- Email: [email protected]
Engineering and optimization of phosphate-responsive phytase expression in Pichia pastoris yeast for phytate hydrolysis
Enzyme and Microbial Technology 137 (2020) 109533
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/enzmictec
Engineering and optimization of phosphate-responsive phytase expression in Pichia pastoris yeast for phytate hydrolysis
T
Zhenming Xiea, Wing-Ping Fonga,*, Paul Wai-Kei Tsangb,* a b
School of Life Sciences, The Chinese University of Hong Kong, Hong Kong, China Technological and Higher Education Institute of Hong Kong, Hong Kong, China
ARTICLE INFO
ABSTRACT
Keywords: Pichia pastoris Phytase Phytate PPHO89 Whole cell bio catalyst
Phytate is the major storage form of phosphorus in plants. It is present in cereals and raw materials of vegetable origin used in animal and human diets. However, non-ruminant animals have little phytase activity in their guts and, therefore, cannot digest phytate. As a result, almost all dietary phytate is discharged into the environment, causing phosphorus pollution. Phytate is also considered as an “antinutrient” for its ability to form insoluble and stable complexes with metal ions, thus reducing dietary absorption of essential minerals. It is a dire need to develop sustainable approaches for environmentally-friendly utilization for this valuable and abundant natural resource. To this end, we engineered Pichia pastoris to express and secrete phytase in a “made-to-order” fashion in response to external level of inorganic phosphate (Pi). Responsiveness to external Pi level was achieved by generating a Pi-responsive promoter library using directed evolution. The resultant yeast strains were proven to liberate Pi from wheat-based meal in a simulated in vitro digestion model. These yeast-based whole cell biocatalysts may serve as platform hosts with potential applications in food processing industry and animal waste treatment.
1. Introduction Phosphorus is one of the essential nutrients for all organisms and is a crucial building block of ATP, nucleic acids, proteins and phospholipids. This non-metal is also involved in various metabolic activities such as phosphorylation and glycolysis [1]. The principle storage form of phosphate in plant tissues is phytate (myo-inositol hexakisphosphate or myo-inositol 1,2,3,4,5,6-hexakis dihydrogen phosphate), representing > 60 % of their total phosphorus content [2]. Phytate is abundant in legumes, cereals and oilseeds used in animal and human diets [3,4]. However, phytate is also an “antinutrient” which readily forms stable complexes with divalent metal ions (e.g. Zn2+, Fe2+, Mg2+ and Ca2+), protein, carbohydrate and lipid, rendering low bioavailability of essential dietary nutrients [5]. Phytate can be decomposed by the phosphorylase phytase to liberate inorganic phosphate (Pi). Ruminants such as cattle, sheep and goat have sufficient phytase activity in their digestive system to release Pi for absorption and assimilation [4,6]. However, simple-stomached (monogastric) animals, including human, swine and poultry, cannot utilize phytate as a nutrient source. Thus, the dietary phytate is excreted and causes severe environmental pollution (eutrophication) [6]. The current practice of increasing phosphorus content in diet involves
⁎
costly exogenous supplementation of Pi. An alternative approach is the addition of phytase. Phytase is gaining international attention for its diverse applications in feed industry, human nutrition and animal waste treatment [7,8]. A recent report from Global Info Research estimated a rapid growth of phytase sale from US$380 million in 2019 to US$590 million in 2024 [9]. Microbial phytases have been commercially available for more than ten years, the most notable one being the phytase from the filamentous fungus Aspergillus niger NRRL 3135 sold under the tradename of “Natuphos” by BASF. Other commercially available phytases prepared from eukaryotic systems include Ronozyme P (DSM Nutritional Products), OptiPhos (Phytex LLC) and Phyzyme XP (Danisco Animal Nutrition) [8,10]. Recombinant production of microbial phytases has been achieved. For instance, “Natuphos” is produced by expressing the phyA gene of A. niger NRRL 3135 in A. niger CBS 513.88 [11]. Other yeasts such as Pichia pastoris and Saccharomyces cerevisiae have also been used for largescale high-level heterologous protein expression as they are considered as “generally recognized as safe” (GRAS) organisms [12,13]. In terms of industrial applications, P. pastoris has been gaining attention in recent years. Not only P. pastoris shares the physiological features with S. cerevisiae (e.g., ease of genetic modification, fast and robust growth in defined culture media, existence of post-translational modification
Corresponding authors. E-mail addresses: [email protected] (W.-P. Fong), [email protected] (P.W.-K. Tsang).
https://doi.org/10.1016/j.enzmictec.2020.109533 Received 10 October 2019; Received in revised form 30 January 2020; Accepted 6 February 2020 Available online 07 February 2020 0141-0229/ © 2020 Elsevier Inc. All rights reserved.
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
machinery, high yield and capability of secreting protein), it also possesses unique features beneficial to heterologous protein production [14]. P. pastoris is Crabtree effect negative, meaning that it could be cultivated at a higher cell density and protein production titer in high external glucose concentration under aerobic condition. The posttranslational glycosylation modification has several functions on the protein. Sometimes, expressed proteins cannot fold properly to achieve their function, while in other cases, proteins are not stable if they are not glycosylated. P. pastoris strain has the ability to glycosylate the protein [15,16]. A number of recombinant proteins produced in P. pastoris is available in the market, including a fungal phytase used as an animal feed additive and two FDA-approved drugs, Kalbitor® and Jetrea® [17]. In the present study, P. pastoris GS115 (his4), a variant of Komagataella phaffii (NRRL Y-11430) made defective in histidinol dehydrogenase by nitrosoguanidine mutagenesis [18] was used. It has been widely used as recipient strain for heterologous protein expression [19,20]. A Pi-responsive promoter (PPHO89) has been identified [21]. The PPHO89 promoter was highly activated when cells were grown in a Pilimited environment but was suppressed under completely Pi-exhausted condition. In a study to drive lipase (CLLip) protein expression, the productivity of PPHO89 was much higher, being 7.4 and 14.8-fold respectively, than those of PTEF1 and PGAP, two other strong promoters in P. pastoris [21]. Such results indicate that the transcriptional activity of PPHO89 is high enough to allow the recombinant protein to accumulate to a high level for industrial application. Nevertheless, even though phytase expression has been studied in P. pastoris and PPHO89 has been used to express protein in P. pastoris, the PPHO89 promoter has not yet been applied to drive the expression of phytase in P. pastoris or utilized in the phytate hydrolysis industry. In an attempt to address the above-mentioned nutritional and environmental concerns of phosphorus utilization, we engineered P. pastoris to secrete thermostable phytases to avoid the cumbersome and tedious protein purification steps. As heterologous protein production, especially in large quantity, could be a severe metabolic burden to the host cells, secretion of phytase from the engineered P. pastoris, using a Pi-responsive promoter, was constructed in a “made-to-order” fashion in response to external Pi concentration. The resultant P. pastoris could liberate Pi from wheat-based meal in a simulated in vitro digestion model.
was used for protein expression. It was routinely cultured in YPD medium (1 % w/v yeast extract, 2 % w/v peptone, 2 % w/v dextrose) with appropriate antibiotic at 30 °C in a shaking incubator at 200 rpm. Media were supplemented with zeocin (25 μg/ml or 100 μg/ml) or kanamycin (50 μg/ml) as required. Solid media were prepared by adding 2 % agar. The plasmid pPICZαA (Invitrogen), containing PAOX1 promoter, α-factor secretion signal, c-myc epitope, (His)6 tag and zeocin resistance gene, was used for cloning. Plasmid pKT127, containing the yeast enhanced green fluorescence protein (yEGFP) reporter, was obtained from Euroscarf. All restriction enzymes were obtained from New England Biolabs. 2.2. Plasmid construction and transformation of P. pastoris Two thermostable bacterial phytases, Yersinia frederiksenii phytase variant Ser51Thr (YF) [22] and A. niger myo-inositol hexaphosphate phosphohydrolyase (phyA) [23], were studied. The codons of these two phytase genes were optimized for expression in P. pastoris with reference to the preferred codon usage of the twenty natural amino acids using DNA2.0 software (see Supplementary Material). The two “optimized” phytase genes were obtained by total gene synthesis and the nucleotide sequences were verified by automated DNA sequencing (TechDragon). The PPHO89 promoter sequence (Genbank: EU938135) was amplified from Pichia genomic DNA using gene-specific primers (Forward: gaAGATCTGGAGCCAGCACAGGAATCG (BglII); Reverse: ccc AAGCTTTGTGAATGATTATAAGATGAGTCATC (HindIII)). After confirming the sequence identity, the PPHO89 promoter sequence was cloned into plasmid pPICZαA to replace the resident PAOX1 promoter sequence, generating pPICZαA-PPHO89. The two “optimized” phytase genes were cloned into pPICZαA-PPHO89 to generate the plasmids pPICZαA-PPHO89-YF and plasmid pPICZαA-PPHO89-phyA (Fig. 1). Pichia transformation was carried out by a “hybrid” method using electroporation [24]. Plasmids were linearized at PPHO89 promoter to facilitate chromosome integration via homologous recombinant in the Pichia genome. Briefly, log-phase P. pastoris GS115 was harvested, washed, and resuspended in 9 ml ice-cold BEDS solution (10 mM bicineNaOH, 3 % (v/v) ethylene glycol, 5 % (v/v) dimethyl sulfoxide, 1 M sorbitol, pH 8.3) and 1 ml of 1 M dithiothreitol (DTT). After a 5-min incubation at 30 °C with gentle shaking (100 rpm), the yeast cells were harvested by centrifugation and resuspended in 1 ml of BEDS solution. Aliquot (40 μl) of electrocompetent cells was mixed with the linearized transforming plasmids in a 2-mm electroporation cuvette. This transformation mixture was incubated on ice for 2 min and pulsed in an electroporator (Gene Pulser® II electroporator) with the following settings: charging voltage 1,500 V; resistance 200 Ω; capacitance 25 μF. The electroporated yeast cells were immediately mixed with 0.5 ml of 1 M sorbitol and 0.5 ml of YPD, incubated at 30 °C for 2 h with agitation (150 rpm), and then spread on YPD agar plates containing zeocin
2. Materials and methods 2.1. Strains, plasmids and growth conditions Escherichia coli DH5α was used as the host for plasmid propagation. It was routinely cultured in LB medium supplemented with appropriate antibiotic at 37 °C in a shaking incubator at 200 rpm. P. pastoris GS115
Fig. 1. Schematic diagram of the constructs (YF, phyA or yEGFP). Relevant restriction sites (BglII, HindIII, EcoRI, XbaI and NotI) are shown. PPHO89, α-factor (N-terminal α-factor secretion signal), phytase (YF, phyA) or yEGFP gene, c-myc/ (His)6 (antibody targeting sites), AOX1TT (AOX1 transcription termination region) and Zeocin (antibiotic resistance gene) are indicated.
2
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
(100 μg/ml). Pichia transformants were scored after a 4-day incubation at 30 °C.
