Engineering of the critical residues at the stereochemistry-gate loops of Brevibacillus agri dihydropyrimidinase for the production of l -homophenylalanine

Process Biochemistry 44 (2009) 309–315

Contents lists available at ScienceDirect

Process Biochemistry journal homepage: www.elsevier.com/locate/procbio

Engineering of the critical residues at the stereochemistry-gate loops of Brevibacillus agri dihydropyrimidinase for the production of L-homophenylalanine Chao-Kai Lo a, Chao-Hung Kao b, Wen-Ching Wang c, Hsin-Mao Wu c, Wen-Hwei Hsu a, Long-Liu Lin d,**, Hui-Yu Hu e,* a

Institute of Molecular Biology, National Chung Hsing University, Taichung 402, Taiwan Department of Biotechnology, Hungkuang University, Shalu, Taichung 433, Taiwan Institute of Molecular and Cellular Biology and Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan d Department of Applied Chemistry, National Chiayi University, Chiayi 60083, Taiwan e Department of Food and Nutrition, Hungkuang University, Shalu, Taichung 433, Taiwan b c

A R T I C L E I N F O

A B S T R A C T

Article history: Received 26 April 2008 Received in revised form 8 October 2008 Accepted 6 November 2008

Brevibacillus agri dihydropyrimidinase (BaDHP) exhibits a substrate preference for D-homophenylalanylhydantoin (D-HPAH). Site-directed mutagenesis of BaDHP was performed specifically to the residues proposed to be important in the enzyme activity. M63A, F65A, L94A, L159A and L159V variants exhibited the increased activity (54–469%) toward L-HPAH. L159V variant was used to convert HPAH to Lhomophenylalanine (L-HPA) in the hydantoinase process. As compared with the wild-type enzyme, the conversion yield of L-HPA was increased from 39 to 61% by L159V variant. The conversion yield for L-HPA production was further increased up to 90% by coupling L159V variant with Bacillus kaustophilus L-Ncarbamoylase and Deinococcus radiodurans N-acylamino acid racemase in the biocatalysis process. ß 2008 Elsevier Ltd. All rights reserved.

Keywords: L-Homophenylalanine Dihydropyrimidinase L-N-Carbamoylase N-Acylamino acid racemase Site-directed mutagenesis Bioconversion

1. Introduction Cyclic amidohydrolases are functionally and structurally related superfamily enzymes that have evolved from a common ancestor. The superfamily enzymes include hydantoinases, dihydropyrimidinases, allantoinases and dihydroorotases, and catalyze the hydrolysis of cyclic amide bonds of five- or six-membered rings in the nucleotide metabolism [1]. Among them, dihydropyrimidinase (DHP; EC 3.5.2.2) is involved in the degradation of pyrimidine nucleotide and is found in diverse organisms [1–4]. DHP catalyzes the ring opening of 5,6-dihydrouracil to Ncarbamyl-b-alanine and of 5,6-dihydrothymine to N-carbamylb-amino isobutyrate, which represents the second step in the three-step reductive degradation pathway of uracil and thymine [5,6]. The ring cleavage reaction is reversible and is achieved by hydrolysis of the amide bond between nitrogen 3 and carbon 4 of

* Corresponding author. Tel.: +886 4 2631 8652x5033; fax: +886 4 2631 9176. ** Corresponding author. Tel.: +886 5 271 7969; fax: +886 5 271 7901. E-mail addresses: [email protected] (L.-L. Lin), [email protected] (H.-Y. Hu). 1359-5113/$ – see front matter ß 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.procbio.2008.11.005

the dihydropyrimidine ring. Besides the reversible ring opening of its physiological substrates dihydrouracil and dihydrothymine, DHP also catalyzes the hydrolysis of a variety of 5-monosubstituted hydantoins and succinimides [7], which led to the hypothesis that DHP is identical to the enzyme hydantoinase (Hyd) and hence to the synonymous use of both names in the EC nomenclature. However, the DHPs from Saccharomyces kluyveri and Dictyostelium discoideum do not hydrolyze hydantoins [1], and not all of Hyds hydrolyze dihydropyrimidines and are therefore not likely to be involved in the reductive pyrimidine catabolism [8– 10]. The (b/a)8-barrel is the most prevalent fold in which eight parallel b-sheets are connected by eight a-helices [11]. Most of the (b/a)8-barrel enzymes have their active sites on the bottom of the pocket formed by the loops that connect the carboxyl end of each b-sheet with the amino end of the next a-helix [12]. Generally, the substrate-binding residues and the catalytic residues are situated in separate regions of carboxyl ends of b-sheets and connecting loops, respectively. Because of these features, the (b/a)8-barrel enzymes have been a good target for reshaping the binding site for a new substrate [13,14]. Progress has been made to elucidate the (b/a)8-barrel structure of cyclic amidohydrolase superfamily in

