. Renal cell carcinoma, however, shows nuclear polymorphism and mitoses. ELST is a primary low-grade adenocarcinoma of the temporal bone that is presumed to originate from the vestibular endolymphatic system [5,8]. An association of ELST and VHL disease was first published in a large study showing an increased prevalence of ELST among the patients with VHLD [18]. Subsequently, germline mutation of the VHL gene and somatic loss of the wildtype allele were demonstrated in ELST from VHL patients [13,20]. Genetic analysis of the tumors in patients with VHLD supports the theory that an inherited mutation in one allele, followed by somatic loss of the other allele, is essential for development of the tumors. Tibbs et al. demonstrated a genetic
ARTICLE IN PRESS A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
mutation in the VHL gene within the ELST that was similar to mutations previously reported in other VHLD-associated tumors [19]. Somatic VHL gene mutations have been shown in sporadic cases of ELST [10,21]. Hamazaki et al. [10] showed a mutation of the VHL tumor suppressor gene in a sporadic ELST in a patient without symptoms of VHL disease. Sequencing studies of tumor DNA disclosed a nucleotide substitution of G to T at position 546 of the VHL gene, resulting in an amino acid substitution (Tr to Cys, codon 117) [10]. In a previous analysis of four sporadic ELSTs, two of the cases showed a point mutation in the VHL gene [21]. In one case, Gly to Asp transversion was shown in exon 2, codon 114, whereas in the other case, a deletion in exon 1, codon 4 was identified. Two other sporadic cases of ELST did not show any mutation in the VHL gene [21]. Thus, the findings in this and previous studies warrant that the VHL gene is associated with ELST tumorigenesis when arising in the context of VHL disease. The role of VHL gene mutation in sporadic cases of ELST is still to be elucidated in future studies of additional cases. In conclusion, we have studied two cases of Heffner tumor of identical histomorphology and immunophenotype. One of the patients presented with a medical and family history of VHLD and proven inherited germline mutation of the VHL tumor suppressor gene. The latter was a sporadic case, in a patient with no symptoms of VHLD. While in the patient with VHLD, the ELST and cerebellar hemangioblastoma carry a mutation of VHL gene, resulting in C to T exchange at position 194, the consequence of which is an amino acid exchange S65L. No mutation of the VHL gene was found in all three exons analyzed and in exon–intron junctions in the sporadic case.
Acknowledgment The authors are grateful to Petr Mukensnabl, MD, for taking photomicrographs.
References [1] H. Aydin, R.H. Young, B.M. Ronnett, J.I. Epstein, Clear cell papillary cystadenoma of epididymis and mesosalpinx. Immunohistochemical differentiation from metastatic clear cell renal cell carcinoma, Am. J. Surg. Pathol. 29 (2005) 520–523. [2] L. Barnes, J.W. Eveson, P. Reichart, D. Sidransky (Eds.), World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Head and Neck Tumours, IARC Press, Lyon, 2005, pp. 355–356. [3] M. Bisceglia, V.A. D’Angelo, Wenig BMEndolymphatic sac papillary tumor (Heffner tumor), Adv. Anat. Pathol. 13 (2006) 131–138.