2.6. Simulated in vitro digestion model In vitro digestion test mimics the digestive conditions (temperature and pH) of monogastric animals [28]. The yeast strains were cultured overnight in YPD medium, washed twice in distilled water and resuspended in 1.5 ml distilled water to obtain a concentrated yeast preparation with an initial OD600nm of 8. Ten U of commercial phytase (SunSon) dissolved in distilled water was used as positive control whereas distilled water by itself was used as negative control. Yeast and the two controls were added (pH 5.8–6.0) into three separate 10 ml plastic syringes (without luer-locks), each containing 1.0 g of hydrated wheat-based meal. After incubation at 40 °C for 30 min, the reaction mixture was acidified by HCl to pH 2.7 - 2.9. Pepsin (460 μl, 6,000 U/ ml, Sigma), was added and incubated at 40 °C for 45 min to simulate proventriculus/gizzard digestion. Duodenal digestion was then carried out by adding NaHCO3 to neutralize the reaction mixture to pH 5.9–6.1, followed by pancreatin (500 μl, 3.7 mg/ml, Sigma) for another 2 h incubation at 40 °C. During the whole digestion simulation, samples were aliquoted at various time intervals for the determination of Pi content. To confirm the cell viability of the engineered yeast in the in vitro digestion model, aliquots were taken at various time intervals, diluted appropriately, and then spread on YPD agar plate with zeocin (100 μg/ ml). The colony number in the plates was counted after 4 days of cultivation in a 30 °C incubator. The effect of Pi concentration on the yeast expression of phytase in the in vitro digestion system was studied. The wheat-based meal was found to contain a significant amount of endogenous Pi (∼0.8 g/kg). To lower the initial concentration of Pi in the simulation, a lower amount of wheat-based meal was used. On the other hand, to obtain a higher concentration of Pi, exogenous NaH2PO4•2H2O was added into the initial incubation mixture. Digestion was carried out as indicated above and aliquots were taken for measuring the Pi content at the end of the simulation process.
2.3. Phytase expression and purification A single colony of the phytase-containing Pichia transformants grown in zeocin YPD agar was inoculated into 10 ml of YPD medium. After an overnight incubation at 30 °C, 400 μl of culture was transferred to 50 ml of new YPD broth. After another 24-h incubation at 30 °C, it was transferred to 22 °C and incubated for 72 h to allow protein expression. The YPD medium originally contained 0.11 g/l of NaH2PO4•2H2O. Additional NaH2PO4•2H2O was added into the medium to achieve a series of concentration from 0.11 to 1.00 g/l as the only Pi source for activation of the Pi-limited PPHO89 promoter. To study the secreted phytase, the culture medium was centrifuged at 10,500 g for 2 min to obtain the supernatant for extracellular phytase determination. The resultant cell pellet was resuspended in the lysis buffer, with the volume equal to the original yeast preparation so that the activities of the extracellular and intracellular phytases can be directly compared. The intracellular phytase was released through cell disruption by the glass beads method [25]. The bead/lysate mixture was centrifuged at 18,000 g at 4℃ for 15 min. The activity of the supernatant, reflecting the intracellular phytase, was measured. To purify the secreted phytase, the proteins obtained after centrifugation of the original culture medium were precipitated with 40 % ammonium sulfate and resuspended in 0.1 M Tris−HCl buffer, pH 7.5. After dialysis for 48 h with three changes of buffer, phytase purification was performed by using the Qiagen Ni-NTA spin kit. The His-tagged phytase was eluted in 250 mM imidazole, 0.1 M Tris−HCl buffer, pH 8.0. The purity of the phytase preparations was checked by SDS-polyacrylamide gel electrophoresis. 2.4. Determination of phytase activity
2.7. Statistical analysis
Phytase activity of the Pichia transformants was determined by following the Pi liberated from the phytate substrate. Briefly, culture supernatant was mixed with 5 mM of sodium phytate (1:9, v/v) in 0.1 M glycine−HCl, pH 2.5, and incubated at 37 °C with agitation (250 rpm) for 15 min, during which the reaction rate was shown to remain initial. The reaction was terminated by the addition of 10 % trichloroacetic acid. The amount of liberated Pi was quantified with the ammonium molybdate method [26] after mixing with freshly prepared colour reagent (4 vol. of 1.5 % ammonium molybdate in 5.5 % H2SO4 + 1 vol. of 2.7 % FeSO4). One unit (U) of phytase activity was defined as the amount of enzyme that yields 1 μmol of Pi per min.
All data were analyzed by using Microsoft Excel and GraphPad Prism. Statistical analysis was calculated in GraphPad Prism using ANOVA. A p value smaller than 0.05 was considered as statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. 3. Results and discussion 3.1. Construction of P. pastoris for secretory phytase production We aimed to engineer P. pastoris to produce phytase in response to external Pi concentration. Pichia transformants, denoted as GS115PPHO89-YF and GS115-PPHO89-phyA, for secretory phytase production were obtained. Under the control of native PPHO89 promoter and an initial Pi (NaH2PO4•2H2O) concentration of 0.11 g/l, extracellular phytase expression from the Pichia transformants was evident: 0.35 U/ ml for GS115-PPHO89-YF and 0.34 U/ml for GS115-PPHO89-phyA (Fig. 2A). The Pichia transformants were quite stable. We have used different streak generations (more than ten streak generations apart under zeocin antibiotic stress) of yeasts for protein expression. The activities of the secreted phytases obtained were within 30 % of each other, indicating the success of plasmid integration into the yeast chromosome. On the other hand, very little intracellular phytase activity (∼0.03 U/ml), similar to that in wild type GS115 (GS115-WT), could be detected in the cell lysate (Fig. 2A).
2.5. Directed evolution of Pi-responsive promoter The yEGFP gene was obtained by PCR using gene-specific primers (Forward: cgGAATTCA TGTCTAAAGGTGAAG (EcoRI); Reverse: cg GCGGCCGCTTTGTACAATTCATCC(NotI)) and plasmid pKT127 as template. The yEGFP gene sequence was cloned into plasmid pPICZαAPPHO89 to generate pPICZαA-PPHO89-yEGFP. Error-prone PCR was employed to generate the promoter library using PPHO89-specific primers and pPICZαA-PPHO89-yEGFP as template in a reaction mixture containing 10 mM Tris−HCl, 50 mM KCl, 10 mM MgCl2, 0.5 mM MnCl2, 1 mM dCTP, 1 mM dTTP, 0.2 mM dATP, 0.2 mM dGTP, 2.5 U Taq DNA polymerase, and under the conditions: 94 °C 1 min, 54 °C 1 min, 72 °C 2 min for 25 cycles [27]. The PCR mixture was cloned into plasmid pPICZαA-PPHO89-yEGFP to replace the resident PPHO89. Pichia transformation was performed as described above. Green fluorescence was detected with an excitation wavelength of 488 nm and an emission wavelength of 515 nm.
3.2. Kinetic properties of the purified phytases The secreted phytases were purified using Ni-NTA metal affinity chromatography. The purity of the isolated phytases was confirmed by SDS-PAGE (Fig. 2B). The apparent molecular weights of the two 3
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
Fig. 2. Phytase expression in Pichia transformants. (A) Extracellular and intracellular phytases were separated by centrifugation. The activities in the supernatant and the cell lysate represent the extracellular and the intracellular phytases respectively. Phytase activity was measured with 5 mM sodium phytate in 0.1 M glycine−HCl, pH 2.5 at room temperature. The data represent average ± SEM of three independent experiments, each performed in duplicate. (B) SDS-PAGE analyses of the purified YF and phyA after Ni-NTA metal affinity chromatography. The proteins were stained with Coomassie blue. The protein molecular weight ladder (M) is also shown for comparison.
phytases were similar to the predicted values, indicating that they are not glycosylated, in contrast to those phyA produced in A. niger, S. cerevisiae and Kluyveromyces lactis [23,29–31]. Glycosylation might affect the properties of the enzyme. While the activity of phyA produced in K. lactis remains unchanged [23], phyA produced in S. cerevisiae showed losses of 9 % of its activity and 40 % of its thermostability after deglycosylation [31]. The kinetic properties of the enzymes were evaluated. At room temperature, both YF and phyA exhibited similar pH-activity profile with optimal activity at acidic pH values. At pH 7.0, enzymatic activity dropped to almost undetectable levels (Fig. 3A). For the effect of temperature, both phytases possessed highest activity at 45 °C, an almost 2or 3-fold increase when compared with that at room temperature (Fig. 3B). The stability of the phytase was tested at different pH and temperature. At pH 2.5, YF and phyA retained 73 % and 89 % of activity after 2-h incubation; while at pH 5.5, they retained 45 % and 33 % of activity, respectively (Fig. 3C). Both phytases were stable at elevated temperature: YF retained more than 90 % of activity after 4-h
incubation at 40 °C; while phyA retained 73 % of activity upon the same treatment (Fig. 3D). These kinetic measurements revealed that both phytases exhibited highest catalytic activity at acidic pH values and had an optimal temperature at 45 °C, similar to those reported in previous studies [22,23]. The strong pH and temperature stabilities of the phytases allowed them to be used for phytate digestion in the animal digestive tracts. 3.3. Correlation between external Pi concentration and phytase production level Under the control of PPHO89 promoter, the expression of both secreted phytases was inversely related to the increase in external Pi concentration, as shown in both activity assay (Fig. 4A and B) and Western blot analysis (Fig. 4C and D). Phytase expression was reduced by 4.5- to 9.5-fold upon the increase of external Pi concentration (NaH2PO4•2H2O) from 0.11 g/l to 1.00 g/l in the YPD growth medium. Such result is similar to a previous report in which the CLLip lipase Fig. 3. Kinetic properties of the purified phytases. The activity of the phytase YF or phyA was measured with 5 mM sodium phytate in 0.1 M buffer solution. (A) pH-activity profile (glycine−HCl for pH 1.5–3.0; sodium acetate for pH 3.0-5.5; Tris-acetate for pH 5.5-6.5; and Tris-HCl for pH 6.5–7.5). The assay was carried out at room temperature. (B) Temperatureactivity profile. The assay was carried out at pH 2.5. (C) Stability at pH 2.5 and 5.5. The phytase activity was determined after incubation at room temperature in 0.1 M glycine−HCl, pH 2.5 or 0.1 M Tris-acetate, pH 5.5 for various times. (D) Stability at 40 °C. The phytase activity was determined after incubation in 0.1 M glycine−HCl, pH 2.5 at 40 °C for various times. The data represent average ± SEM of three independent experiments, each performed in duplicate.