310

C.-K. Lo et al. / Process Biochemistry 44 (2009) 309–315

order to understand their catalytic mechanism in detail. To date, three-dimensional structures of five hydantoinases are available [15–19]. The basic framework of these enzymes consists of an eightfold repetition of a b/a-motif wrapped in a circular fashion to make a central b-barrel. Each b-strand is connected to an a-helix through a front loop, and each helix is connected to a strand by a back loop. The conserved metal-binding residues are present on the C-terminal ends of b-strands and on the front loops. The production of enantiomerically pure compounds is steadily increasing importance to the chemical and pharmaceutical industries and, therefore, the world market for chiral fine chemicals, pharmaceuticals, agrochemicals, and flavor compounds rapidly expands. In the year 2000, the worldwide sales volume for chiral drugs exceeded the US$ 100 billion barrier for the first time [20]. The demand for chiral drugs is caused by the fact that cell surface receptors are biological molecules that are chiral by themselves, and efficient drug molecules must match the receptor’s asymmetry. Accordingly, many researchers have focused on the isolation and characterization of Hyds with favorable catalytic properties in an effort to develop hydantoinase-based enzymatic processes for the production of unnatural amino acids [10,21,22]. In this study, we attempted to increase the hydrolytic activity of Brevibacillus agri DHP (BaDHP) [23] toward L-homophenylalanylhydantoin (L-HPAH) by manipulating the stereochemistry gate loops (SGLs) on the basis of the sequence comparison of seven different DHP and Hyd enzymes, and the modeled active-site structure. Site-directed mutagenesis and characterization of the wild-type and mutant enzymes were conducted to demonstrate the replacement of the hydrophobic residues Met63, Phe65, Leu94, Phe152, Trp155, and Leu159 in the hydrolytic activity of BaDHP to L-HPAH. The results showed that the specific activity of BaDHP toward L-HPAH could be increased remarkably by the substitution of Leu159 with Val. The conversion yield of approximately 90% for L-homophenylalanine (L-HPA) from racemic homophenylalanylhydantoin (D,L-HPAH), using L159V variant, Bacillus kaustophilus LN-carbamoylase [24] and Deinococcus radiodurans N-acylamino acid racemase in the hydantoinase process was also achieved.

Table 1 Oligonucleotides used for site-directed mutagenesis. Enzyme

Nucleotide sequence (50 to 30 )a

Codon change

M63A M63F F65A L94A F152A Y155A L159A L159I L159V L159F L159T

CCGCACACGCACCTCGACGCGCCGTTTGGCGGC CCGCACACGCACCTCGACTTCCCGTTTGGCGGC ACGCACCTCGACATGCCGGCTGGCGGCACGGTT CGTGGACTTTTGCGCGACGAGCAAAGGGGAG TCACTCAAAGTGGCCATGGCGTACAAA CAAAGTGTTCATGGCGGCCAAAAACGTGCTG GGCGTACAAAAACGTGGCGATGGCCGACGAC GGCGTACAAAAACGTGATAGATGGCCGACGAC GGCGTACAAAAACGTGGTGGATGGCCGACGAC GGCGTACAAAAACGTGTTCGATGGCCGACGAC GGCGTACAAAAACGTGACGATGGCCGACGAC

ATG ! GCG ATG ! TTC TTT ! GCT CTG ! GCG TTC ! GCC TAC ! GCC CTG ! GCG CTG ! ATA CTG ! GTG CTG ! TTC CTG ! ACG

a

Only the sense primers are shown.

Amino acid sequences were analyzed with the program BLAST-X [28] from the National Center of Biotechnology Information (National Library of Medicine, National Institute of Health, MD). A multiple peptide sequence alignment along with the sequences most closely related to that of BaDHP (TrEMBL Q846U5), including Bacillus sp. AR9 D-Hyd (B9DHyd) (TrEMBL Q5DLU2), Bacillus stearothermophilus D-Hyd (BsDHyd) (TrEMBL Q45515), Thermus sp. DHP (TsDHP) (TrEMBL Q7SIE9), D. discoideum DHP (DdDHP) (TrEMBL Q55DL0), S. kluyveri DHP (SkDHP) (TrEMBL Q9P903), and Arthrobacter aurescens L-Hyd (AaLHyd) (TrEMBL Q9F465) was performed with CLUSTALW program from the ExPASy molecular biology server (Swiss Institute of Bioinformatics, Basel, Switzerland). 2.4. Plasmid construction and site-directed mutagenesis For expression plasmid construction, pET21a was restricted with XbaI/NheI to release a fragment containing ribosome binding site and His-tag coding sequence and was compatibly ligated itself to generate pETX. Expression plasmid pETXBaDHP was constructed by insertion of an EcoRI/HindIII fragment containing ribosome binding site, ORF of BaDHP gene and His-tag coding sequence from pQEpydB [23] into the corresponding sites of pETX. The pETX-BaDHP construct was then used as template in the Quick-Change Site-Directed Mutagenesis procedure according to manufacture’s instructions. The designed mutations were included in the primers as listed in Table 1. Following amplification, the reaction mixture was treated with DpnI to eliminate the template DNA. Each of the mutated amplification products were transformed into E. coli Novablue. The nucleotide sequence of each mutant construct was confirmed by DNA sequencing. Also, both strands of the entire coding region were analyzed to confirm that no unwanted mutations occurred in the rest of the enzyme’s coding region.