605
[4] R. Chetty, M. Kennedy, S. Ezzat, S.L. Asa, Pancreatic endocrine pathology in von Hippel–Lindau disease: an expanding spectrum of lesions, Endocr. Pathol. 15 (2004) 141–148. [5] T.L. Eby, M.S. Makek, U. Fisch, Adenomas of the temporal bone, Ann. Otol. Rhinol. Laryngol. 97 (1988) 605–612. [6] A.K. El-Naggar, M. Pfaltz, N.G. Ordonez, J.G. Batsakis, Tumors of the middle ear and endolymphatic sac, Pathol. Annu. 29 (Pt 2) (1994) 199–231. [7] C.A. Friedrich, von Hippel–Lindau syndrome. A pleomorphic condition, Cancer 86 (1999) 2478–2482. [8] M.J. Gaffey, S.E. Mills, R.E. Fechner, et al., Aggressive papillary middle-ear tumor. A clinicopathologic entity distinct from middle-ear adenoma, Am. J. Surg. Pathol. 12 (1988) 790–797. [9] J.R. Gnarra, K. Tory, Y. Weng, L. Schmidt, M.H. Wei, H. Li, F. Latif, S. Liu, F. Chen, F.M. Duh, I. Lubensky, D.R. Duan, C. Florence, R. Pozzatti, M.M. Walther, N.H. Bander, H.B. Grossman, H. Brauch, S. Pomer, J.D. Brooks, W.B. Isaacs, N.I. Lerman, B. Zbar, W.M. Linehan, Mutations of the VHL tumour suppressor gene in renal carcinoma, Nat. Genet. 7 (1994) 85–90. [10] S. Hamazaki, M. Yoshida, M. Yao, et al., Mutation of von Hippel–Lindau tumor suppressor gene in a sporadic endolymphatic sac tumor, Hum. Pathol. 32 (2001) 1272–1276. [11] D.K. Heffner, Low grade adenocarcinoma of probable endolymphatic sac origin: a clinicopathological study of 20 cases, Cancer 64 (1989) 2292–2302. [12] H. Horiguchi, T. Sano, H. Toi, et al., Endolymphatic sac tumor associated with a von Hippel–Lindau disease patient: an immunohistochemical study, Mod. Pathol. 14 (2001) 727–732. [13] N. Kawahara, H. Kume, K. Ueki, et al., VHL gene inactivation in an endolymphatic sac tumor associated with von Hippel–Lindau disease, Neurology 53 (1999) 208–210. [14] T.J. Manski, D.K. Heffner, G.M. Glenn, et al., Endolymphatic sac tumors: a source of morbid hearing loss in von Hippel–Lindau disease, JAMA 277 (1997) 1461–1466. [15] C.A. Megerian, M.J. McKenna, R.C. Nuss, A.J. Maniglia, R.G. Ojemann, B.Z. Pilch, J.B. Nadol, Endolymphatic sac tumors: histopathologic confirmation, clinical characterization, and implication in von Hippel–Lindau disease, Laryngoscope 105 (1995) 801–808. [16] M. Michal, T. Vaneˇcˇek, R. Sˇı´ ma, P. Mukensˇ nabl, L. Boudova´, M. Broucˇkova´, Primary capillary hemangioblastoma of peripheral soft tissues, Am. J. Surg. Pathol. 28 (2004) 962–966. [17] D.S. Poe, E.C. Tarlov, C.B. Thomas, et al., Aggressive papillary tumor of temporal bone, Otolaryngol. Head Neck Surg. 108 (1993) 80–86. [18] P.A. Sinkre, L. Murakata, L. Rabin, M.P. Hoang, J. Albores-Saavedra, Clear cell carcinoid tumor of the gallbladder. Another distinctive manifestation of von Hippel–Lindau disease, Am. J. Surg. Pathol. 25 (2001) 1334–1339. [19] R.E. Tibbs, A.P. Bowles, F.A. Raila, et al., Should endolymphatic sac tumors be considered part of the von
ARTICLE IN PRESS 606
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
Hippel–Lindau complex? Pathology case report, Neurosurgery 40 (1997) 848–855. [20] A.O. Vortmeyer, D. Choo, S.D. Pack, et al., von Hippel– Lindau disease gene alterations associated with endolymphatic sac tumor, J. Natl. Cancer Inst. 89 (1997) 970–972. [21] A.O. Vortmeyer, S.C. Huang, C.A. Koch, et al., Somatic von Hippel–Lindau gene mutations detected in sporadic endolymphatic sac tumor, Cancer Res. 60 (2000) 5963–5965. [22] M. Wassef, P. Kanavaros, M. Polı´ vka, et al., Middle ear adenoma. A tumor displaying mucinous and neuroendo-
crine diffentiation, Am. J. Surg. Pathol. 13 (1989) 838–849. [23] R.J. Weil, A.O. Vortmeyer, Z. Zhuang, S.D. Pack, N. Theodore, R.K. Erickson, E.H. Oldfield, Clinical and molecular analysis of disseminated hemangioblastomatosis of the central nervous system in patients without von Hippel–Lindau disease. Report of four cases, J. Neurosurg. 96 (2002) 775–777. [24] B.M. Wenig, D.K. Heffner, Endolymphatic sac tumors: fact or fiction?, Adv. Anat. Pathol. 3 (1996) 378–387.