4
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
Fig. 4. Effect of external Pi concentration on phytase expression. Pichia transformants (GS115-PPHO89-YF and GS115PPHO89-phyA) were grown in YPD medium containing different concentrations of Pi (g/l NaH2PO4•2H2O, shown in the parenthesis). The crude culture supernatants were used for the analyses. (A and B) Phytase activity. The activity was determined with 5 mM sodium phytate in 0.1 M glycine−HCl, pH 2.5. The data represent average ± SEM of three independent experiments, each performed in duplicate. (C and D) Western blot analysis. The phytases were detected using (His)6 tag monoclonal antibody as the primary antibody.
expression correlates with the different activities of PPHO89 promoter under different Pi concentrations [21]. In P. pastoris, the PPHO89 promoter is originally used to regulate the expression of a sodium phosphate symporter (PHO89 gene) [21] which controls Pi absorption and allows normal cell growth. Such Pi homeostasis is important for yeast and other eukaryotic organisms [21,32]. Nevertheless, replacing the PHO89 gene by the phytase gene did not seem to have any significant effect on the yeast growth (data not shown). This is not entirely unexpected as its role can be compensated by some other functionally similar genes, for example, PHO5 and PHO84 [33,34]. In our P. pastoris
PPHO89-phytase system, the limited Pi or excess Pi could turn “on” or “off” the promoter on phytase expression. The expressed phytase could digest the phytate substrate and release Pi which, in turn, regulates the level of phytase expression in a feedback loop. 3.4. Directed evolution of Pi-responsive promoter Three rounds of error-prone PCR were conducted to generate mutant PPHO89 promoter sequences for enhanced sensitivity to variations of external Pi concentration. In total, more than 2000 mutants were Fig. 5. Evaluation of mutant PPHO89 promoter strength. (A) Wild type PPHO89 and mutant PPHO89ΔTT promoters’ strength, measured as the level of YF phytase expression, was determined in YPD medium with different Pi concentrations (g/l NaH2PO4•2H2O). The data represent average ± SEM of three independent experiments, each performed in duplicate. (B) Sequence analysis of wild type PPHO89 and PPHO89ΔTT promoter sequences showing a TT-deletion. Pho4p binding sites, including UASp1 (CACGTT with low affinity to pho4p) at position -583 and UASp2 (CACGTG with high affinity to pho4p) at position -414, together with TATAAA box (underlined, TA in circle) at position -101, Kozak consensus sequence (CACA labeled in a box) at position -1, putative translation initiation site CACAATG (start codon ATG is underlined), transcription start site (TSS), and open reading frame (ORF) are also indicated.
5
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
Fig. 6. Simulated in vitro digestion model. (A) Hydrated wheat-based meal was incubated with commercial phytase, wild type GS115 or different Pichia transformants (GS115-PPHO89-YF, GS115-PPHO899ΔTT-YF, and YF; GS115PPHO89-phyA). Distilled water was used as the control. Samples were aliquoted at time intervals to determine the Pi concentration. The data represent average ± SEM of five independent experiments, each performed in duplicate, ****p < 0.0001 when compared with the control. (B) Different initial Pi concentration (g/l, shown in parenthesis) in the mixture was used in the digestion experiment. The amount of phosphate increase after the 3.25 h of simulation was determined. The data represent average ± SEM of three independent experiments, each performed in duplicate. *p < 0.05, ***p < 0.001 when compared with the control; **p < 0.01, when GS115PPHO89-YF with initial Pi concentrations of 0.31 and 1.15 g/l were compared. (C) Yeast cell number and viability. During the digestion simulation, samples were taken at different time intervals, diluted and spread on the selective YPD agar plate containing 100 μg/ml zeocin. The cell number was counted after 4 days. The data represent average ± SEM of three independent experiments, each performed in duplicate.
screened. The strengths of the resultant mutant PPHO89 promoters in GS115-PPHO89-yEGFP were evaluated by measuring the fluorescence intensity of yEGFP in culture supernatant. A PPHO89 mutants’ library, including 36 mutants with activities spanning between 6%–170% of the original one, was generated and studied. Several representative mutants were selected to drive YF phytase expression. Among them, PPHO89ΔTT was found to exhibit an enhanced sensitivity to regulate YF phytase expression in response to external Pi concentration (Fig. 5A). DNA sequence analysis revealed a deletion of two T nucleotides at positions -597 and -598 (Fig. 5B). There is a CACGTT motif at position -583, which is very close to the double T nucleotides deletion. Previous study reported a PHO regulatory system in which the Pi signal could be conveyed to PHO8 gene by the binding of Pho4p, a positive regulatory factor, to the promoter binding sites (two binding sequences, UASp1: CACGTT with low affinity to pho4p, and UASp2: CACGTG with high affinity to pho4p) [35,36]. The PHO89 promoter has the same consensus binding site, suggesting that the P. pastoris-derived PHO89 gene is also under the control of the PHO regulatory system [21]. Therefore, the PPHO89ΔTT promoter might have a stronger strength and an improvement in transcription efficiency as the structure of the binding site UASp1 was altered.
pastoris was used. Indeed, the amount of liberated Pi from the phytasesecreting yeasts was comparable to that obtained by 10 U of commercial phytase (Fig. 6A). With the present experimental setup of using 1 g of wheat-based meal, 10 U should be in great excess as the usual amount of phytase used in the feed industry is only 1 U/g diet [28]. When the digestion simulation was carried out under different initial Pi concentrations, it was found that the Pi liberated from the wheat-based meal, which indirectly reflects the phytase expression, decreased with an increase in initial Pi concentration (Fig. 6B). For example, with an initial concentration of 1.15 g/l, the Pi increase after the digestion simulation was only 0.18 g/l, about 50 % when compared with the increase under an initial Pi concentration of 0.31 g/l. To conclude, a lower Pi concentration environment will stimulate the engineered yeast to express and secrete a large amount of phytase which can then digest the wheat-based meal more efficiently, resulting in a greater release of Pi from the phytate in the wheat-based meal. Such negative feedback regulation of Pi on phytase expression in the digestion simulation model is consistent with the result obtained under the YPD medium culture condition (Fig. 4). In the animal feed industry, exogenous phytase could be added into the diet directly or introduced through the addition of phytase-expressing yeast using the whole-cell biocatalyst concept. P. pastoris has been engineered to express Citrobacter amalonaticus phytase on the cell surface. In vitro digestion experiments demonstrated that the phytase attached on the cell surface has similar or even better efficiency in liberating Pi from the diet when compared with the free enzyme [37,38]. Yeast as whole cell feed supplement can also provide additional nutrients, for example, biotin and niacin. It has also been reported that certain cellular components of S. cerevisiae could improve
3.5. Simulated in vitro digestion model Addition of the yeast GS115-PPHO89-YF, GS115-PPHO89-phyA or GS115-PPHO89ΔTT-YF to wheat-based meal resulted in an increased production of Pi in the first hour of incubation. By the end of the whole process (3.25 h), the Pi concentration in the digestion mixture was ∼1.4 g/l, significantly higher than the control in which wild type P. 6
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
the growth performance, meat quality and ileal mucosa development of broiler chicks [39]. Nevertheless, whether it is the phytase itself or yeast with phytase expressed on the cell surface, it is difficult to have just the right amount of phytase activity. Usually, they are added in excess and the excess one will be released into the environment and gradually works to liberate more Pi into the environment, finally leading to phosphorus pollution again. Direct introduction of phytase supplement into the animal feed industry needs complicated, expensive, tedious isolation and purification. A Pi-responsive system could regulate the supply and demand relationship of phytase and phytate in a straightforward way. Another distinct advantage for using the phytase-secreting yeast in the animal feed industry is that the GRAS organism P. pastoris can be used directly and need not go through the high temperature during the feed pelleting process, which might inactivate the enzyme. To evaluate the cell viability of the three different types of engineered phytase-secreting yeast in the in vitro digestion condition, samples were aliquoted at different time points to analyze the cell number using the spread plate methods. During the whole process, the engineered cell number remained the same (Fig. 6C), suggesting that the phytase-secreting yeast could survive under the digestion condition. Nevertheless, even though the yeast cells could survive, their proliferation was extremely slow. As a comparison, P. pastoris has a doubling time of ∼90 min in YPD medium and ∼140 min in synthetic media during the exponential phase of growth at 30 °C [40]. For future application of phytase-secreting yeast as whole cell catalyst, multiple feeding of the engineered P. pastoris yeast to the monogastric animals might be necessary. The yeast feed supplement could form colonies of long-standing in the animal stomach or intestine tract and produce phytase in response to the environment Pi concentration.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.enzmictec.2020. 109533. References [1] M. Pasek, A role for phosphorus redox in emerging and modern biochemistry, Curr. Opin. Chem. Biol. 49 (2019) 53–58, https://doi.org/10.1016/j.cbpa.2018.09.018. [2] M. Jiang, Y. Liu, Y. Liu, Y. Tan, J. Huang, Q. Shu, Mutation of inositol 1,3,4-trisphosphate 5/6-kinase6 impairs plant growth and phytic acid synthesis in rice, Plants 8 (2019) 1–12, https://doi.org/10.3390/plants8050114. [3] J.J. Barrero, J.C. Casler, F. Valero, P. Ferrer, B.S. Glick, An improved secretion signal enhances the secretion of model proteins from Pichia pastoris, Microb. Cell Fact. 17 (2018) 1–13, https://doi.org/10.1186/s12934-018-1009-5. [4] X.G. Lei, J.D. Weaver, E. Mullaney, A.H. Ullah, M.J. Azain, Phytase, a new life for an “old” enzyme, Annu. Rev. Anim. Biosci. 1 (2012) 283–309, https://doi.org/10. 