2. Materials and methods

2.5. Expression and purification of His-tagged wild-type and mutant enzymes

2.1. Materials

Expression and purification of the wild-type and mutant BaDHP were performed according to manufacturer’s protocol (Qiagen, Valencia, CA). Briefly, single colony of transformed E. coli cells was inoculated in 5 ml of LB containing 5 mM MnCl2 and 100 mg/ml ampicillin and incubated at 37 8C. Overnight culture was diluted into 100 ml of the same broth and cultivated at 37 8C with vigorous shaking until OD600 reached 0.5. The cells were induced by adding isopropyl-b-Dthiogalactopyranoside (IPTG) to a final concentration of 1 mM and grown at 28 8C for 5 h. To purify BaDHP from the crude extracts, the cells were harvested by centrifugation at 10,000  g for 10 min at 4 8C, resuspended in 10 ml of 40 mM Tris–HCl buffer (pH 8.0) containing 40 mM NaCl, and disrupted by sonication (Model XL-2020, Heat System, NY). The extract was clarified by centrifugation at 12,000  g for 30 min at 4 8C, and the resulting supernatant was mixed with Ni2+NTA resin pre-equilibrated with binding buffer (5 mM imidazole, 40 mM NaCl, and 40 mM Tris–HCl; pH 8.0). The adherent His-tagged BaDHP was eluted from the column using a buffer containing 100 mM imidazole, 40 mM NaCl, and 40 mM Tris–HCl (pH 8.0).

Luria-Bertani (LB) medium for Escherichia coli cultivation was obtained from Difco Laboratories (Detroit, MI). The oligonucleotide primers used for mutagenesis were synthesized by Mission Biotechnology Inc. (Taipei, Taiwan). The QuickChange Site-Directed mutagenesis kit was acquired from Stratagene (La Jolla, CA). Ni2+nitrilotriacetate (Ni2+-NTA) was obtained from Qiagen Inc. (Valencia, CA). D,L-HPAH, L-homophenylalanylhydantoin (L-HPAH), D-N-carbamoyl-homophenylalanine (DNC-HPA), and L-NC-HPA were kindly provided by SCI Pharmtech, Inc. (Taoyuan, Taiwan). N,N,N0 ,N0 -tetramethylethylene diamine (TEMED), acrylamide, and Coomassie brilliant blue R-250 were from Bio-Rad (Hercules, CA). All other chemicals were commercial products of analytical grade or molecular biological grade. 2.2. Bacterial strains, plasmids, and culture conditions E. coli Novablue (Novagen Inc., Madison, WI) was used as a host for routine cloning procedures and overproduction of wild-type and mutant proteins. E. coli cells harboring pQE-pydB [23], pQE-LNCA [24], and pQE-naar [25] were used for the production of BaDHP, L-N-carbamoylase, and N-acylamino acid racemase, respectively. Recombinant E. coli cells were cultivated at 37 8C in LB medium supplemented with 100 mg ampicillin/ml. For overproduction of the recombinant proteins, cells were grown at lower temperature (28 8C) to avoid the formation of inclusion bodies. 2.3. General DNA techniques and sequence comparison Plasmid isolations were carried out on alkaline lysate with the Gene-SpinTM-V2 Miniprep Purification Kit (Protech Technology Enterprise Co., Ltd., Taipei, Taiwan). Standard procedures for endonuclease digestions and agarose electrophoresis were performed according to Sambrook and Russell [26]. DNA sequencing was carried out by Mission Biotechnology (Taipei, Taiwan). E. coli cells were made competent for transformation by the method of Dagert and Ehrlich [27].

2.6. Gel electrophoresis and determination of protein concentration Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS/PAGE) was performed with a Bio-Rad Protein III mini gel system (Bio-Rad). The purified enzymes were suspended in SDS/PAGE loading buffer (5% 2-mercaptoethanol, 2% SDS, 0.1% bromophenol blue, and 10% glycerol in 50 mM Tris–HCl buffer; pH 6.8) and fractionized under 12% gel. After electrophoresis, the gels were stained with 0.25% Coomassie brilliant blue dissolved in 50% methanol–10% acetic acid and then destained in a 30% methanol–10% acetic acid solution. The protein size markers were phosphorylase b (97.4 kDa), bovine serum albumin (66.3 kDa), ovalbumin (45.0 kDa), carbonic anhydrase (31.0 kDa), trypsin inhibitor (21.5 kDa), and lysozyme (14.4 kDa). Protein concentrations were determined with a protein assay kit (Bio-Rad Laboratories) using bovine serum albumin as the standard.