Pathology – Research and Practice 204 (2008) 599–606 www.elsevier.de/prp
TEACHING CASE
Endolymphatic sac tumor (aggressive papillary tumor of middle ear and temporal bone) Report of two cases with analysis of the VHL gene$ A. Skalovaa,, R. Sˇı´ mab, P. Bohusˇ c, R. Cˇurˇ ı´ kd, J. Luka´sˇ e, M. Michala a
Department of Pathology, Medical Faculty of Charles University, Pilsen, Czech Republic Molecular Genetic Laboratory, Department of Pathology, Medical Faculty Hospital, Pilsen, Czech Republic c Department of Pathology, Medical Faculty of Luis Pasteur, Kosˇice, Slovakia d Biopticka Laborator, Pilsen, Czech Republic e Department of Otorhinolaryngology and Head and Neck Surgery, Hospital Na Homolce, Prague, Czech Republic b
Received 25 September 2007; accepted 31 January 2008
Abstract Endolymphatic sac tumor (Heffner tumor) (ELST) is a very rare nonmetastasizing, locally aggressive low-grade adenocarcinoma of endolymphatic sac origin, which is linked to von-Hippel–Lindau disease (VHLD). VHLD is an autosomal dominant disorder characterized by an inherited genetic abnormality of the VHL gene located on the short arm of chromosome 3 (3p26-p25). VHL gene mutations have been shown both in ELSTs associated with VHLD and in sporadic cases. Because of the rarity of ELST, only a small number of cases have been subjected to molecular genetic analysis. We have encountered two patients with ELST, one of whom presented with a medical and family history of VHLD. The second was a sporadic case, the patient having no symptoms of VHLD. The tissues obtained from Heffner tumor and cerebellar hemangioblastoma from the patient with inherited VHLD possess a point mutation in exon 1 of VHL gene. This mutation is a C to T exchange at position 194, resulting in amino acid exchange S65L. No mutation was found in any of the three exons analyzed and in the exon–intron junctions of the VHL gene in the sporadic case. r 2008 Elsevier GmbH. All rights reserved. Keywords: von Hippel–Lindau disease; Aggressive papillary middle ear tumor; Endolymphatic sac tumor; Heffner tumor; VHL gene analysis
Introduction
$ Case 1 was presented (AS) at the Slide Seminar of the Working Group of Head and Neck Pathology at the Congress of the European Society of Pathology, in Paris, France, 2005. Corresponding author. Tel.: +420 377 402 545; mobile: +420 603886638; fax: +420 377 421 561. E-mail address: [email protected] (A. Skalova).
0344-0338/$ - see front matter r 2008 Elsevier GmbH. All rights reserved. doi:10.1016/j.prp.2008.01.016
Primary adenomatous tumors of the middle ear/ mastoid and endolymphatic sac are rare neoplasms that are difficult to diagnose and classify [5,6]. They represent only a small portion of all primary neoplasms of the ear, which, as a whole, are unusual and derived mostly from neuroectoderm, such as paragangliomas, meningiomas, and neurinomas [6]. Although the majority of adenomatous tumors of temporal bone are benign
ARTICLE IN PRESS 600
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
lesions arising from the mucosa of the middle ear, an infrequent occurrence of aggressive and locally destructive tumors has been reported. In 1988, Gaffey et al. [8] reported a series of 10 cases of an aggressive papillary middle ear tumor (APMET) characterized by a locally aggressive papillary growth pattern, bone destruction, and frequent endolymphatic sac invasion, establishing them as an entity separate from middle ear adenoma [22]. In 1989, Heffner reported 20 cases of an identical tumor entity, and proposed an endolymphatic sac origin for these tumors [11]. The origin of APMET in endolymphatic sac was based on a histological similarity between the tumor and normal endolymphatic sac epithelium, and a clinical manifestation of hearing loss, tinnitus, and vertigo [11,24]. According to the recently published WHO tumor classification, endolymphatic sac tumor (ELST) is synonymous with Heffner tumor and APMET [2]. At an early stage of growth, the neoplasm is located within the endolymphatic sac. At a later stage, it destroys much of the petrous bone, including the middle ear, and extends to the posterior fossa, reaching into the cerebellopontine angle. Despite the controversy about the origin of the so-called APMET, current evidence suggests that it is ELST with extension to the middle ear [2,3,15,17]. Subsequently, it was found that ELST is a biologically unique entity often associated with von Hippel–Lindau disease (VHLD), with 10–15% of patients with ELST harboring the symptoms of VHLD [3]. VHLD is an autosomal dominant disorder characterized by clear cell neoplasms of various organs, such as the central nervous system, kidney, pancreas, adrenals, and epididymis [9,18]. VHLD is an inherited genetic abnormality of the VHL gene located on the short arm of chromosome 3 (3p26-p25). There is inactivation or deletion of the other copy of VHL gene in all the tumors associated with VHLD, including cerebellar, spinal, and retinal Table 1.