1146/annurev-animal-031412-103717. [5] C.L. Walk, S.V. Rama Rao, Dietary phytate has a greater anti-nutrient effect on feed conversion ratio compared to body weight gain and greater doses of phytase are required to alleviate this effect as evidenced by prediction equations on growth performance, bone ash and phytate degradation in broilers, Poult. Sci. (2019) pez469, https://doi.org/10.3382/ps/pez469 [Epub ahead of print]. [6] V. Kumar, A.K. Sinha, H.P.S. Makkar, K. Becker, Dietary roles of phytate and phytase in human nutrition: a review, Food Chem. 120 (2010) 945–959, https:// doi.org/10.1016/J.FOODCHEM.2009.11.052. [7] M.E.A. El-Hack, M. Alagawany, M. Arif, M. Emam, M. Saeed, M.A. Arain, F.A. Siyal, A. Patra, S.S. Elnesr, R.U. Khan, The uses of microbial phytase as a feed additive in poultry nutrition -a review, Ann. Anim. Sci. 18 (2018) 639–658, https://doi.org/10. 2478/aoas-2018-0009. [8] K. Bhavsar, J.M. Khire, Current research and future perspectives of phytase bioprocessing, RSC Adv. 4 (2014) 26677–26691, https://doi.org/10.1039/ C4RA03445G. [9] Global Info Research, Global Phytases Market 2019, (2019) (Accessed 28 January 2020), https://www.globalinforesearch.com/global-phytases-market_p172237. html. [10] C.K. Jones, M.D. Tokach, S.S. Dritz, B.W. Ratliff, N.L. Horn, R.D. Goodband, J.M. DeRouchey, R.C. Sulabo, J.L. Nelssen, Efficacy of different commercial phytase enzymes and development of an available phosphorus release curve for Escherichia coli-derived phytases in nursery pigs, J. Anim. Sci. 88 (2010) 3631–3644, https:// doi.org/10.2527/jas.2010-2936. [11] H.J. Pel, J.H. de Winde, D.B. Archer, P.S. Dyer, G. Hofmann, P.J. Schaap, G. Turner, R.P. de Vries, R. Albang, K. Albermann, M.R. Andersen, J.D. Bendtsen, J.A.E. Benen, M. van den Berg, S. Breestraat, M.X. Caddick, R. Contreras, M. Cornell, P.M. Coutinho, E.G.J. Danchin, A.J.M. Debets, P. Dekker, P.W.M. van Dijck, A. van Dijk, L. Dijkhuizen, A.J.M. Driessen, C. d’Enfert, S. Geysens, C. Goosen, G.S.P. Groot, P.W.J. de Groot, T. Guillemette, B. Henrissat, M. Herweijer, J.P.T.W. van den Hombergh, C.A.M.J.J. van den Hondel, R.T.J.M. van der Heijden, R.M. van der Kaaij, F.M. Klis, H.J. Kools, C.P. Kubicek, P.A. van Kuyk, J. Lauber, X. Lu, M.J.E.C. van der Maarel, R. Meulenberg, H. Menke, M.A. Mortimer, J. Nielsen, S.G. Oliver, M. Olsthoorn, K. Pal, N.N.M.E. van Peij, A.F.J. Ram, U. Rinas, J.A. Roubos, C.M.J. Sagt, M. Schmoll, J. Sun, D. Ussery, J. Varga, W. Vervecken, P.J.J. van de Vondervoort, H. Wedler, H.A.B. Wösten, A.-P. Zeng, A.J.J. van Ooyen, J. Visser, H. Stam, Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88, Nat. Biotechnol. 25 (2007) 221–231, https://doi.org/10.1038/nbt1282. [12] S.C. dos Santos, I. Sá-Correia, Yeast toxicogenomics: lessons from a eukaryotic cell model and cell factory, Curr. Opin. Biotechnol. 33 (2015) 183–191, https://doi.org/ 10.1016/J.COPBIO.2015.03.001. [13] J. Steensels, T. Snoek, E. Meersman, M. Picca Nicolino, K. Voordeckers, K.J. Verstrepen, Improving industrial yeast strains: exploiting natural and artificial diversity, FEMS Microbiol. Rev. 38 (2014) 947–995, https://doi.org/10.1111/ 1574-6976.12073. [14] A. Berlec, B. Štrukelj, Current state and recent advances in biopharmaceutical production in Escherichia coli, yeasts and mammalian cells, J. Ind. Microbiol. Biotechnol. 40 (2013) 257–274, https://doi.org/10.1007/s10295-013-1235-0. [15] J.L. Martínez, L. Liu, D. Petranovic, J. Nielsen, Pharmaceutical protein production by yeast: towards production of human blood proteins by microbial fermentation, Curr. Opin. Biotechnol. 23 (2012) 965–971, https://doi.org/10.1016/J.COPBIO. 2012.03.011. [16] B.K. Choi, P. Bobrowicz, R.C. Davidson, S.R. Hamilton, D.H. Kung, H. Li, R.G. Miele, J.H. Nett, S. Wildt, T.U. Gerngross, Use of combinatorial genetic libraries to humanize N-linked glycosylation in the yeast Pichia pastoris, Proc. Natl. Acad. Sci. 100 (2003) 5022–5027, https://doi.org/10.1073/pnas.0931263100. [17] M. Ahmad, M. Hirz, H. Pichler, H. Schwab, Protein expression in Pichia pastoris: recent achievements and perspectives for heterologous protein production, Appl. Microbiol. Biotechnol. 98 (2014) 5301–5317, https://doi.org/10.1007/s00253014-5732-5. [18] J.M. Cregg, K.J. Barringer, A.Y. Hessler, K.R. Madden, Pichia pastoris as a host system for transformations, Mol. Cell. Biol. 5 (1985) 3376–3385, https://doi.org/ 10.1128/mcb.5.12.3376. [19] O.V. Berezina, J. Herlet, S.V. Rykov, P. Kornberger, A. Zavyalov, D. Kozlov,
4. Conclusion This study demonstrated the successful expression of two thermostable phytases in P. pastoris for phytate hydrolysis. Both secreted phytases had good pH and temperature stabilities. More importantly, the phytase expression could be regulated in response to variations in external Pi concentration: a “made-to-order” state driven by the Pi-responsive promoter. We used a simulated in vitro digestion model with hydrated wheat-based meal to evaluate the potential application of the engineered P. pastoris in feed industry and animal waste treatment. Our results strongly indicated that the engineered P. pastoris could release Pi with an efficiency comparable with commercial phytase, justifying our innovative concept in phytate hydrolysis using whole cell biocatalyst. Further feasibility studies on the engineered P. pastoris is warranted, for instance, by adding them in feed pellet for monogastric animals to follow the in vivo digestion of phytate Author agreement We certify that all authors have seen and approved the final version of the manuscript being submitted. The manuscript represents the authors’ original work, has not received prior publication and is not under consideration for publication elsewhere. Declaration of Competing Interest None. Acknowledgement The work described in this paper was supported by a grant from the Research Grants Council of the Hong Kong Special Administrative Region, China (Project No.: UGC/FDS25/M02/16). 7
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
[20]
[21]
[22] [23] [24]
[25] [26] [27] [28]
[29]
L. Sakhibgaraeva, I. Krestyanova, W.H. Schwarz, V.V. Zverlov, W. Liebl, S.V. Yarotsky, Thermostable multifunctional GH74 xyloglucanase from Myceliophthora thermophila: high-level expression in Pichia pastoris and characterization of the recombinant protein, Appl. Microbiol. Biotechnol. 101 (2017) 5653–5666, https://doi.org/10.1007/s00253-017-8297-2. H. He, C. Zhai, M. Mei, Y. Rao, Y. Liu, F. Wang, L. Ma, Z. Jiang, G. Zhang, L. Yi, Functional expression of porcine interferon-α using a combinational strategy in Pichia pastoris GS115, Enzyme Microb. Technol. 122 (2019) 55–63, https://doi.org/ 10.1016/j.enzmictec.2018.12.005. J. Ahn, J. Hong, M. Park, H. Lee, E. Lee, C. Kim, J. Lee, E.S. Choi, J.K. Jung, H. Lee, Phosphate-responsive promoter of a Pichia pastoris sodium phosphate symporter, Appl. Environ. Microbiol. 75 (2009) 3528–3534, https://doi.org/10.1128/AEM. 02913-08. D. Fu, H. Huang, K. Meng, Y. Wang, H. Luo, P. Yang, T. Yuan, B. Yao, Improvement of Yersinia frederiksenii phytase performance by a single amino acid substitution, Biotechnol. Bioeng. 103 (2009) 857–864, https://doi.org/10.1002/bit.22315. M.V. Ushasree, J. Vidya, A. Pandey, Extracellular expression of a thermostable phytase (phyA) in Kluyveromyces lactis, Process Biochem. 49 (2014) 1440–1447, https://doi.org/10.1016/j.procbio.2014.05.010. J. Lin-Cereghino, W.W. Wong, S. Xiong, W. Giang, L.T. Luong, J. Vu, S.D. Johnson, G.P. Lin-Cereghino, Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris, Biotechniques 38 (2005) 44–48, https://doi.org/10.2144/05381BM04. M. Çağlayan, S.H. Wilson, Enzymatic activity assays in yeast cell extracts, Bioprotocol 4 (23) (2014) e1312. H. Bae, L. Yanke, K.J. Cheng, L. Selinger, A novel staining method for detecting phytase activity, J. Microbiol. Methods 39 (1999) 17–22, https://doi.org/10.1016/ S0167-7012(99)00096-2. X. Qin, J. Qian, G. Yao, Y. Zhuang, S. Zhang, J. Chu, GAP promoter library for finetuning of gene expression in Pichia pastoris, Appl. Environ. Microbiol. 77 (2011) 3600–3608, https://doi.org/10.1128/AEM.02843-10. K. Zyłe, D. Gogol, J. Koreleski, S. Światkiewicz, D.R. Ledoux, Simultaneous application of phytase and xylanase to broiler feeds based on wheat: in vitro measurements of phosphorus and pentose release from wheats and wheat-based feeds, J. Sci. Food Agric. 79 (1999) 1832–1840 doi:10.1002/(SICI)1097-0010(199910) 79:13 < 1832::AID-JSFA441 > 3.0.CO;2-Q. W. van Hartingsveldt, C.M.J. van Zeijl, G.M. Harteveld, R.J. Gouka, M.E.G. Suykerbuyk, R.G.M. Luiten, P.A. van Paridon, G.C.M. Selten, A.E. Veenstra,
[30] [31] [32] [33]
[34] [35] [36] [37]
[38]
[39]
[40]
8
R.F.M. van Gorcom, C.A.M.J.J. van den Hondel, Cloning, characterization and overexpression of the phytase-encoding gene (phyA) of Aspergillus niger, Gene 127 (1993) 87–94, https://doi.org/10.1016/0378-1119(93)90620-I. M.V. Ushasree, J. Vidya, A. Pandey, Gene cloning and soluble expression of Aspergillus niger phytase in E. coli cytosol via chaperone co-expression, Biotechnol. Lett. 36 (2014) 85–91, https://doi.org/10.1007/s10529-013-1322-3. Y. Han, D.B. Wilson, X.G. Lei, Expression of an Aspergillus niger phytase gene (phyA) in Saccharomyces cerevisiae, Appl. Environ. Microbiol. 65 (1999) 1915–1918 https://www.ncbi.nlm.nih.gov/pubmed/10223979. D. Secco, C. Wang, H. Shou, J. Whelan, Phosphate homeostasis in the yeast Saccharomyces cerevisiae, the key role of the SPX domain-containing proteins, FEBS Lett. 586 (2012) 289–295, https://doi.org/10.1016/j.febslet.2012.01.036. C. Auesukaree, T. Homma, Y. Kaneko, S. Harashima, Transcriptional regulation of phosphate-responsive genes in low-affinity phosphate-transporter-defective mutants in Saccharomyces cerevisiae, Biochem. Biophys. Res. Commun. 306 (2003) 843–850, https://doi.org/10.1016/S0006-291X(03)01068-4. M. Bun-Ya, M. Nishimura, S. Harashima, Y. Oshima, The PHO84 gene of Saccharomyces cerevisiae encodes an inorganic phosphate transporter, Mol. Cell. Biol. 11 (1991) 3229–3238, https://doi.org/10.1128/MCB.11.6.3229. N. Hayashi, Y. Oshima, Specific cis-acting sequence for PHO8 expression interacts with PHO4 protein, a positive regulatory factor, in Saccharomyces cerevisiae, Mol. Cell. Biol. 11 (1991) 785–794, https://doi.org/10.1128/mcb.11.2.785. Y. Oshima, The phosphatase system in Saccharomyces cerevisiae, Genes Genet. Syst. 72 (1997) 323–334, https://doi.org/10.1021/jo00053a025. C. Li, Y. Lin, Y. Huang, X. Liu, S. Liang, Citrobacter amalonaticus phytase on the cell surface of Pichia pastoris exhibits high pH stability as a promising potential feed supplement, PLoS One 9 (2014) 1–15, https://doi.org/10.1371/journal.pone. 0114728. P. Harnpicharnchai, W. Sornlake, K. Tang, L. Eurwilaichitr, S. Tanapongpipat, Cellsurface phytase on Pichia pastoris cell wall offers great potential as a feed supplement, FEMS Microbiol. Lett. 302 (2010) 8–14, https://doi.org/10.1111/j.15746968.2009.01811.x. A.W. Zhang, B.D. Lee, S.K. Lee, K.W. Lee, G.H. An, K.B. Song, C.H. Lee, Effects of yeast (Saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks, Poult. Sci. 84 (2005) 1015–1021, https://doi.org/10.1093/ps/84.7.1015. F. Sherman, Getting started with yeast, Methods Enzymol. 350 (2002) 3–41, https://doi.org/10.1016/S0076-6879(02)50954-X.