C.-K. Lo et al. / Process Biochemistry 44 (2009) 309–315 2.7. Enzyme assays DHP activity was determined at 50 8C by colorimetric method [29]. Unless otherwise indicated, the reaction mixture (1 ml) contained 10 mM D,L-HPAH, 1 mM MnCl2, 100 mM Tris–HCl buffer (pH 8.0), and an appropriate amount of enzyme solution. One unit of DHP activity is defined as the amount of enzyme that produces 1 mmol of N-carbamoyl-D-hydroxyphenylglycine per min under the assay conditions. The L-N-carbamoylase activity was determined according to the method of Hu et al. [24]. One unit of L-N-carbamoylase activity is defined as the amount of enzyme that produces 1 mmol L-amino acid per min in the reaction mixture. The N-acylamino acid racemase activity was assayed mainly according to Tokuyama and Hatano [30]. One unit of N-acylamino acid racemase activity is defined as the amount of enzyme that releases 1 mmol product per min under the assay conditions. 2.8. Production of L-HPA The batch-type reaction was performed for the conversion of D,L-HPAH to L-HPA. Reaction mixture contained 9 mM D,L-HPAH, 1 mM MnCl2, 2 mM CoCl2, 100 mM Tris–HCl buffer (pH 8.0), and an appropriate amount of the purified enzyme in a final volume of 100 ml. The addition of 2 mM CoCl2 in the reaction mixture is to increase the enzymatic activity of N-acylamino acid racemase [25]. Since the substrate (HPAH) has very low solubility (about 15 mM in 100 mM Tris–HCl buffer at pH 8.0 and 30 8C) and the BaDHP is a thermostable enzyme, to which 100% of the enzyme activity can be retained at 50 8C for 20 days [29], 50 8C was chosen as the reaction temperature to increase the solubility of HPAH in the reaction mixture and to obtain higher reaction rate. The consumption of substrate and the production of L-HPA were monitored at intervals with HPLC method using Chirobiotic T column [25].

3. Results 3.1. Metallo-dependence of BaDHP It has been reported that the synthesis of Arthrobacter sp. BH20 2+ ions [31]. Consistently, BaDHP activity was stimulated by the addition of metal ions into culture medium, especially Mn2+ (Table 2). The specific activity for L-HPAH was increased by 25-fold upon the incorporation of 5 mM MnCl2 into the culture medium. Other metal ions including Mg2+, Ca2+, Co2+, Ni2+, Cu2+ and Zn2+ also had an enhancement on the activity to LHPAH. Interestingly, the addition of Ni2+ or Zn2+ ion into the culture medium led to a remarkable decrease in the specific activity to DHPAH. The specific activity of BaDHP purified from the cells grown under non-metal condition could also be increased by the Mn2+ ion. When 1 mM MnCl2 was included in the reaction mixture, the specific activity to L-HPAH was increased from 0.1 to 2.6 U/mg. These results indicated that BaDHP is metallo-dependent and the metal ions have a profound effect on the enzyme activity. D-Hyd is dependent on Mn

3.2. Sequence and crystal structure comparison In this study, the potential critical residues for substrate specificity were identified by sequence comparison of BaDHP with DHP-related enzymes of prokaryotic and eukaryotic origin (Fig. 1). BaDHP had sequence identity between 34 and 84% with Bacillus sp. Table 2 Effect of metal ion in the culture medium on the specific activities of BaDHP to HPAH. Metal ionsa

None Mg2+ Ca2+ Mn2+ Co2+ Ni2+ Cu2+ Zn2+ a

Specific activity (U/mg) L-HPAH

D-HPAH

0.1  0.02 1.4  0.07 1.7  0.06 2.6  0.08 1.0  0.06 0.9  0.19 1.6  0.11 0.8  0.05

13.8  0.21 10.3  0.50 13.4  0.54 18.5  0.51 10.8  0.21 0.3  0.03 13.4  0.43 0.2  0.02

The concentration of metal ions in the culture medium was 5 mM.