hemangioblastomas, clear cell renal carcinoma, clear cell papillary cystadenoma of the epididymis, etc. [14,23]. VHL gene mutations have been shown both in ELST associated with VHLD [19] and in sporadic cases [10]. Because of the rarity of ELST, only a small number of cases have been subjected to molecular genetic analysis. We have encountered two patients with ELST. Herein, we describe the clinical and histopathological features of these cases, along with the results of molecular genetic analysis of the VHL gene in the available tissue samples.
Materials and methods VHL gene analysis We examined the tissues of ELST and cerebellar hemangioblastoma for the presence of VHL mutation by direct sequencing of the coding region. Molecular genetic analysis of the coding sequence of the VHL gene (accession number AF010238) was carried out. Five 10 mm thick sections were cut from each formalin-fixed, paraffin-embedded block, and DNA was isolated by the DNeasy Tissue Kit (QIAgen, Hilden, Germany), according to the manufacturer’s protocol. PCR was carried out using the primers displayed in Table 1. The reaction conditions were as follows: 12.5 ml of HotStart Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer, 100 ng of template DNA, and distilled water up to 25 ml. The amplification program for all fragments consisted of denaturation at 95 1C for 15 min, followed by 40 cycles of denaturation at 95 1C for 1 min, annealing at 55 1C for 1 min, and extension at 72 1C for 1 min. The program was terminated by 72 1C incubation for 7 min. Success-
Sequences of primers used in the study
Exon
Name
Sequence 50 -30
Reference
Exon 1
VHL e1-1
cgcgaagactacggaggt
New primers
Exon 2
VHL VHL VHL VHL VHL VHL VHL VHL
e1-2 e1-3 e1-4 e1-5 e1-6 e1-7 e1-8 e2-1
GTCTTCTTCAGGGCCGTA GAGGCAGGCGTCGAAGAG GCGATTGCAGAAGATGACCT GCCGAGGAGGAGATGGAG cccgtacCTCGGTAGCTGT CCGTATGGCTCAACTTCGAC gcttcagaccgtgctatcgt accggtgtggctctttaaca
New primers
VHL VHL VHL VHL VHL
e2-2 e3-1 e3-2 e3-3 e3-4c
tcctgtacttaccacaacaacctt GATTTGGTTTTTGCCCTTCC ACATTTGGGTGGTCTTCCAG CGTCAGGTCGCTCTACGAA CCATCAAAAGCTGAGATGAAAC
Exon 3
Ref. [16]
ARTICLE IN PRESS A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
fully amplified PCR products were purified with Montage PCR Centrifugal Filter Devices (Millipore, Billerica, USA) and sequenced using Big Dye Terminator Sequencing kit (PE/Applied Biosystems, Foster City, USA). Samples were run on automated sequencer ABI Prism 310 (PE/Applied Biosystems) at a constant voltage of 11.3 kV for 20 min.
Immunohistochemistry Formalin-fixed, paraffin-embedded tissues from the ELST and the cerebellar hemangioblastoma were available. These were routinely processed and stained with hematoxylin and eosin. For immunohistochemical studies, 4-mm-thick sections were cut from paraffin blocks, mounted on slides coated with 3-aminopropyltriethoxy-silane (Sigma, St. Louis, USA), deparaffinized in xylene, and rehydrated in descending grades (100–70%) of ethanol. Sections were then subjected to heat-induced epitope retrieval by immersion in a 0.01 mol/l concentration of citrate buffer (pH 6.0) in microwave oven Micromed TTmega for 40 min. Endogenous peroxidase was blocked by a 5-min treatment with 3% hydrogen peroxidase in absolute methanol. The slides were incubated in an autostainer LabVision for 60 min at room temperature with the primary antibodies (Table 2). The bound antibodies were visualized using the supersensitive streptavidin–biotin– peroxidase complex (Novocastra, Newcastle upon Tyne, UK) and 3-30 -diaminobenzidine (Sigma) as chromogen. The slides were counterstained with Mayer’s hematoxylin.