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/enzmictec
Engineering and optimization of phosphate-responsive phytase expression in Pichia pastoris yeast for phytate hydrolysis
T
Zhenming Xiea, Wing-Ping Fonga,*, Paul Wai-Kei Tsangb,* a b
School of Life Sciences, The Chinese University of Hong Kong, Hong Kong, China Technological and Higher Education Institute of Hong Kong, Hong Kong, China
ARTICLE INFO
ABSTRACT
Keywords: Pichia pastoris Phytase Phytate PPHO89 Whole cell bio catalyst
Phytate is the major storage form of phosphorus in plants. It is present in cereals and raw materials of vegetable origin used in animal and human diets. However, non-ruminant animals have little phytase activity in their guts and, therefore, cannot digest phytate. As a result, almost all dietary phytate is discharged into the environment, causing phosphorus pollution. Phytate is also considered as an “antinutrient” for its ability to form insoluble and stable complexes with metal ions, thus reducing dietary absorption of essential minerals. It is a dire need to develop sustainable approaches for environmentally-friendly utilization for this valuable and abundant natural resource. To this end, we engineered Pichia pastoris to express and secrete phytase in a “made-to-order” fashion in response to external level of inorganic phosphate (Pi). Responsiveness to external Pi level was achieved by generating a Pi-responsive promoter library using directed evolution. The resultant yeast strains were proven to liberate Pi from wheat-based meal in a simulated in vitro digestion model. These yeast-based whole cell biocatalysts may serve as platform hosts with potential applications in food processing industry and animal waste treatment.
1. Introduction Phosphorus is one of the essential nutrients for all organisms and is a crucial building block of ATP, nucleic acids, proteins and phospholipids. This non-metal is also involved in various metabolic activities such as phosphorylation and glycolysis [1]. The principle storage form of phosphate in plant tissues is phytate (myo-inositol hexakisphosphate or myo-inositol 1,2,3,4,5,6-hexakis dihydrogen phosphate), representing > 60 % of their total phosphorus content [2]. Phytate is abundant in legumes, cereals and oilseeds used in animal and human diets [3,4]. However, phytate is also an “antinutrient” which readily forms stable complexes with divalent metal ions (e.g. Zn2+, Fe2+, Mg2+ and Ca2+), protein, carbohydrate and lipid, rendering low bioavailability of essential dietary nutrients [5]. Phytate can be decomposed by the phosphorylase phytase to liberate inorganic phosphate (Pi). Ruminants such as cattle, sheep and goat have sufficient phytase activity in their digestive system to release Pi for absorption and assimilation [4,6]. However, simple-stomached (monogastric) animals, including human, swine and poultry, cannot utilize phytate as a nutrient source. Thus, the dietary phytate is excreted and causes severe environmental pollution (eutrophication) [6]. The current practice of increasing phosphorus content in diet involves
⁎
costly exogenous supplementation of Pi. An alternative approach is the addition of phytase. Phytase is gaining international attention for its diverse applications in feed industry, human nutrition and animal waste treatment [7,8]. A recent report from Global Info Research estimated a rapid growth of phytase sale from US$380 million in 2019 to US$590 million in 2024 [9]. Microbial phytases have been commercially available for more than ten years, the most notable one being the phytase from the filamentous fungus Aspergillus niger NRRL 3135 sold under the tradename of “Natuphos” by BASF. Other commercially available phytases prepared from eukaryotic systems include Ronozyme P (DSM Nutritional Products), OptiPhos (Phytex LLC) and Phyzyme XP (Danisco Animal Nutrition) [8,10]. Recombinant production of microbial phytases has been achieved. For instance, “Natuphos” is produced by expressing the phyA gene of A. niger NRRL 3135 in A. niger CBS 513.88 [11]. Other yeasts such as Pichia pastoris and Saccharomyces cerevisiae have also been used for largescale high-level heterologous protein expression as they are considered as “generally recognized as safe” (GRAS) organisms [12,13]. In terms of industrial applications, P. pastoris has been gaining attention in recent years. Not only P. pastoris shares the physiological features with S. cerevisiae (e.g., ease of genetic modification, fast and robust growth in defined culture media, existence of post-translational modification
Corresponding authors. E-mail addresses: [email protected] (W.-P. Fong), [email protected] (P.W.-K. Tsang).
https://doi.org/10.1016/j.enzmictec.2020.109533 Received 10 October 2019; Received in revised form 30 January 2020; Accepted 6 February 2020 Available online 07 February 2020 0141-0229/ © 2020 Elsevier Inc. All rights reserved.
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
machinery, high yield and capability of secreting protein), it also possesses unique features beneficial to heterologous protein production [14]. P. pastoris is Crabtree effect negative, meaning that it could be cultivated at a higher cell density and protein production titer in high external glucose concentration under aerobic condition. The posttranslational glycosylation modification has several functions on the protein. Sometimes, expressed proteins cannot fold properly to achieve their function, while in other cases, proteins are not stable if they are not glycosylated. P. pastoris strain has the ability to glycosylate the protein [15,16]. A number of recombinant proteins produced in P. pastoris is available in the market, including a fungal phytase used as an animal feed additive and two FDA-approved drugs, Kalbitor® and Jetrea® [17]. In the present study, P. pastoris GS115 (his4), a variant of Komagataella phaffii (NRRL Y-11430) made defective in histidinol dehydrogenase by nitrosoguanidine mutagenesis [18] was used. It has been widely used as recipient strain for heterologous protein expression [19,20]. A Pi-responsive promoter (PPHO89) has been identified [21]. The PPHO89 promoter was highly activated when cells were grown in a Pilimited environment but was suppressed under completely Pi-exhausted condition. In a study to drive lipase (CLLip) protein expression, the productivity of PPHO89 was much higher, being 7.4 and 14.8-fold respectively, than those of PTEF1 and PGAP, two other strong promoters in P. pastoris [21]. Such results indicate that the transcriptional activity of PPHO89 is high enough to allow the recombinant protein to accumulate to a high level for industrial application. Nevertheless, even though phytase expression has been studied in P. pastoris and PPHO89 has been used to express protein in P. pastoris, the PPHO89 promoter has not yet been applied to drive the expression of phytase in P. pastoris or utilized in the phytate hydrolysis industry. In an attempt to address the above-mentioned nutritional and environmental concerns of phosphorus utilization, we engineered P. pastoris to secrete thermostable phytases to avoid the cumbersome and tedious protein purification steps. As heterologous protein production, especially in large quantity, could be a severe metabolic burden to the host cells, secretion of phytase from the engineered P. pastoris, using a Pi-responsive promoter, was constructed in a “made-to-order” fashion in response to external Pi concentration. The resultant P. pastoris could liberate Pi from wheat-based meal in a simulated in vitro digestion model.
was used for protein expression. It was routinely cultured in YPD medium (1 % w/v yeast extract, 2 % w/v peptone, 2 % w/v dextrose) with appropriate antibiotic at 30 °C in a shaking incubator at 200 rpm. Media were supplemented with zeocin (25 μg/ml or 100 μg/ml) or kanamycin (50 μg/ml) as required. Solid media were prepared by adding 2 % agar. The plasmid pPICZαA (Invitrogen), containing PAOX1 promoter, α-factor secretion signal, c-myc epitope, (His)6 tag and zeocin resistance gene, was used for cloning. Plasmid pKT127, containing the yeast enhanced green fluorescence protein (yEGFP) reporter, was obtained from Euroscarf. All restriction enzymes were obtained from New England Biolabs. 2.2. Plasmid construction and transformation of P. pastoris Two thermostable bacterial phytases, Yersinia frederiksenii phytase variant Ser51Thr (YF) [22] and A. niger myo-inositol hexaphosphate phosphohydrolyase (phyA) [23], were studied. The codons of these two phytase genes were optimized for expression in P. pastoris with reference to the preferred codon usage of the twenty natural amino acids using DNA2.0 software (see Supplementary Material). The two “optimized” phytase genes were obtained by total gene synthesis and the nucleotide sequences were verified by automated DNA sequencing (TechDragon). The PPHO89 promoter sequence (Genbank: EU938135) was amplified from Pichia genomic DNA using gene-specific primers (Forward: gaAGATCTGGAGCCAGCACAGGAATCG (BglII); Reverse: ccc AAGCTTTGTGAATGATTATAAGATGAGTCATC (HindIII)). After confirming the sequence identity, the PPHO89 promoter sequence was cloned into plasmid pPICZαA to replace the resident PAOX1 promoter sequence, generating pPICZαA-PPHO89. The two “optimized” phytase genes were cloned into pPICZαA-PPHO89 to generate the plasmids pPICZαA-PPHO89-YF and plasmid pPICZαA-PPHO89-phyA (Fig. 1). Pichia transformation was carried out by a “hybrid” method using electroporation [24]. Plasmids were linearized at PPHO89 promoter to facilitate chromosome integration via homologous recombinant in the Pichia genome. Briefly, log-phase P. pastoris GS115 was harvested, washed, and resuspended in 9 ml ice-cold BEDS solution (10 mM bicineNaOH, 3 % (v/v) ethylene glycol, 5 % (v/v) dimethyl sulfoxide, 1 M sorbitol, pH 8.3) and 1 ml of 1 M dithiothreitol (DTT). After a 5-min incubation at 30 °C with gentle shaking (100 rpm), the yeast cells were harvested by centrifugation and resuspended in 1 ml of BEDS solution. Aliquot (40 μl) of electrocompetent cells was mixed with the linearized transforming plasmids in a 2-mm electroporation cuvette. This transformation mixture was incubated on ice for 2 min and pulsed in an electroporator (Gene Pulser® II electroporator) with the following settings: charging voltage 1,500 V; resistance 200 Ω; capacitance 25 μF. The electroporated yeast cells were immediately mixed with 0.5 ml of 1 M sorbitol and 0.5 ml of YPD, incubated at 30 °C for 2 h with agitation (150 rpm), and then spread on YPD agar plates containing zeocin
2. Materials and methods 2.1. Strains, plasmids and growth conditions Escherichia coli DH5α was used as the host for plasmid propagation. It was routinely cultured in LB medium supplemented with appropriate antibiotic at 37 °C in a shaking incubator at 200 rpm. P. pastoris GS115
Fig. 1. Schematic diagram of the constructs (YF, phyA or yEGFP). Relevant restriction sites (BglII, HindIII, EcoRI, XbaI and NotI) are shown. PPHO89, α-factor (N-terminal α-factor secretion signal), phytase (YF, phyA) or yEGFP gene, c-myc/ (His)6 (antibody targeting sites), AOX1TT (AOX1 transcription termination region) and Zeocin (antibiotic resistance gene) are indicated.
2
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
(100 μg/ml). Pichia transformants were scored after a 4-day incubation at 30 °C.