311

AR9, B. stearothermophilus, Thermus sp., D. discoideum, and S. kluyveri enzymes, while the identity with A. aurescens L-Hyd is 29%. The aligned proteins shows high conservation of residues implicated in metal binding and catalytic reaction (Fig. 1). To date, the three-dimensional structure of BsDHyd has been determined [17]. The enzyme subunit has a classic TIM barrel fold and contains recognition sites for the functional amino groups and exocyclic substituents of hydantoins in its substrate-binding pocket. Three SGLs are proposed to contribute the hydrophobic nature of substrate-binding pocket of the enzyme. As shown in Fig. 1, these loops are conserved among the DHP and D-Hyd sequences. In the case of BsDHyd, the side chains of residues Met63, Phe65, Phe152, Tyr155, and Phe159 in SGL-1 and SGL-3 seal the active site completely, forming the hydrophobic pocket for the exocyclic substituent of the substrate [17]. The hydrophobic feature of the substrate-binding pocket has been proposed to be crucial for the substrate specificity of Hyds [10,32]. Particularly, the hydrophobic and bulky side chains of Phe152, Tyr155, and Phe159 in SGL-3 directed toward the active site of BsDHyd have been found to closely interact with the chiral exocyclic substituent of the substrate [32]. The corresponding residues in BaDHP were Met63, Phe65, Phe152, Tyr155, and Leu159. We have resolved the 2.3 A˚ crystal structure of BaDHP (accession number Q846U5 in the ExPASY website). Since BaDHP shows 73% sequence identity with BsDHyd, the homology model of BaDHP was built with a protein structure program Insight II using the resolution crystal structure of BsDHyd (PDB code, 1K1D) as the template. As shown in Fig. 2A, the homology model is perfectly superimposed with the subunit structure of BsDHyd. Structural similarities between BaDHP and BsDHyd further extend to active sites (Fig. 2B). The deduced BaDHP active site including zinc ion and its ligands could be superimposed onto the equivalent zinc ion and protein ligands of BsDHyd. 3.3. Site-directed mutagenesis at the putative residues responsible for catalytic activity Owing to the potential importance of residues Met63, Phe65, Leu94, Phe152, Tyr155, and Leu159 in the substrate binding of BaDHP (Fig. 2B), they were targeted to site-directed mutagenesis. After confirmation of the altered sequences, pETX-BaDHP and each of the mutated plasmids were transformed into E. coli Novablue for IPTG-induced gene expression. SDS/PAGE analysis of the total cell proteins revealed that the mutant enzymes had an apparent molecular mass of approximately 51 kDa (data not shown). The wild-type and mutant enzymes in the crude extracts were further purified to near homogeneity by a Ni2+-NTA resin (data not shown). For the recombinant enzymes, the purification procedure resulted in a yield of 48–63% of the wild-type enzyme. Met63 of the SGL-1 in BaDHP was replaced with phenylalanine and the mutational effect was examined. The substitution led to a decrease in the enzyme activity to L-HPAH (Table 3). Met63 was also substituted with Ala and the mutant enzyme exhibited a higher activity toward L-HPAH. Leu 65 of BsDHyd has been changed to Phe or Ala; however, the mutant enzymes only show little or no catalytic improvement for the aromatic substrate [13]. In contrast, replacement of the corresponding residue (Phe65) in SGL-1 of BaDHP with Ala led to about 2.5-fold increase in enzyme activity toward L-HPAH (Table 3). It has been demonstrated that substitution of Phe152, which constitutes the hydrophobic lid of the substrate-binding pocket, in SGL-3 of BsDHyd with Ala resulted in a noticeable impact on enzyme activity for hydantoin and p-hydroxyphenylhydantoin [13]. In our case, the replacement of the corresponding residue, Phe152, in SGL-3 of BaDHP also considerably lowered the activity to L-HPAH (Table 3). In the substrate-binding pocket of BsDHyd, Tyr155 also closely interacts with the exocyclic substituent of the

312

C.-K. Lo et al. / Process Biochemistry 44 (2009) 309–315

Fig. 1. Alignment of the predicted amino acid sequence of BaDHP with some DHPs and Hyds. The amino acid sequence for BaDHP, Bacillus sp. AR9 D-Hyd (B9DHyd), B. stearothermophilus D-Hyd (BsDHyd), Thermus sp. DHP (TsDHP), D. discoideum DHP (DdDHP), S. kluyveri DHP (SkDHP), and A. aurescens L-Hyd (AaLHyd) are shown. Gaps in aligned sequences (dashes) were introduced to maximize similarities. The essential metal-binding and catalytic residues are marked by solid circles and a star, respectively.

substrate and this residue has been to play an important role in either the substrate binding or stabilization of the transition state [16,17]. As expected, replacement of Tyr155 in SGL-3 of BaDHP with Ala decreased the specific activity toward L-HPAH by 87% (Table 3). In BsDHyd, Phe159 has been proposed to be one of the major constituents of the hydrophobic lid and have a strong interaction with the exocyclic substituent of the substrate. This residue was replaced with a smaller amino acid, Ala, to enlarge the substrate-binding pocket in the nearby of the exocyclic substituent and the resulting mutant F159A has been shown to display a remarkable change in the substrate specificity [13]. Consistently, the replacement of the corresponding Leu159 residue with Ala, Ile, Val, Phe or Thr resulted in the mutant enzymes, with increase in the activity to L-HPAH (Table 3). 3.4. Conversion of D,L-HPAH to L-HPA In the hydantoinase process, we used the purified wild-type BaDHP and B. kaustophilus L-N-carbamoylase with hydrolytic activity toward N-carbamoyl-L-homophenylalanine [24] for the

conversion of racemic HPAH to L-HPA. As shown in Fig. 3A, the conversion yield reached only about 39% with a productivity of 0.58 mmol L-HPA l1 h1 in a 6 h reaction. Except the accumulation of about 3.6 mM NC-D-HPA, approximately 1.8 mM racemic HPAH was also remained in the reaction mixture. This might be due to the lower activity of wild-type BaDHP to L-HPAH. When the L159V variant, an enzyme mutant with the highest activity to L-HPAH, was used instead of the wild-type BaDHP as biocatalyst in the reaction mixture, the conversion yield could be increased to about 61% with a productivity of 1.83 mmol L-HPA l1 h1 in a 3 h reaction (Fig. 3B). However, significant amount of intermediate, NC-D-HPA, was still accumulated in the reaction mixture in a 8 h reaction. Based on this fact, a D. radiodurans N-acylamino acid racemase with racemization activity toward chiral N-carbamoyl-homophenylalanine [33] was also introduced into the process for the improvement of L-HPA production. As shown in Fig. 4, the conversion yield could reach 90% in a 4.5 h reaction. Moreover, we observed that the amount of NC-D-HPA in reaction mixture was time-dependent and decreased gradually. Also, the accumulation