Table 2.
601
Results Case 1: Clinical history A 25-year-old woman presented with a 1-year history of slowly progressive and gradual decrease in hearing. Two years previously, the patient had undergone brain surgery because of hemangioblastoma of the cerebellum. Gene analysis performed at that time showed mutation in VHL gene in exon 1 TCG(Ser65)-TTG(Leu). On physical examination, she was found to have a middle ear mass that protruded into the external auditory canal. Bone destruction was found radiographically. At surgery, vascular tumor tissue and cysts were seen permeating and destroying the adjacent petrous portion of the temporal bone with invasion of the mastoid and the semicircular canal. The patient underwent a complete removal of the tumor from the middle ear, mastoid, and petrous bone. However, recurrent destructive tumor of the middle ear appeared after 26 months.
Family history The family medical history disclosed the presence of symptoms of VHLD in the patient’s grandfather, uncle, and father. In particular, the patient’s father presented with multi-tumor syndrome and evidence of genetic VHLD due to causal mutation in VHL gene in exon 1 TCG(Ser65)-TTG(Leu). At the age of 30, he was operated on for cerebellar hemangioblastoma, and died of disseminated bilateral renal cell carcinoma of kidneys with multi-organ distant metastases 13 years later at the age of 43.
Antibodies used for immunohistochemical study
Antibody specificity
Clone
Dilution
Source
Ki-67 CK 1–8, 10, 14–16, 19 CK Cytokeratin 5/6 Cytokeratin 18 Cytokeratin 19 Cytokeratin 7 Cytokeratin 20 Cytokeratin 14 EMA Thyreoglobulin TTF1 S-100 protein NSE chromogranin Synaptophysin
MIB1 AE 1–3 CAM 5.2 D5/16B4 DC10 RCK 108 OV-TL12/30 IT-Ks 20.8 LL002 E29 DAK-Tg6 8G7G3/1 Polyclonal BBS/NC/IV-H14 DAK-A3 SP11
1:1000 1:1000 1:200 1:150 1:100 1:100 1:200 1:100 1:1000 1:1000 1:400 1:100 1:10000 1:3000 1:300 1:400
DakoCytomation, Glostrup, Denmark LabVision/NeoMarkers Becton-Dickinson, Mountain View DakoCytomation Biogenex, San Ramon, CA DakoCytomation DakoCytomation DakoCytomation LabVision/NeoMarkers DakoCytomation DakoCytomation LabVision/NeoMarkers DakoCytomation DakoCytomation DakoCytomation LabVision/NeoMarkers
EMA, epithelial membrane antigen; NSE, neurone-specific enolase; TTF1, tumor transcription factor 1.
ARTICLE IN PRESS 602
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
Case 2: Clinical history The patient was a 66-year-old woman with a long history of vertigo and slowly progressing unilateral hearing loss. On admission, a tumor of the left petrous temporal bone was found. On the basis of an intraoperative frozen-section-based diagnosis of a tumor of uncertain biological behavior, probably aggressive meningioma, the intracranial portion of the tumor was resected. The final diagnosis of endolymphatic sac tumor was followed by examination for von Hippel– Lindau syndrome. Neither the symptoms nor a family history of VHLD were found in the patient.
Microscopical and immunohistochemical findings Both tumors of the ear were identical microscopically. The tumors were removed in fragments, the largest of which measured 6 mm in diameter (Case 1) and 4 7 mm (Case 2). Histologically, the tumors consisted of complex papillary structures embedded in a dense fibrous stroma (Fig. 1). The papillae were covered by a single layer of low cuboidal cells that frequently became flattened. The stroma of the papillary fronds was richly vascularized. In places, the neoplastic cells were taller, with deeply eosinophilic finely granular cytoplasm (Fig. 2). Focally, the cytoplasm was clear, with sharply delineated cell membranes (Fig. 3). Occasional cells were completely vacuolated, while the others displayed prominent, multiple, small, optically clear, perinuclear vacuoles. There was slight nuclear polymorphism, but mitotic figures were not seen. The growth pattern was invasive, with destruction of the petrous bone (Fig. 4).