2.6. Simulated in vitro digestion model In vitro digestion test mimics the digestive conditions (temperature and pH) of monogastric animals [28]. The yeast strains were cultured overnight in YPD medium, washed twice in distilled water and resuspended in 1.5 ml distilled water to obtain a concentrated yeast preparation with an initial OD600nm of 8. Ten U of commercial phytase (SunSon) dissolved in distilled water was used as positive control whereas distilled water by itself was used as negative control. Yeast and the two controls were added (pH 5.8–6.0) into three separate 10 ml plastic syringes (without luer-locks), each containing 1.0 g of hydrated wheat-based meal. After incubation at 40 °C for 30 min, the reaction mixture was acidified by HCl to pH 2.7 - 2.9. Pepsin (460 μl, 6,000 U/ ml, Sigma), was added and incubated at 40 °C for 45 min to simulate proventriculus/gizzard digestion. Duodenal digestion was then carried out by adding NaHCO3 to neutralize the reaction mixture to pH 5.9–6.1, followed by pancreatin (500 μl, 3.7 mg/ml, Sigma) for another 2 h incubation at 40 °C. During the whole digestion simulation, samples were aliquoted at various time intervals for the determination of Pi content. To confirm the cell viability of the engineered yeast in the in vitro digestion model, aliquots were taken at various time intervals, diluted appropriately, and then spread on YPD agar plate with zeocin (100 μg/ ml). The colony number in the plates was counted after 4 days of cultivation in a 30 °C incubator. The effect of Pi concentration on the yeast expression of phytase in the in vitro digestion system was studied. The wheat-based meal was found to contain a significant amount of endogenous Pi (∼0.8 g/kg). To lower the initial concentration of Pi in the simulation, a lower amount of wheat-based meal was used. On the other hand, to obtain a higher concentration of Pi, exogenous NaH2PO4•2H2O was added into the initial incubation mixture. Digestion was carried out as indicated above and aliquots were taken for measuring the Pi content at the end of the simulation process.
2.3. Phytase expression and purification A single colony of the phytase-containing Pichia transformants grown in zeocin YPD agar was inoculated into 10 ml of YPD medium. After an overnight incubation at 30 °C, 400 μl of culture was transferred to 50 ml of new YPD broth. After another 24-h incubation at 30 °C, it was transferred to 22 °C and incubated for 72 h to allow protein expression. The YPD medium originally contained 0.11 g/l of NaH2PO4•2H2O. Additional NaH2PO4•2H2O was added into the medium to achieve a series of concentration from 0.11 to 1.00 g/l as the only Pi source for activation of the Pi-limited PPHO89 promoter. To study the secreted phytase, the culture medium was centrifuged at 10,500 g for 2 min to obtain the supernatant for extracellular phytase determination. The resultant cell pellet was resuspended in the lysis buffer, with the volume equal to the original yeast preparation so that the activities of the extracellular and intracellular phytases can be directly compared. The intracellular phytase was released through cell disruption by the glass beads method [25]. The bead/lysate mixture was centrifuged at 18,000 g at 4℃ for 15 min. The activity of the supernatant, reflecting the intracellular phytase, was measured. To purify the secreted phytase, the proteins obtained after centrifugation of the original culture medium were precipitated with 40 % ammonium sulfate and resuspended in 0.1 M Tris−HCl buffer, pH 7.5. After dialysis for 48 h with three changes of buffer, phytase purification was performed by using the Qiagen Ni-NTA spin kit. The His-tagged phytase was eluted in 250 mM imidazole, 0.1 M Tris−HCl buffer, pH 8.0. The purity of the phytase preparations was checked by SDS-polyacrylamide gel electrophoresis. 2.4. Determination of phytase activity
2.7. Statistical analysis
Phytase activity of the Pichia transformants was determined by following the Pi liberated from the phytate substrate. Briefly, culture supernatant was mixed with 5 mM of sodium phytate (1:9, v/v) in 0.1 M glycine−HCl, pH 2.5, and incubated at 37 °C with agitation (250 rpm) for 15 min, during which the reaction rate was shown to remain initial. The reaction was terminated by the addition of 10 % trichloroacetic acid. The amount of liberated Pi was quantified with the ammonium molybdate method [26] after mixing with freshly prepared colour reagent (4 vol. of 1.5 % ammonium molybdate in 5.5 % H2SO4 + 1 vol. of 2.7 % FeSO4). One unit (U) of phytase activity was defined as the amount of enzyme that yields 1 μmol of Pi per min.
All data were analyzed by using Microsoft Excel and GraphPad Prism. Statistical analysis was calculated in GraphPad Prism using ANOVA. A p value smaller than 0.05 was considered as statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. 3. Results and discussion 3.1. Construction of P. pastoris for secretory phytase production We aimed to engineer P. pastoris to produce phytase in response to external Pi concentration. Pichia transformants, denoted as GS115PPHO89-YF and GS115-PPHO89-phyA, for secretory phytase production were obtained. Under the control of native PPHO89 promoter and an initial Pi (NaH2PO4•2H2O) concentration of 0.11 g/l, extracellular phytase expression from the Pichia transformants was evident: 0.35 U/ ml for GS115-PPHO89-YF and 0.34 U/ml for GS115-PPHO89-phyA (Fig. 2A). The Pichia transformants were quite stable. We have used different streak generations (more than ten streak generations apart under zeocin antibiotic stress) of yeasts for protein expression. The activities of the secreted phytases obtained were within 30 % of each other, indicating the success of plasmid integration into the yeast chromosome. On the other hand, very little intracellular phytase activity (∼0.03 U/ml), similar to that in wild type GS115 (GS115-WT), could be detected in the cell lysate (Fig. 2A).
2.5. Directed evolution of Pi-responsive promoter The yEGFP gene was obtained by PCR using gene-specific primers (Forward: cgGAATTCA TGTCTAAAGGTGAAG (EcoRI); Reverse: cg GCGGCCGCTTTGTACAATTCATCC(NotI)) and plasmid pKT127 as template. The yEGFP gene sequence was cloned into plasmid pPICZαAPPHO89 to generate pPICZαA-PPHO89-yEGFP. Error-prone PCR was employed to generate the promoter library using PPHO89-specific primers and pPICZαA-PPHO89-yEGFP as template in a reaction mixture containing 10 mM Tris−HCl, 50 mM KCl, 10 mM MgCl2, 0.5 mM MnCl2, 1 mM dCTP, 1 mM dTTP, 0.2 mM dATP, 0.2 mM dGTP, 2.5 U Taq DNA polymerase, and under the conditions: 94 °C 1 min, 54 °C 1 min, 72 °C 2 min for 25 cycles [27]. The PCR mixture was cloned into plasmid pPICZαA-PPHO89-yEGFP to replace the resident PPHO89. Pichia transformation was performed as described above. Green fluorescence was detected with an excitation wavelength of 488 nm and an emission wavelength of 515 nm.
3.2. Kinetic properties of the purified phytases The secreted phytases were purified using Ni-NTA metal affinity chromatography. The purity of the isolated phytases was confirmed by SDS-PAGE (Fig. 2B). The apparent molecular weights of the two 3
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
Fig. 2. Phytase expression in Pichia transformants. (A) Extracellular and intracellular phytases were separated by centrifugation. The activities in the supernatant and the cell lysate represent the extracellular and the intracellular phytases respectively. Phytase activity was measured with 5 mM sodium phytate in 0.1 M glycine−HCl, pH 2.5 at room temperature. The data represent average ± SEM of three independent experiments, each performed in duplicate. (B) SDS-PAGE analyses of the purified YF and phyA after Ni-NTA metal affinity chromatography. The proteins were stained with Coomassie blue. The protein molecular weight ladder (M) is also shown for comparison.
phytases were similar to the predicted values, indicating that they are not glycosylated, in contrast to those phyA produced in A. niger, S. cerevisiae and Kluyveromyces lactis [23,29–31]. Glycosylation might affect the properties of the enzyme. While the activity of phyA produced in K. lactis remains unchanged [23], phyA produced in S. cerevisiae showed losses of 9 % of its activity and 40 % of its thermostability after deglycosylation [31]. The kinetic properties of the enzymes were evaluated. At room temperature, both YF and phyA exhibited similar pH-activity profile with optimal activity at acidic pH values. At pH 7.0, enzymatic activity dropped to almost undetectable levels (Fig. 3A). For the effect of temperature, both phytases possessed highest activity at 45 °C, an almost 2or 3-fold increase when compared with that at room temperature (Fig. 3B). The stability of the phytase was tested at different pH and temperature. At pH 2.5, YF and phyA retained 73 % and 89 % of activity after 2-h incubation; while at pH 5.5, they retained 45 % and 33 % of activity, respectively (Fig. 3C). Both phytases were stable at elevated temperature: YF retained more than 90 % of activity after 4-h
incubation at 40 °C; while phyA retained 73 % of activity upon the same treatment (Fig. 3D). These kinetic measurements revealed that both phytases exhibited highest catalytic activity at acidic pH values and had an optimal temperature at 45 °C, similar to those reported in previous studies [22,23]. The strong pH and temperature stabilities of the phytases allowed them to be used for phytate digestion in the animal digestive tracts. 3.3. Correlation between external Pi concentration and phytase production level Under the control of PPHO89 promoter, the expression of both secreted phytases was inversely related to the increase in external Pi concentration, as shown in both activity assay (Fig. 4A and B) and Western blot analysis (Fig. 4C and D). Phytase expression was reduced by 4.5- to 9.5-fold upon the increase of external Pi concentration (NaH2PO4•2H2O) from 0.11 g/l to 1.00 g/l in the YPD growth medium. Such result is similar to a previous report in which the CLLip lipase Fig. 3. Kinetic properties of the purified phytases. The activity of the phytase YF or phyA was measured with 5 mM sodium phytate in 0.1 M buffer solution. (A) pH-activity profile (glycine−HCl for pH 1.5–3.0; sodium acetate for pH 3.0-5.5; Tris-acetate for pH 5.5-6.5; and Tris-HCl for pH 6.5–7.5). The assay was carried out at room temperature. (B) Temperatureactivity profile. The assay was carried out at pH 2.5. (C) Stability at pH 2.5 and 5.5. The phytase activity was determined after incubation at room temperature in 0.1 M glycine−HCl, pH 2.5 or 0.1 M Tris-acetate, pH 5.5 for various times. (D) Stability at 40 °C. The phytase activity was determined after incubation in 0.1 M glycine−HCl, pH 2.5 at 40 °C for various times. The data represent average ± SEM of three independent experiments, each performed in duplicate.