C.-K. Lo et al. / Process Biochemistry 44 (2009) 309–315

a

Fig. 2. (A) Superimposed monomers of BaDHP and BsDHyd. The C traces of BaDHP a and BsDHyd are in blue and red, respectively. The overall r.m.s.d. in the C atom position between the superimposed monomers is 0.629 A˚. (B) Superposition of the binding pockets among BaDHP (green), BsDHyd (blue) and SkDHP (orange). Residues corresponding to M63, F65, L94, KCX150, Y155, and L159 and the bound dihydrouracil (DUC) in SkDHP are shown as sticks. The zinc atoms are shown as balls. Three loops, SGL-1, -2, -3 are indicated. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

of NC-D-HPA was lower than in reaction mixture without Nacylamino acid racemase, indicating that NC-D-HPA could be transformed into NC-L-HPA by N-acylamino acid racemase. The wild-type BaDHP coupled with B. kaustophilus L-N-carbamoylase and N-acylamino acid racemase also achieved the same conversion

313

Fig. 3. Profiles of L-HPA production using the purified wild-type BaDHP or L159V variant coupled with B. kaustophilus L-N-carbamoylase. The reaction mixture (100 ml) containing 9 mM D,L-HPAH, 1 mM MnCl2, 100 mM Tris–HCl buffer (pH 8.0), and 3 U of each enzyme was incubated at 50 8C. Symbols: 4, D,L-HPAH; &, NC-DHPA; &, NC-L-HPA; *, L-HPA.

yield, but the amount of wild-type enzyme used in the process was approximately 5 times to that of L159V (data not shown). 4. Discussion In this study, we observed that the specific activity of BaDHP to chiral HPAH can be changed by metal ions either in the culture medium (Table 2) or in the reaction mixture. DHPs are reported to

Table 3 Relative activity of wild-type and mutant enzymes to HPAH. Enzyme

Wild-type M63A M63F F65A L94A F152A Y155A L159A L159I L159V L159F L159T

Relative activity (%)a L-HPAH

D-HPAH

100 383  2.6 42  2.2 353  7.6 154  1.2 7  1.0 13  1.0 277  5.9 135  7.2 569  4.6 188  8.5 127  4.2

100 96  0.6 96  1.2 95  1.0 103  3.1 107  2.3 115  7.2 96  2.1 112  3.8 91  2.9 102  4.7 98  2.1

a The rate of hydrolysis is expressed as a percentage of the activity, where 100% activity for substrates L-HPAH and D-HPAH corresponds to 2.6 and 18.5 U/mg protein, respectively.

Fig. 4. Profiles of L-HPA production using the purified L159V coupled with B. kaustophilus L-N-carbamoylase and D. radiodurans N-acylamino acid racemase. The reaction mixture (100 ml) containing 9 mM D,L-HPAH, 1 mM MnCl2, 1 mM CoCl2, 100 mM Tris–HCl buffer (pH 8.0), and 3 U of each enzyme was incubated at 50 8C. Symbols: 4, D,L-HPAH; &, NC-D-HPA; &, NC-L-HPA; *, L-HPA.