Immunohistochemistry showed strong staining with cytokeratin antibodies AE1-3 and CAM 5.2 and EMA (epithelial membrane antigen), and focal staining with S100 protein. The tumor cells expressed strong reactivity for cytokeratins CK5/6, CK7, CK8, CK18, and CK19, but not for CK14 and CK20. The cells were negative for synaptophysin, chromogranin, thyroglobulin, CEA, and TTF1. Proliferative activity was low, with few MIB 1-positive nuclei.
Gene analysis In Case 1, the ELST and cerebellar hemangioblastoma possess a point mutation in exon 1. This mutation is a C to T exchange at position 194, resulting in amino acid exchange S65L (Fig. 5). No mutation was found in all three exons analyzed and in exon–intron junctions of the VHL gene in Case 2.
Discussion VHLD is a rare autosomal dominant disorder due to deletions or mutations in a tumor suppressor gene located on short arm of chromosome 3 (3p25-p26) [7]. The disease is characterized by the asynchronous and synchronous development of various clear cell tumors in different organs [4,12,18]. The affected individuals are at risk of developing various vascularized benign and malignant tumors of the central nervous system, kidneys, adrenals, pancreas, and reproductive adnexal organs. The diagnosis of VHLD is often based on clinical criteria. At present, it is accepted that the
Fig. 1. Histologically, both tumors consist of complex papillary structures embedded in dense fibrous stroma.
ARTICLE IN PRESS A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
603
Fig. 2. The stroma of papillary fronds is richly vascularized. There is only mild nuclear polymorphism, and no mitotic figures are seen.
Fig. 3. The neoplastic cells reveal clear cytoplasm, and they are sharply delineated by cell membranes. Occasional cells were completely vacuolated, the others displayed prominent, multiple, small, optically clear, perinuclear vacuoles.
diagnosis of VHLD may be made using the following criteria: two or more hemangioblastomas or a single hemangioblastoma in association with other visceral manifestations, or a single hemangioblastoma in a patient with a family history of VHLD [19]. The median age at death of a patient with VHLD is 49 years, and the most common cause of death is the occurrence of
neurological complications of hemangioblastoma or metastatic clear cell renal carcinoma [12]. Most commonly, the tumors associated with VHLD include retinal, cerebellar, medullary, and spinal cord hemangioblastomas, renal cell carcinomas, and pheochromocytomas. The cell phenotype of these tumors varies according to the site; some tumors are epithelial,
ARTICLE IN PRESS 604
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
Fig. 4. The growth pattern is invasive, with destruction of petrous bone.
Fig. 5. VHL gene analysis of hemangioblastoma of Case 1. The arrow indicates a point mutation C to T, resulting in amino acid exchange S65L.
the others show an endocrine phenotype. Although most likely mesenchymal, the phenotype of hemangioblastomas has not been clearly defined yet. Histologically, most VHLD linked tumors share a number of features, including clear cell change, papillary cystic structures, and highly vascularized stroma. A possible explanation for the histological similarity between VHLD-associated tumors may lie in the abnormal function of the VHL gene. It is thought that the rich blood vessel supply in VHLD-related tumors may result from an abnormal or absent VHL-protein function, which may cause hypoxia-inducible factor (HIF) stimulation of angiogenesis. The VHL gene normally regulates vascular endothelial growth factor (VEGF), and there is evidence that inactivation of the VHL gene promotes VEGF overexpression and angiogenesis in VHL-associated tumors [12]. This link may explain the highly vascularized nature of all tumors associated with VHLD [1]. The histopathological differential diagnosis of ELST includes middle ear adenoma, paraganglioma, chorioid plexus papilloma, and metastatic carcinoma of the thyroid, kidney, prostate, lung, and breast. Middle ear adenoma is a rare tumor displaying mucinous and neuroendocrine differentiation without formation of