4
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
Fig. 4. Effect of external Pi concentration on phytase expression. Pichia transformants (GS115-PPHO89-YF and GS115PPHO89-phyA) were grown in YPD medium containing different concentrations of Pi (g/l NaH2PO4•2H2O, shown in the parenthesis). The crude culture supernatants were used for the analyses. (A and B) Phytase activity. The activity was determined with 5 mM sodium phytate in 0.1 M glycine−HCl, pH 2.5. The data represent average ± SEM of three independent experiments, each performed in duplicate. (C and D) Western blot analysis. The phytases were detected using (His)6 tag monoclonal antibody as the primary antibody.
expression correlates with the different activities of PPHO89 promoter under different Pi concentrations [21]. In P. pastoris, the PPHO89 promoter is originally used to regulate the expression of a sodium phosphate symporter (PHO89 gene) [21] which controls Pi absorption and allows normal cell growth. Such Pi homeostasis is important for yeast and other eukaryotic organisms [21,32]. Nevertheless, replacing the PHO89 gene by the phytase gene did not seem to have any significant effect on the yeast growth (data not shown). This is not entirely unexpected as its role can be compensated by some other functionally similar genes, for example, PHO5 and PHO84 [33,34]. In our P. pastoris
PPHO89-phytase system, the limited Pi or excess Pi could turn “on” or “off” the promoter on phytase expression. The expressed phytase could digest the phytate substrate and release Pi which, in turn, regulates the level of phytase expression in a feedback loop. 3.4. Directed evolution of Pi-responsive promoter Three rounds of error-prone PCR were conducted to generate mutant PPHO89 promoter sequences for enhanced sensitivity to variations of external Pi concentration. In total, more than 2000 mutants were Fig. 5. Evaluation of mutant PPHO89 promoter strength. (A) Wild type PPHO89 and mutant PPHO89ΔTT promoters’ strength, measured as the level of YF phytase expression, was determined in YPD medium with different Pi concentrations (g/l NaH2PO4•2H2O). The data represent average ± SEM of three independent experiments, each performed in duplicate. (B) Sequence analysis of wild type PPHO89 and PPHO89ΔTT promoter sequences showing a TT-deletion. Pho4p binding sites, including UASp1 (CACGTT with low affinity to pho4p) at position -583 and UASp2 (CACGTG with high affinity to pho4p) at position -414, together with TATAAA box (underlined, TA in circle) at position -101, Kozak consensus sequence (CACA labeled in a box) at position -1, putative translation initiation site CACAATG (start codon ATG is underlined), transcription start site (TSS), and open reading frame (ORF) are also indicated.
5
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
Fig. 6. Simulated in vitro digestion model. (A) Hydrated wheat-based meal was incubated with commercial phytase, wild type GS115 or different Pichia transformants (GS115-PPHO89-YF, GS115-PPHO899ΔTT-YF, and YF; GS115PPHO89-phyA). Distilled water was used as the control. Samples were aliquoted at time intervals to determine the Pi concentration. The data represent average ± SEM of five independent experiments, each performed in duplicate, ****p < 0.0001 when compared with the control. (B) Different initial Pi concentration (g/l, shown in parenthesis) in the mixture was used in the digestion experiment. The amount of phosphate increase after the 3.25 h of simulation was determined. The data represent average ± SEM of three independent experiments, each performed in duplicate. *p < 0.05, ***p < 0.001 when compared with the control; **p < 0.01, when GS115PPHO89-YF with initial Pi concentrations of 0.31 and 1.15 g/l were compared. (C) Yeast cell number and viability. During the digestion simulation, samples were taken at different time intervals, diluted and spread on the selective YPD agar plate containing 100 μg/ml zeocin. The cell number was counted after 4 days. The data represent average ± SEM of three independent experiments, each performed in duplicate.
screened. The strengths of the resultant mutant PPHO89 promoters in GS115-PPHO89-yEGFP were evaluated by measuring the fluorescence intensity of yEGFP in culture supernatant. A PPHO89 mutants’ library, including 36 mutants with activities spanning between 6%–170% of the original one, was generated and studied. Several representative mutants were selected to drive YF phytase expression. Among them, PPHO89ΔTT was found to exhibit an enhanced sensitivity to regulate YF phytase expression in response to external Pi concentration (Fig. 5A). DNA sequence analysis revealed a deletion of two T nucleotides at positions -597 and -598 (Fig. 5B). There is a CACGTT motif at position -583, which is very close to the double T nucleotides deletion. Previous study reported a PHO regulatory system in which the Pi signal could be conveyed to PHO8 gene by the binding of Pho4p, a positive regulatory factor, to the promoter binding sites (two binding sequences, UASp1: CACGTT with low affinity to pho4p, and UASp2: CACGTG with high affinity to pho4p) [35,36]. The PHO89 promoter has the same consensus binding site, suggesting that the P. pastoris-derived PHO89 gene is also under the control of the PHO regulatory system [21]. Therefore, the PPHO89ΔTT promoter might have a stronger strength and an improvement in transcription efficiency as the structure of the binding site UASp1 was altered.
pastoris was used. Indeed, the amount of liberated Pi from the phytasesecreting yeasts was comparable to that obtained by 10 U of commercial phytase (Fig. 6A). With the present experimental setup of using 1 g of wheat-based meal, 10 U should be in great excess as the usual amount of phytase used in the feed industry is only 1 U/g diet [28]. When the digestion simulation was carried out under different initial Pi concentrations, it was found that the Pi liberated from the wheat-based meal, which indirectly reflects the phytase expression, decreased with an increase in initial Pi concentration (Fig. 6B). For example, with an initial concentration of 1.15 g/l, the Pi increase after the digestion simulation was only 0.18 g/l, about 50 % when compared with the increase under an initial Pi concentration of 0.31 g/l. To conclude, a lower Pi concentration environment will stimulate the engineered yeast to express and secrete a large amount of phytase which can then digest the wheat-based meal more efficiently, resulting in a greater release of Pi from the phytate in the wheat-based meal. Such negative feedback regulation of Pi on phytase expression in the digestion simulation model is consistent with the result obtained under the YPD medium culture condition (Fig. 4). In the animal feed industry, exogenous phytase could be added into the diet directly or introduced through the addition of phytase-expressing yeast using the whole-cell biocatalyst concept. P. pastoris has been engineered to express Citrobacter amalonaticus phytase on the cell surface. In vitro digestion experiments demonstrated that the phytase attached on the cell surface has similar or even better efficiency in liberating Pi from the diet when compared with the free enzyme [37,38]. Yeast as whole cell feed supplement can also provide additional nutrients, for example, biotin and niacin. It has also been reported that certain cellular components of S. cerevisiae could improve
3.5. Simulated in vitro digestion model Addition of the yeast GS115-PPHO89-YF, GS115-PPHO89-phyA or GS115-PPHO89ΔTT-YF to wheat-based meal resulted in an increased production of Pi in the first hour of incubation. By the end of the whole process (3.25 h), the Pi concentration in the digestion mixture was ∼1.4 g/l, significantly higher than the control in which wild type P. 6
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
the growth performance, meat quality and ileal mucosa development of broiler chicks [39]. Nevertheless, whether it is the phytase itself or yeast with phytase expressed on the cell surface, it is difficult to have just the right amount of phytase activity. Usually, they are added in excess and the excess one will be released into the environment and gradually works to liberate more Pi into the environment, finally leading to phosphorus pollution again. Direct introduction of phytase supplement into the animal feed industry needs complicated, expensive, tedious isolation and purification. A Pi-responsive system could regulate the supply and demand relationship of phytase and phytate in a straightforward way. Another distinct advantage for using the phytase-secreting yeast in the animal feed industry is that the GRAS organism P. pastoris can be used directly and need not go through the high temperature during the feed pelleting process, which might inactivate the enzyme. To evaluate the cell viability of the three different types of engineered phytase-secreting yeast in the in vitro digestion condition, samples were aliquoted at different time points to analyze the cell number using the spread plate methods. During the whole process, the engineered cell number remained the same (Fig. 6C), suggesting that the phytase-secreting yeast could survive under the digestion condition. Nevertheless, even though the yeast cells could survive, their proliferation was extremely slow. As a comparison, P. pastoris has a doubling time of ∼90 min in YPD medium and ∼140 min in synthetic media during the exponential phase of growth at 30 °C [40]. For future application of phytase-secreting yeast as whole cell catalyst, multiple feeding of the engineered P. pastoris yeast to the monogastric animals might be necessary. The yeast feed supplement could form colonies of long-standing in the animal stomach or intestine tract and produce phytase in response to the environment Pi concentration.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.enzmictec.2020. 109533. References [1] M. Pasek, A role for phosphorus redox in emerging and modern biochemistry, Curr. Opin. Chem. Biol. 49 (2019) 53–58, https://doi.org/10.1016/j.cbpa.2018.09.018. [2] M. Jiang, Y. Liu, Y. Liu, Y. Tan, J. Huang, Q. Shu, Mutation of inositol 1,3,4-trisphosphate 5/6-kinase6 impairs plant growth and phytic acid synthesis in rice, Plants 8 (2019) 1–12, https://doi.org/10.3390/plants8050114. [3] J.J. Barrero, J.C. Casler, F. Valero, P. Ferrer, B.S. Glick, An improved secretion signal enhances the secretion of model proteins from Pichia pastoris, Microb. Cell Fact. 17 (2018) 1–13, https://doi.org/10.1186/s12934-018-1009-5. [4] X.G. Lei, J.D. Weaver, E. Mullaney, A.H. Ullah, M.J. Azain, Phytase, a new life for an “old” enzyme, Annu. Rev. Anim. Biosci. 1 (2012) 283–309, https://doi.org/10. 