314

C.-K. Lo et al. / Process Biochemistry 44 (2009) 309–315

be metal-dependent since chelators lead to an inactivation of the enzymes and the addition of different metals will restore their activity [2,31,34]. DHPs from bovine [2] and rat liver [3] are homotetrameric enzymes with native molecular masses of 226 and 215 kDa, respectively. Both enzymes contain about 1 mol Zn2+/ mol subunit, as determined by atomic absorption analysis. Other DHPs from bacteria compare well in terms of subunit composition and molecular masses [35,36,37]. It has been demonstrated that zinc ion have a catalytic and a structural function for A. aurescens Hyd [38]. In hydrolases, the catalytic function of zinc ion can be to activate water by promoting its nucleophilicity through decreasing its pKa [39]. However, B. stearothermophilus SD-1 DHP differs in the kind of metal bound to the enzyme, to which the pre-incubation with MnCl2 might lead to an exchange of a previously bound metal [40]. Accordingly, it is likely that Mn2+ ions in the culture medium or in the reaction mixture exchange with the enzyme-bound metal, but the reason for the Mn-coordinated BaDHP with the highest activity toward HPAH remains to be elucidated. Hyds can differ significantly in their substrate and stereospecificities [41] and are commonly classified as D, L, and nonselective [21]. This classification became ambiguous with the identification of A. aurescens Hyd, which shows a substratedependent enantioselectivity [42]. The emergence of structural models for several Hyds enabled comparative studies with the aim to reveal the structural basis for their distinct substrate specificities and stereoselectivities. Cheon et al. [17] identified three hydrophobic loop regions involving in the binding of the exocyclic ring substituents in BsDHyd, in which amino acid composition defines the particular substrate preference of the enzyme. The conformation of these SGLs are well conserved among BaDHP, BsDHyd, Thermus sp. DHP, Bacillus sp. AR9 D-Hyd, S. kluyveri DHP, and D. discoideum DHP (Fig. 1). In site-directed mutagenesis at positions 63 and 65 of BaDHP SGL-1, the resulting mutant enzymes, M63A and F65A, exhibited a considerably higher specific activities toward L-HPAH than that of the wild-type enzyme. The smaller amino acids residues (Ala and Val) at position 159 also induced higher activity for L-HPAH. Since the phenyl ring of HPAH positioned distantly from the binding pocket of BaDHP, it seems that the mutations such as M63A, F65A and L159V have other effects rather than enlargement of the substrate binding pocket which enables a favorable orientation of the exocyclic group of LHPAH in the active site. In this study, the specific activity of BaDHP was increased by directed evolution technique. The specific activity toward L-HPAH was achieved by single amino acid mutation. For M63A, F65A, and L159V, the activity to L-HPAH was improved by more than 2.5-fold. Optically pure amino acids are currently used as intermediates for the synthesis of pharmaceuticals such as semisynthetic antibiotics, pepticides, and food additives. For efficient synthesis of L-amino acid, we developed a hydantoinase process composed of L159V, BkLNC, and DrNAAR. This system has been shown to shorten the reaction time and to improve the conversion yield for L-HPA production. Acknowledgement This work was supported by the Grant 95AS-6.1.3-FD-EZ1-(1) from the Council of Agriculture, Taiwan. References [1] Gojkovic Z, Rislund L, Andersen B, Sandrini MP, Cook PF, Schnackerz KD, Piskur J. Dihydropyrimidine amidohydrolases and dihydroorotases share the same origin and several enzymatic properties. Nucleic Acids Res 2003;31:1683–92. [2] Brooks KP, Jones EA, Kim BD, Sander EG. Bovine liver dihydropyrimidine amidohydrolase: purification, properties, and characterization as a zinc metalloenzyme. Arch Biochem Biophys 1983;226:469–83.