papillae. Adenomas form an avascular mass limited to the middle ear without bone destruction. Paragangliomas of the middle ear are cytologically benign and may demonstrate papillary structures and cuboidal cells with eosinophilic cytoplasm. However, paraganglioma cells are positive for chromogranin and synaptophysin, and at least focally they are arranged in characteristic nests. Chorioid plexus papilloma may be histologically similar to ELST, but it originates in the ventricle and does not invade bone. Currently, considerations of metastases from thyroid, breast, and prostate can be eliminated by immunohistochemistry. Positive staining for thyroglobulin, GCDFP-15 protein, estrogen and progesterone receptors, and prostatic-specific antigen, respectively, can help in this differential diagnosis. Differentiation of ELST from metastatic renal carcinoma can be more difficult, both tumors may occur in patients with VHLD, and immunohistochemistry does not help. Renal cell carcinoma, however, shows nuclear polymorphism and mitoses. ELST is a primary low-grade adenocarcinoma of the temporal bone that is presumed to originate from the vestibular endolymphatic system [5,8]. An association of ELST and VHL disease was first published in a large study showing an increased prevalence of ELST among the patients with VHLD [18]. Subsequently, germline mutation of the VHL gene and somatic loss of the wildtype allele were demonstrated in ELST from VHL patients [13,20]. Genetic analysis of the tumors in patients with VHLD supports the theory that an inherited mutation in one allele, followed by somatic loss of the other allele, is essential for development of the tumors. Tibbs et al. demonstrated a genetic
ARTICLE IN PRESS A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
mutation in the VHL gene within the ELST that was similar to mutations previously reported in other VHLD-associated tumors [19]. Somatic VHL gene mutations have been shown in sporadic cases of ELST [10,21]. Hamazaki et al. [10] showed a mutation of the VHL tumor suppressor gene in a sporadic ELST in a patient without symptoms of VHL disease. Sequencing studies of tumor DNA disclosed a nucleotide substitution of G to T at position 546 of the VHL gene, resulting in an amino acid substitution (Tr to Cys, codon 117) [10]. In a previous analysis of four sporadic ELSTs, two of the cases showed a point mutation in the VHL gene [21]. In one case, Gly to Asp transversion was shown in exon 2, codon 114, whereas in the other case, a deletion in exon 1, codon 4 was identified. Two other sporadic cases of ELST did not show any mutation in the VHL gene [21]. Thus, the findings in this and previous studies warrant that the VHL gene is associated with ELST tumorigenesis when arising in the context of VHL disease. The role of VHL gene mutation in sporadic cases of ELST is still to be elucidated in future studies of additional cases. In conclusion, we have studied two cases of Heffner tumor of identical histomorphology and immunophenotype. One of the patients presented with a medical and family history of VHLD and proven inherited germline mutation of the VHL tumor suppressor gene. The latter was a sporadic case, in a patient with no symptoms of VHLD. While in the patient with VHLD, the ELST and cerebellar hemangioblastoma carry a mutation of VHL gene, resulting in C to T exchange at position 194, the consequence of which is an amino acid exchange S65L. No mutation of the VHL gene was found in all three exons analyzed and in exon–intron junctions in the sporadic case.
Acknowledgment The authors are grateful to Petr Mukensnabl, MD, for taking photomicrographs.
References [1] H. Aydin, R.H. Young, B.M. Ronnett, J.I. Epstein, Clear cell papillary cystadenoma of epididymis and mesosalpinx. Immunohistochemical differentiation from metastatic clear cell renal cell carcinoma, Am. J. Surg. Pathol. 29 (2005) 520–523. [2] L. Barnes, J.W. Eveson, P. Reichart, D. Sidransky (Eds.), World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Head and Neck Tumours, IARC Press, Lyon, 2005, pp. 355–356. [3] M. Bisceglia, V.A. D’Angelo, Wenig BMEndolymphatic sac papillary tumor (Heffner tumor), Adv. Anat. Pathol. 13 (2006) 131–138.