1146/annurev-animal-031412-103717. [5] C.L. Walk, S.V. Rama Rao, Dietary phytate has a greater anti-nutrient effect on feed conversion ratio compared to body weight gain and greater doses of phytase are required to alleviate this effect as evidenced by prediction equations on growth performance, bone ash and phytate degradation in broilers, Poult. Sci. (2019) pez469, https://doi.org/10.3382/ps/pez469 [Epub ahead of print]. [6] V. Kumar, A.K. Sinha, H.P.S. Makkar, K. Becker, Dietary roles of phytate and phytase in human nutrition: a review, Food Chem. 120 (2010) 945–959, https:// doi.org/10.1016/J.FOODCHEM.2009.11.052. [7] M.E.A. El-Hack, M. Alagawany, M. Arif, M. Emam, M. Saeed, M.A. Arain, F.A. Siyal, A. Patra, S.S. Elnesr, R.U. Khan, The uses of microbial phytase as a feed additive in poultry nutrition -a review, Ann. Anim. Sci. 18 (2018) 639–658, https://doi.org/10. 2478/aoas-2018-0009. [8] K. Bhavsar, J.M. Khire, Current research and future perspectives of phytase bioprocessing, RSC Adv. 4 (2014) 26677–26691, https://doi.org/10.1039/ C4RA03445G. [9] Global Info Research, Global Phytases Market 2019, (2019) (Accessed 28 January 2020), https://www.globalinforesearch.com/global-phytases-market_p172237. html. [10] C.K. Jones, M.D. Tokach, S.S. Dritz, B.W. Ratliff, N.L. Horn, R.D. Goodband, J.M. DeRouchey, R.C. Sulabo, J.L. Nelssen, Efficacy of different commercial phytase enzymes and development of an available phosphorus release curve for Escherichia coli-derived phytases in nursery pigs, J. Anim. Sci. 88 (2010) 3631–3644, https:// doi.org/10.2527/jas.2010-2936. [11] H.J. Pel, J.H. de Winde, D.B. Archer, P.S. Dyer, G. Hofmann, P.J. Schaap, G. Turner, R.P. de Vries, R. Albang, K. Albermann, M.R. Andersen, J.D. Bendtsen, J.A.E. Benen, M. van den Berg, S. Breestraat, M.X. Caddick, R. Contreras, M. Cornell, P.M. Coutinho, E.G.J. Danchin, A.J.M. Debets, P. Dekker, P.W.M. van Dijck, A. van Dijk, L. Dijkhuizen, A.J.M. Driessen, C. d’Enfert, S. Geysens, C. Goosen, G.S.P. Groot, P.W.J. de Groot, T. Guillemette, B. Henrissat, M. Herweijer, J.P.T.W. van den Hombergh, C.A.M.J.J. van den Hondel, R.T.J.M. van der Heijden, R.M. van der Kaaij, F.M. Klis, H.J. Kools, C.P. Kubicek, P.A. van Kuyk, J. Lauber, X. Lu, M.J.E.C. van der Maarel, R. Meulenberg, H. Menke, M.A. Mortimer, J. Nielsen, S.G. Oliver, M. Olsthoorn, K. Pal, N.N.M.E. van Peij, A.F.J. Ram, U. Rinas, J.A. Roubos, C.M.J. Sagt, M. Schmoll, J. Sun, D. Ussery, J. Varga, W. Vervecken, P.J.J. van de Vondervoort, H. Wedler, H.A.B. Wösten, A.-P. Zeng, A.J.J. van Ooyen, J. Visser, H. Stam, Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88, Nat. Biotechnol. 25 (2007) 221–231, https://doi.org/10.1038/nbt1282. [12] S.C. dos Santos, I. Sá-Correia, Yeast toxicogenomics: lessons from a eukaryotic cell model and cell factory, Curr. Opin. Biotechnol. 33 (2015) 183–191, https://doi.org/ 10.1016/J.COPBIO.2015.03.001. [13] J. Steensels, T. Snoek, E. Meersman, M. Picca Nicolino, K. Voordeckers, K.J. Verstrepen, Improving industrial yeast strains: exploiting natural and artificial diversity, FEMS Microbiol. Rev. 38 (2014) 947–995, https://doi.org/10.1111/ 1574-6976.12073. [14] A. Berlec, B. Štrukelj, Current state and recent advances in biopharmaceutical production in Escherichia coli, yeasts and mammalian cells, J. Ind. Microbiol. Biotechnol. 40 (2013) 257–274, https://doi.org/10.1007/s10295-013-1235-0. [15] J.L. Martínez, L. Liu, D. Petranovic, J. Nielsen, Pharmaceutical protein production by yeast: towards production of human blood proteins by microbial fermentation, Curr. Opin. Biotechnol. 23 (2012) 965–971, https://doi.org/10.1016/J.COPBIO. 2012.03.011. [16] B.K. Choi, P. Bobrowicz, R.C. Davidson, S.R. Hamilton, D.H. Kung, H. Li, R.G. Miele, J.H. Nett, S. Wildt, T.U. Gerngross, Use of combinatorial genetic libraries to humanize N-linked glycosylation in the yeast Pichia pastoris, Proc. Natl. Acad. Sci. 100 (2003) 5022–5027, https://doi.org/10.1073/pnas.0931263100. [17] M. Ahmad, M. Hirz, H. Pichler, H. Schwab, Protein expression in Pichia pastoris: recent achievements and perspectives for heterologous protein production, Appl. Microbiol. Biotechnol. 98 (2014) 5301–5317, https://doi.org/10.1007/s00253014-5732-5. [18] J.M. Cregg, K.J. Barringer, A.Y. Hessler, K.R. Madden, Pichia pastoris as a host system for transformations, Mol. Cell. Biol. 5 (1985) 3376–3385, https://doi.org/ 10.1128/mcb.5.12.3376. [19] O.V. Berezina, J. Herlet, S.V. Rykov, P. Kornberger, A. Zavyalov, D. Kozlov,
4. Conclusion This study demonstrated the successful expression of two thermostable phytases in P. pastoris for phytate hydrolysis. Both secreted phytases had good pH and temperature stabilities. More importantly, the phytase expression could be regulated in response to variations in external Pi concentration: a “made-to-order” state driven by the Pi-responsive promoter. We used a simulated in vitro digestion model with hydrated wheat-based meal to evaluate the potential application of the engineered P. pastoris in feed industry and animal waste treatment. Our results strongly indicated that the engineered P. pastoris could release Pi with an efficiency comparable with commercial phytase, justifying our innovative concept in phytate hydrolysis using whole cell biocatalyst. Further feasibility studies on the engineered P. pastoris is warranted, for instance, by adding them in feed pellet for monogastric animals to follow the in vivo digestion of phytate Author agreement We certify that all authors have seen and approved the final version of the manuscript being submitted. The manuscript represents the authors’ original work, has not received prior publication and is not under consideration for publication elsewhere. Declaration of Competing Interest None. Acknowledgement The work described in this paper was supported by a grant from the Research Grants Council of the Hong Kong Special Administrative Region, China (Project No.: UGC/FDS25/M02/16). 7
Enzyme and Microbial Technology 137 (2020) 109533
Z. Xie, et al.
[20]
[21]
[22] [23] [24]
[25] [26] [27] [28]
[29]
L. Sakhibgaraeva, I. Krestyanova, W.H. Schwarz, V.V. Zverlov, W. Liebl, S.V. Yarotsky, Thermostable multifunctional GH74 xyloglucanase from Myceliophthora thermophila: high-level expression in Pichia pastoris and characterization of the recombinant protein, Appl. Microbiol. Biotechnol. 101 (2017) 5653–5666, https://doi.org/10.1007/s00253-017-8297-2. H. He, C. Zhai, M. Mei, Y. Rao, Y. Liu, F. Wang, L. Ma, Z. Jiang, G. Zhang, L. Yi, Functional expression of porcine interferon-α using a combinational strategy in Pichia pastoris GS115, Enzyme Microb. Technol. 122 (2019) 55–63, https://doi.org/ 10.1016/j.enzmictec.2018.12.005. J. Ahn, J. Hong, M. Park, H. Lee, E. Lee, C. Kim, J. Lee, E.S. Choi, J.K. Jung, H. Lee, Phosphate-responsive promoter of a Pichia pastoris sodium phosphate symporter, Appl. Environ. Microbiol. 75 (2009) 3528–3534, https://doi.org/10.1128/AEM. 02913-08. D. Fu, H. Huang, K. Meng, Y. Wang, H. Luo, P. Yang, T. Yuan, B. Yao, Improvement of Yersinia frederiksenii phytase performance by a single amino acid substitution, Biotechnol. Bioeng. 103 (2009) 857–864, https://doi.org/10.1002/bit.22315. M.V. Ushasree, J. Vidya, A. Pandey, Extracellular expression of a thermostable phytase (phyA) in Kluyveromyces lactis, Process Biochem. 49 (2014) 1440–1447, https://doi.org/10.1016/j.procbio.2014.05.010. J. Lin-Cereghino, W.W. Wong, S. Xiong, W. Giang, L.T. Luong, J. Vu, S.D. Johnson, G.P. Lin-Cereghino, Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris, Biotechniques 38 (2005) 44–48, https://doi.org/10.2144/05381BM04. M. Çağlayan, S.H. Wilson, Enzymatic activity assays in yeast cell extracts, Bioprotocol 4 (23) (2014) e1312. H. Bae, L. Yanke, K.J. Cheng, L. Selinger, A novel staining method for detecting phytase activity, J. Microbiol. Methods 39 (1999) 17–22, https://doi.org/10.1016/ S0167-7012(99)00096-2. X. Qin, J. Qian, G. Yao, Y. Zhuang, S. Zhang, J. Chu, GAP promoter library for finetuning of gene expression in Pichia pastoris, Appl. Environ. Microbiol. 77 (2011) 3600–3608, https://doi.org/10.1128/AEM.02843-10. K. Zyłe, D. Gogol, J. Koreleski, S. Światkiewicz, D.R. Ledoux, Simultaneous application of phytase and xylanase to broiler feeds based on wheat: in vitro measurements of phosphorus and pentose release from wheats and wheat-based feeds, J. Sci. Food Agric. 79 (1999) 1832–1840 doi:10.1002/(SICI)1097-0010(199910) 79:13 < 1832::AID-JSFA441 > 3.0.CO;2-Q. W. van Hartingsveldt, C.M.J. van Zeijl, G.M. Harteveld, R.J. Gouka, M.E.G. Suykerbuyk, R.G.M. Luiten, P.A. van Paridon, G.C.M. Selten, A.E. Veenstra,
[30] [31] [32] [33]
[34] [35] [36] [37]
[38]
[39]
[40]
8
R.F.M. van Gorcom, C.A.M.J.J. van den Hondel, Cloning, characterization and overexpression of the phytase-encoding gene (phyA) of Aspergillus niger, Gene 127 (1993) 87–94, https://doi.org/10.1016/0378-1119(93)90620-I. M.V. Ushasree, J. Vidya, A. Pandey, Gene cloning and soluble expression of Aspergillus niger phytase in E. coli cytosol via chaperone co-expression, Biotechnol. Lett. 36 (2014) 85–91, https://doi.org/10.1007/s10529-013-1322-3. Y. Han, D.B. Wilson, X.G. Lei, Expression of an Aspergillus niger phytase gene (phyA) in Saccharomyces cerevisiae, Appl. Environ. Microbiol. 65 (1999) 1915–1918 https://www.ncbi.nlm.nih.gov/pubmed/10223979. D. Secco, C. Wang, H. Shou, J. Whelan, Phosphate homeostasis in the yeast Saccharomyces cerevisiae, the key role of the SPX domain-containing proteins, FEBS Lett. 586 (2012) 289–295, https://doi.org/10.1016/j.febslet.2012.01.036. C. Auesukaree, T. Homma, Y. Kaneko, S. Harashima, Transcriptional regulation of phosphate-responsive genes in low-affinity phosphate-transporter-defective mutants in Saccharomyces cerevisiae, Biochem. Biophys. Res. Commun. 306 (2003) 843–850, https://doi.org/10.1016/S0006-291X(03)01068-4. M. Bun-Ya, M. Nishimura, S. Harashima, Y. Oshima, The PHO84 gene of Saccharomyces cerevisiae encodes an inorganic phosphate transporter, Mol. Cell. Biol. 11 (1991) 3229–3238, https://doi.org/10.1128/MCB.11.6.3229. N. Hayashi, Y. Oshima, Specific cis-acting sequence for PHO8 expression interacts with PHO4 protein, a positive regulatory factor, in Saccharomyces cerevisiae, Mol. Cell. Biol. 11 (1991) 785–794, https://doi.org/10.1128/mcb.11.2.785. Y. Oshima, The phosphatase system in Saccharomyces cerevisiae, Genes Genet. Syst. 72 (1997) 323–334, https://doi.org/10.1021/jo00053a025. C. Li, Y. Lin, Y. Huang, X. Liu, S. Liang, Citrobacter amalonaticus phytase on the cell surface of Pichia pastoris exhibits high pH stability as a promising potential feed supplement, PLoS One 9 (2014) 1–15, https://doi.org/10.1371/journal.pone. 0114728. P. Harnpicharnchai, W. Sornlake, K. Tang, L. Eurwilaichitr, S. Tanapongpipat, Cellsurface phytase on Pichia pastoris cell wall offers great potential as a feed supplement, FEMS Microbiol. Lett. 302 (2010) 8–14, https://doi.org/10.1111/j.15746968.2009.01811.x. A.W. Zhang, B.D. Lee, S.K. Lee, K.W. Lee, G.H. An, K.B. Song, C.H. Lee, Effects of yeast (Saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks, Poult. Sci. 84 (2005) 1015–1021, https://doi.org/10.1093/ps/84.7.1015. F. Sherman, Getting started with yeast, Methods Enzymol. 350 (2002) 3–41, https://doi.org/10.1016/S0076-6879(02)50954-X.