[3] Kikugawa M, Kaneko M, Fujimoto-Sakata S, Maeda M, Kawasaki K, Takagi T, Tamaki N. Purification, characterization and inhibition of dihydropyrimidinase from rat liver. Eur J Biochem 1994;219:393–9. [4] Matsuda K, Sakata S, Kaneko M, Hamajima N, Nonaka M, Sasaki M, Tamaki N. Molecular cloning and sequencing of a cDNA encoding dihydropyrimidinase from the rat liver. Biochim Biophys Acta 1996;1307:140–4. [5] Wallach DP, Grisolia S. The purification and properties of hydropyrimidine hydrase. J Biol Chem 1957;226:277–88. [6] Wasternack C. Degradation of pyrimidines and pyrimidine analogs pathways and mutual influences. Pharmacol Ther 1980;8:629–51. [7] Dudley KH, Butler TC, Bius DL. The role of dihydropyrimidinase in the metabolism of some hydantoin and succinimide drugs. Drug Metab Dispos 1974;2:103–12. [8] Kim GJ, Kim HS. Identification of the structural similarity in the functionally related amidohydrolases acting on the cyclic amide ring. Biochem J 1998;330(Pt 1):295–302. [9] Nam SH, Park HS, Kim HS. Evolutionary relationship and application of a superfamily of cyclic amidohydrolase enzymes. Chem Rec 2005;5:298–307. [10] Syldatk C, May O, Altenbuchner J, Mattes R, Siemann M. Microbial hydantoinases—industrial enzymes from the origin of life? Appl Microbiol Biotechnol 1999;51:293–309. [11] Farber GK, Petsko GA. The evolution of alpha/beta barrel enzymes. Trends Biochem Sci 1990;15:228–34. [12] Wierenga RK. The TIM-barrel fold: a versatile framework for efficient enzymes. FEBS Lett 2001;492:193–8. [13] Cheon YH, Park HS, Kim JH, Kim Y, Kim HS. Manipulation of the active site loops of D-hydantoinase, a (beta/alpha)8-barrel protein, for modulation of the substrate specificity. Biochemistry 2004;43:7413–20. [14] May O, Nguyen PT, Arnold FH. Inverting enantioselectivity by directed evolution of hydantoinase for improved production of L-methionine. Nat Biotechnol 2000;18:317–20. [15] Abendroth J, Niefind K, May O, Siemann M, Syldatk C, Schomburg D. The structure of L-hydantoinase from Arthrobacter aurescens leads to an understanding of dihydropyrimidinase substrate and enantio specificity. Biochemistry 2002;41:8589–97. [16] Abendroth J, Niefind K, Schomburg D. X-ray structure of a dihydropyrimidinase from Thermus sp. at 1.3 A˚ resolution. J Mol Biol 2002;320:143–56. [17] Cheon YH, Kim HS, Han KH, Abendroth J, Niefind K, Schomburg D, Wang J, Kim Y. Crystal structure of D-hydantoinase from Bacillus stearothermophilus: insight into the stereochemistry of enantioselectivity. Biochemistry 2002;41:9410–7. [18] Radha Kishan KV, Vohra RM, Ganesan K, Agrawal V, Sharma VM, Sharma R. Molecular structure of D-hydantoinase from Bacillus sp. AR9: evidence for mercury inhibition. J Mol Biol 2005;347:95–105. [19] Xu Z, Liu Y, Yang Y, Jiang W, Arnold E, Ding J. Crystal structure of D-Hydantoinase from Burkholderia pickettii at a resolution of 2.7 Angstroms: insights into the molecular basis of enzyme thermostability. J Bacteriol 2003;185:4038–49. [20] Stinson SC. Chiral drugs. Chem Eng News 2000;78:55–78. [21] Ogawa J, Shimizu S. Diversity and versatility of microbial hydantoin-transforming enzymes. J Mol Catal B Enzym 1997;2:163–76. [22] Olivieri R, Fascetti E, Angelini L, Degen L. Microbial transformation of racemic hydantoins to D-amino acids. Biotechnol Bioeng 1981;23:2173–83. [23] Kao CH, Hsu WH. A gene cluster involved in pyrimidine reductive catabolism from Brevibacillus agri NCHU1002. Biochem Biophys Res Commun 2003;303:848–54. [24] Hu HY, Hsu WH, Chien HR. Characterization and phylogenetic analysis of a thermostable N-carbamoyl-L-amino acid amidohydrolase from Bacillus kaustophilus CCRC11223. Arch Microbiol 2003;179:250–7. [25] Hsu SK, Lo HH, Kao CH, Lee DS, Hsu WH. Enantioselective synthesis of Lhomophenylalanine by whole cells of recombinant Escherichia coli expressing L-aminoacylase and N-acylamino acid racemase genes from Deinococcus radiodurans BCRC12827. Biotechnol Prog 2006;22:1578–84. [26] Sambrook J, Russell DW. Molecular cloning. A laboratory manual, 3rd ed., Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001. [27] Dagert M, Ehrlich SD. Prolonged incubation in calcium chloride improves the competence of Escherichia coli cells. Gene 1979;6:23–8. [28] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. [29] Kao CH, Lo HH, Hsu SK, Hsu WH. A novel hydantoinase process using recombinant Escherichia coli cells with dihydropyrimidinase and L-N-carbamoylase activities as biocatalyst for the production of L-homophenylalanine. J Biotechnol 2008;134:231–9. [30] Tokuyama S, Hatano K. Purification and properties of thermostable N-acylamino acid racemase from Amycolatopsis sp. TS-1-60. Appl Microbiol Biotechnol 1995;42:853–9. [31] Syldatk C, Cotoras D, Dombach G, Groß C, Kallwaß H, Wagner F. Substrate- and stereospecificity, induction and metallo-dependence of a microbial hydantoinase. Biotechnol Lett 1987;9:25–30. [32] Cheon YH, Park HS, Lee SC, Lee DE, Kim HS. Structure-based mutational analysis of the active site residues of D-hydantoinase. J Mol Catal B Enzym 2003;26:217–22. [33] Hsu SK, Lo HH, Lin WD, Chen IC, Kao CH, Hsu WH. Stereoselective synthesis of L-homophenylalanine using the carbamoylase method with in situ racemization via N-acylamino acid racemase. Process Biochem 2007;42:856–62. [34] Ogawa J, Soong CL, Honda M, Shimizu S. Imidase, a dihydropyrimidinase-like enzyme involved in the metabolism of cyclic imides. Eur J Biochem 1997;243:322–7.

C.-K. Lo et al. / Process Biochemistry 44 (2009) 309–315 [35] Morin A, Hummel W, Schutte H, Kula MR. Characterization of hydantoinase from Pseudomonas fluorescens strain DSM 84. Biotechnol Appl Biochem 1986;8:564–74. [36] Siemann M, Alvarado-Marin A, Pietzsch M, Syldatk C. A D-specific hydantoin amidohydrolase: properties of the metalloenzyme purified from Arthrobacter crystallopoietes. J Mol Catal B Enzym 1999;6:387–97. [37] Takahashi S, Kii Y, Kumagai H, Yamada H. Purification, crystallization and properties of hydantoinase from Pseudomonas striata. J Ferment Technol 1978;56:492–8. [38] May O, Siemann M, Syldatk C. Catalytic and structural function of zinc for the hydantoinase from Arthrobacter aurescens DSM 3745. J Mol Catal B Enzym 1998;4:211–8.

315

[39] Groves JT, Olson JR. Models of zinc-containing proteases: rapid amide hydrolysis by an unusually acidic Zn2+-OH2 complex. Inorg Chem 1985; 24:2715–7. [40] Lee SG, Lee DC, Kim HS. Purification and characterization of thermostable Dhydantoinase from thermophilic Bacillus stearothermophilus SD-1. Appl Biochem Biotechnol 1997;62:251–66. [41] Cecere F, Galli G, Morisi F. Substrate and steric specificity of hydropyrimidine hydrase. FEBS Lett 1975;57:192–4. [42] May O, Siemann M, Pietzsch M, Kiess M, Mattes R, Syldatk C. Substratedependent enantioselectivity of a novel hydantoinase from Arthrobacter aurescens DSM 3745: purification and characterization as new member of cyclic amidases. J Biotechnol 1998;61:1–13.