605
[4] R. Chetty, M. Kennedy, S. Ezzat, S.L. Asa, Pancreatic endocrine pathology in von Hippel–Lindau disease: an expanding spectrum of lesions, Endocr. Pathol. 15 (2004) 141–148. [5] T.L. Eby, M.S. Makek, U. Fisch, Adenomas of the temporal bone, Ann. Otol. Rhinol. Laryngol. 97 (1988) 605–612. [6] A.K. El-Naggar, M. Pfaltz, N.G. Ordonez, J.G. Batsakis, Tumors of the middle ear and endolymphatic sac, Pathol. Annu. 29 (Pt 2) (1994) 199–231. [7] C.A. Friedrich, von Hippel–Lindau syndrome. A pleomorphic condition, Cancer 86 (1999) 2478–2482. [8] M.J. Gaffey, S.E. Mills, R.E. Fechner, et al., Aggressive papillary middle-ear tumor. A clinicopathologic entity distinct from middle-ear adenoma, Am. J. Surg. Pathol. 12 (1988) 790–797. [9] J.R. Gnarra, K. Tory, Y. Weng, L. Schmidt, M.H. Wei, H. Li, F. Latif, S. Liu, F. Chen, F.M. Duh, I. Lubensky, D.R. Duan, C. Florence, R. Pozzatti, M.M. Walther, N.H. Bander, H.B. Grossman, H. Brauch, S. Pomer, J.D. Brooks, W.B. Isaacs, N.I. Lerman, B. Zbar, W.M. Linehan, Mutations of the VHL tumour suppressor gene in renal carcinoma, Nat. Genet. 7 (1994) 85–90. [10] S. Hamazaki, M. Yoshida, M. Yao, et al., Mutation of von Hippel–Lindau tumor suppressor gene in a sporadic endolymphatic sac tumor, Hum. Pathol. 32 (2001) 1272–1276. [11] D.K. Heffner, Low grade adenocarcinoma of probable endolymphatic sac origin: a clinicopathological study of 20 cases, Cancer 64 (1989) 2292–2302. [12] H. Horiguchi, T. Sano, H. Toi, et al., Endolymphatic sac tumor associated with a von Hippel–Lindau disease patient: an immunohistochemical study, Mod. Pathol. 14 (2001) 727–732. [13] N. Kawahara, H. Kume, K. Ueki, et al., VHL gene inactivation in an endolymphatic sac tumor associated with von Hippel–Lindau disease, Neurology 53 (1999) 208–210. [14] T.J. Manski, D.K. Heffner, G.M. Glenn, et al., Endolymphatic sac tumors: a source of morbid hearing loss in von Hippel–Lindau disease, JAMA 277 (1997) 1461–1466. [15] C.A. Megerian, M.J. McKenna, R.C. Nuss, A.J. Maniglia, R.G. Ojemann, B.Z. Pilch, J.B. Nadol, Endolymphatic sac tumors: histopathologic confirmation, clinical characterization, and implication in von Hippel–Lindau disease, Laryngoscope 105 (1995) 801–808. [16] M. Michal, T. Vaneˇcˇek, R. Sˇı´ ma, P. Mukensˇ nabl, L. Boudova´, M. Broucˇkova´, Primary capillary hemangioblastoma of peripheral soft tissues, Am. J. Surg. Pathol. 28 (2004) 962–966. [17] D.S. Poe, E.C. Tarlov, C.B. Thomas, et al., Aggressive papillary tumor of temporal bone, Otolaryngol. Head Neck Surg. 108 (1993) 80–86. [18] P.A. Sinkre, L. Murakata, L. Rabin, M.P. Hoang, J. Albores-Saavedra, Clear cell carcinoid tumor of the gallbladder. Another distinctive manifestation of von Hippel–Lindau disease, Am. J. Surg. Pathol. 25 (2001) 1334–1339. [19] R.E. Tibbs, A.P. Bowles, F.A. Raila, et al., Should endolymphatic sac tumors be considered part of the von
ARTICLE IN PRESS 606
A. Skalova et al. / Pathology – Research and Practice 204 (2008) 599–606
Hippel–Lindau complex? Pathology case report, Neurosurgery 40 (1997) 848–855. [20] A.O. Vortmeyer, D. Choo, S.D. Pack, et al., von Hippel– Lindau disease gene alterations associated with endolymphatic sac tumor, J. Natl. Cancer Inst. 89 (1997) 970–972. [21] A.O. Vortmeyer, S.C. Huang, C.A. Koch, et al., Somatic von Hippel–Lindau gene mutations detected in sporadic endolymphatic sac tumor, Cancer Res. 60 (2000) 5963–5965. [22] M. Wassef, P. Kanavaros, M. Polı´ vka, et al., Middle ear adenoma. A tumor displaying mucinous and neuroendo-
crine diffentiation, Am. J. Surg. Pathol. 13 (1989) 838–849. [23] R.J. Weil, A.O. Vortmeyer, Z. Zhuang, S.D. Pack, N. Theodore, R.K. Erickson, E.H. Oldfield, Clinical and molecular analysis of disseminated hemangioblastomatosis of the central nervous system in patients without von Hippel–Lindau disease. Report of four cases, J. Neurosurg. 96 (2002) 775–777. [24] B.M. Wenig, D.K. Heffner, Endolymphatic sac tumors: fact or fiction?, Adv. Anat. Pathol. 3 (1996) 378–387.